ID: 1059636077

View in Genome Browser
Species Human (GRCh38)
Location 9:116171883-116171905
Sequence AAGCAGAAGCTGATTGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059636074_1059636077 6 Left 1059636074 9:116171854-116171876 CCAAACACATCCGCCTGCAGTGT 0: 1
1: 0
2: 1
3: 6
4: 98
Right 1059636077 9:116171883-116171905 AAGCAGAAGCTGATTGAAGAAGG No data
1059636075_1059636077 -4 Left 1059636075 9:116171864-116171886 CCGCCTGCAGTGTTATCTGAAGC 0: 1
1: 0
2: 0
3: 12
4: 150
Right 1059636077 9:116171883-116171905 AAGCAGAAGCTGATTGAAGAAGG No data
1059636073_1059636077 7 Left 1059636073 9:116171853-116171875 CCCAAACACATCCGCCTGCAGTG 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1059636077 9:116171883-116171905 AAGCAGAAGCTGATTGAAGAAGG No data
1059636076_1059636077 -7 Left 1059636076 9:116171867-116171889 CCTGCAGTGTTATCTGAAGCAGA 0: 1
1: 0
2: 0
3: 18
4: 162
Right 1059636077 9:116171883-116171905 AAGCAGAAGCTGATTGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059636077 Original CRISPR AAGCAGAAGCTGATTGAAGA AGG Intronic
No off target data available for this crispr