ID: 1059647132

View in Genome Browser
Species Human (GRCh38)
Location 9:116278944-116278966
Sequence ATTGAGATAGGCAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 340}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059647132_1059647137 21 Left 1059647132 9:116278944-116278966 CCTTCCTCATTGCCTATCTCAAT 0: 1
1: 0
2: 1
3: 27
4: 340
Right 1059647137 9:116278988-116279010 CAACCCATCATCAGCAAAAATGG No data
1059647132_1059647135 -6 Left 1059647132 9:116278944-116278966 CCTTCCTCATTGCCTATCTCAAT 0: 1
1: 0
2: 1
3: 27
4: 340
Right 1059647135 9:116278961-116278983 CTCAATTGTGACTGATGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059647132 Original CRISPR ATTGAGATAGGCAATGAGGA AGG (reversed) Intronic
900356369 1:2266755-2266777 AATGAGATAGAAAATGAAGATGG + Intronic
900771988 1:4552570-4552592 ACTGTGATGGGCACTGAGGATGG + Intergenic
901091171 1:6642541-6642563 ACTGAGATAGGAAAGGAGGCTGG + Intronic
902677405 1:18018351-18018373 ATTGAGGAAGGGAGTGAGGAAGG - Intergenic
903197044 1:21698136-21698158 ACTGAGATATGTGATGAGGAGGG + Intronic
903335228 1:22620069-22620091 AGTGAGAGAGACAATTAGGAGGG + Intergenic
904069218 1:27780125-27780147 ATTTAGATAGCCAATGAGGTAGG - Intronic
904288164 1:29466972-29466994 TTAGAGATAGGCAAAGAGGTAGG - Intergenic
905240858 1:36580667-36580689 ATTGGGAAGGACAATGAGGAGGG + Intergenic
906214134 1:44029528-44029550 ATTGGGATAGGTTTTGAGGATGG - Intronic
906495370 1:46301659-46301681 TTTGAGTTATGCCATGAGGAGGG - Intronic
907594404 1:55706084-55706106 ATTGAGATAAGCAATATGCATGG + Intergenic
907603847 1:55795677-55795699 ATTGATATGGGGAATTAGGAAGG + Intergenic
908485581 1:64589205-64589227 ATTGATATAGTCACTGTGGAAGG + Intronic
908880317 1:68724589-68724611 ATTGAGATATCCAAGGAGGGAGG + Intergenic
908922549 1:69212847-69212869 ATTGAGATAGGGAAGTGGGAAGG + Intergenic
908986086 1:70023532-70023554 ATTGACATTGGCAATGGGGTGGG + Intronic
908993207 1:70119464-70119486 ATTGTGCTAGGCACTGGGGATGG - Intronic
911933886 1:103941578-103941600 TTTGTGATGGGCAATGAGGGAGG - Intergenic
914996716 1:152549750-152549772 ATTCAGTTAGGAAAAGAGGAAGG - Intronic
915066978 1:153232763-153232785 TTTGTGACAGGCCATGAGGAGGG + Intergenic
915852351 1:159338879-159338901 ATTGAGATAGGCAACGTGTATGG + Intergenic
915894252 1:159799087-159799109 ATGGAGAGAGGGAATGAGGGTGG + Intergenic
916587681 1:166162890-166162912 ATTCAGGTAGGCAAGGAGGAGGG - Intronic
916922996 1:169488064-169488086 AATCACATAGGCAATGAGGTTGG + Intergenic
918300499 1:183199485-183199507 ATTGAGGGAGGGAATGAGGGAGG - Intronic
918964579 1:191325773-191325795 ATTGAGATATCCAATCAGGTTGG - Intergenic
919343153 1:196339600-196339622 ATGAAGTTAGGTAATGAGGAGGG + Intronic
919517123 1:198539722-198539744 ATAAAGATAAGCAATGAGCATGG + Intronic
920256544 1:204659114-204659136 ACTGAGAAATGTAATGAGGATGG - Intronic
921284408 1:213596178-213596200 ATTAAGACAGGCTATGAAGATGG + Intergenic
921688694 1:218121888-218121910 ATTGAGATGGGCAACCAGAATGG - Intergenic
923319248 1:232813991-232814013 AGTGAGAAAGGCAATGAATATGG - Intergenic
923886743 1:238165482-238165504 ATTGAAAGAGGCATTGAGGAGGG - Intergenic
924679986 1:246221326-246221348 AATGAGGTATGCAATGTGGAGGG - Intronic
1063999796 10:11654064-11654086 TTTGAAATGTGCAATGAGGAAGG + Intergenic
1065921698 10:30398842-30398864 ACTGAAAGAGGCACTGAGGAGGG + Intergenic
1066649860 10:37643781-37643803 ACTGAAAGAGGCACTGAGGAGGG - Intergenic
1067970093 10:50959896-50959918 ATTTATATAGGCAGTGAGCAGGG + Intergenic
1068033759 10:51735031-51735053 AGTGAGATAGGGAATTAGGTAGG + Intronic
1068749876 10:60580208-60580230 ATCAAGATAATCAATGAGGATGG + Intronic
1070658256 10:78285950-78285972 AGAGAGACAGACAATGAGGAGGG - Intergenic
1071095566 10:81970190-81970212 AGTAAAATAGGCAGTGAGGAAGG + Intronic
1071393590 10:85199652-85199674 AGTGAGAGAGGGAAGGAGGAAGG + Intergenic
1072038422 10:91585315-91585337 TTTGAGATAGCCCATGAGGCAGG - Intergenic
1072046780 10:91664636-91664658 AGTGAGTTAGCCAAAGAGGATGG + Intergenic
1073267330 10:102235679-102235701 ATTGAGTTAGGCACTGAGGGTGG + Intronic
1073868005 10:107827419-107827441 ATTGAGTAAGGCAATGAAAAAGG - Intergenic
1074128444 10:110551309-110551331 ATTAAAATAGGAAATGAAGAGGG - Intergenic
1075359055 10:121813327-121813349 GTTGAGATGGAGAATGAGGAGGG - Intronic
1077835350 11:5922534-5922556 ATGGAAAGAGGCATTGAGGAGGG + Intronic
1078727910 11:13948422-13948444 ATTTAGCTTGGCAAAGAGGATGG + Intergenic
1078954980 11:16183159-16183181 TTTGAGATAGGCAAGGAAAATGG - Intronic
1079055921 11:17207060-17207082 ATTGAGGAGGGAAATGAGGAAGG - Intronic
1079239432 11:18712213-18712235 ATTAAGATAGGCGAGGTGGACGG - Exonic
1079520412 11:21319808-21319830 ATTGATATAGGTAATGTGGAAGG + Intronic
1080161184 11:29178964-29178986 AGTCAGAGAGGCAATGAGAAAGG - Intergenic
1080371068 11:31644165-31644187 ATCCAGATGGGCAAGGAGGAGGG + Intronic
1087528112 11:99344286-99344308 ATTGAGGTAAACAATGAGAAAGG - Intronic
1087691166 11:101321660-101321682 ATTGAAAGAGGCATTGAGGAGGG - Intergenic
1087887454 11:103497038-103497060 ACTGAAAAAGGCATTGAGGAAGG + Intergenic
1088986097 11:114909903-114909925 GTTGACACAGGCAAGGAGGAGGG - Intergenic
1089095996 11:115920523-115920545 AATGAGAGAGACAATGATGAAGG - Intergenic
1090408720 11:126493077-126493099 AGTGAGGTAGGCAGTGAGGTAGG + Intronic
1092254301 12:6917801-6917823 ATTGAGGGAGGTAAAGAGGAAGG + Intronic
1092254719 12:6920280-6920302 ATTTGGATTAGCAATGAGGAAGG + Intronic
1092829750 12:12432279-12432301 ATTGAAAGAGGAAAAGAGGAAGG - Intronic
1093241794 12:16685973-16685995 ATTGAGGAAGGGAAGGAGGAGGG - Intergenic
1093530355 12:20154569-20154591 ATTGAAATCAGCAGTGAGGAAGG + Intergenic
1093694371 12:22143616-22143638 ACTGAAAGAGGCAATGAAGAGGG + Intronic
1094738593 12:33262601-33262623 ATTTAGATAGGCAGAGAAGATGG + Intergenic
1097060877 12:56282801-56282823 TTAGAGAAAGGCAATGAAGAAGG + Intronic
1097497570 12:60359931-60359953 CTTCAAATAGGCATTGAGGAGGG - Intergenic
1098046576 12:66407422-66407444 ATTGAAAGAGGCACTGAAGAGGG + Intronic
1098392443 12:69983824-69983846 ATTGAGGTAGGTAATTAGGATGG - Intergenic
1098531183 12:71543433-71543455 ATTCAGATAGGCAGTGGGTAGGG + Intronic
1099303360 12:80925129-80925151 ACTGTGATAGGCAATGAGTACGG + Intronic
1099562354 12:84193689-84193711 ACTGAAAGAGGCATTGAGGAAGG - Intergenic
1100708647 12:97229357-97229379 AATGAGATGAGCAATGAGGGGGG - Intergenic
1101231307 12:102744389-102744411 ATTTAGATAAGAAATGGGGAAGG - Intergenic
1101805063 12:108056429-108056451 AAGGAGACAGGCATTGAGGATGG - Intergenic
1102007686 12:109598841-109598863 ACTGCAATAGGCAATGAGAAGGG - Intergenic
1103000501 12:117382098-117382120 ATTGAGCTAGGTAAAGAGCAGGG - Intronic
1105702267 13:22942470-22942492 ATTGAGTTAGACAATGAAAATGG + Intergenic
1105854886 13:24364255-24364277 ATTGAGTTAGACAATGAAAATGG + Intergenic
1106058878 13:26265992-26266014 AGTGAGAGAGGGGATGAGGAGGG + Intronic
1106845622 13:33735147-33735169 ATTTAAATAGGCAAAGAGAAAGG + Intergenic
1107210739 13:37851719-37851741 ATTGAAAGAGGCATTGAGGAGGG + Intronic
1107726933 13:43308299-43308321 ACTGACATAGGCAATGATAAAGG - Intronic
1107915284 13:45143708-45143730 ATTGGGAGAGGCAGAGAGGAGGG + Intronic
1108132731 13:47320542-47320564 ATTGGGATGGGCAGTTAGGAGGG + Intergenic
1108256077 13:48612202-48612224 ATTGAAAGAGGCATTGAAGAGGG - Intergenic
1108881109 13:55117298-55117320 ATTGAGTTGGACATTGAGGATGG + Intergenic
1108967058 13:56321596-56321618 ATTGAGAGAAGCAATGAGATGGG - Intergenic
1111201228 13:84940191-84940213 ACTGGGATAGGCATTTAGGAAGG - Intergenic
1111235587 13:85404031-85404053 CTGGAGATAGACAGTGAGGATGG - Intergenic
1112196384 13:97230563-97230585 ACAGAGATAGGCAATGACAAAGG + Intronic
1113268830 13:108649761-108649783 ATTAAGACTTGCAATGAGGAGGG + Intronic
1114898615 14:27027218-27027240 ATTAAGAGAGGCACTGAAGAGGG - Intergenic
1115475212 14:33806782-33806804 ATTGAGCTAGGCACTATGGAAGG - Intergenic
1116550277 14:46228797-46228819 CTTGAGATAGGAAATGAGGAAGG - Intergenic
1116888923 14:50248881-50248903 TTTGAAAGAGGCATTGAGGAGGG + Intronic
1116966809 14:51023301-51023323 ATTCAAAAAGGCAATGAGGAGGG + Intronic
1117109412 14:52434604-52434626 ATTAAGATATGCAATAAGTAAGG + Intronic
1117233862 14:53751464-53751486 ATTGAAAGAGGCATTGAGGAAGG + Intergenic
1119043136 14:71293631-71293653 ATTGAGACAGGATATGTGGAGGG - Intergenic
1119819197 14:77599551-77599573 ATTCAGATAGGCATGGAAGATGG + Intronic
1119913878 14:78377501-78377523 ATTGATATAGGAAATCAGCAAGG + Intronic
1121149663 14:91620508-91620530 ACTGAGATAGGAAGAGAGGAAGG - Intronic
1125385015 15:39128078-39128100 ATTGAGATAAGCAATTAGTTTGG + Intergenic
1126687850 15:51264085-51264107 ATGGACATAGGCAAAGTGGAGGG + Intronic
1126725569 15:51628204-51628226 AGTGAAATAGGCAAAGAGTATGG - Intergenic
1127178157 15:56383310-56383332 ATTGAAAGAGGCATTGAAGAAGG - Intronic
1127576055 15:60293602-60293624 ATAGAGATAGGCCAAGAAGAAGG + Intergenic
1129880974 15:79005813-79005835 AAAGAGAAAGGAAATGAGGAGGG - Intronic
1130853174 15:87817918-87817940 AAAGAGATAGGCCATGAGGGAGG + Intergenic
1130961585 15:88663090-88663112 ACTGAAATAGGCACTGAAGAGGG + Intergenic
1132026179 15:98406116-98406138 ATTCAGGTAGGCACAGAGGAAGG + Intergenic
1132040904 15:98523975-98523997 TTTGAGATGGGCCTTGAGGATGG - Intergenic
1135175204 16:20221705-20221727 ATTGAGATAGGCAAAGAACAAGG - Intergenic
1135604318 16:23810011-23810033 GTTGAGATAGTCAAGGAGGCTGG - Intergenic
1138420271 16:56894537-56894559 AAGGAGATAGGGAATGAGGAGGG - Exonic
1138813528 16:60178273-60178295 ACTGAGAGAGGAAAGGAGGAGGG - Intergenic
1138995928 16:62452623-62452645 AGTTAGATAGGCAATAAGCAGGG - Intergenic
1138999702 16:62494636-62494658 TGTGAAAAAGGCAATGAGGATGG + Intergenic
1140183111 16:72740366-72740388 ATTTAGATAGTGTATGAGGAAGG + Intergenic
1140635209 16:76904709-76904731 ATTGAAATATCAAATGAGGATGG + Intergenic
1144319216 17:14097245-14097267 TTTGAAAAAGGCAGTGAGGACGG - Intronic
1146484474 17:33231853-33231875 ATTGAGATGAGCAATGGGGAGGG + Intronic
1146505215 17:33399091-33399113 ATAGAGATGAGCAAAGAGGAAGG + Intronic
1147310449 17:39592910-39592932 ATTGAGATAAGTAATCAGGTAGG - Intergenic
1147765267 17:42830792-42830814 ATTGAGAAAGTCAAAGGGGATGG + Intronic
1149273428 17:55008390-55008412 ATTCAAATTGGCAATGAGAAAGG - Intronic
1149397817 17:56262731-56262753 AATGAGATAATAAATGAGGATGG + Intronic
1149578944 17:57734467-57734489 ATTGAGACAGGCAGAGAGGATGG - Intergenic
1149656332 17:58311341-58311363 AATGAGATAGGCCATGCAGAGGG - Intronic
1149717288 17:58804505-58804527 ATGGAGATAGGGAAGGGGGATGG + Intronic
1151939571 17:77284011-77284033 ATTGAGCTGGGCCTTGAGGAAGG + Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152370349 17:79884072-79884094 ATGGCGAAAGGCAAGGAGGAAGG - Intergenic
1154490344 18:14917318-14917340 AGAGAGAAAGGCAATGAGAAAGG - Intergenic
1155073791 18:22338171-22338193 CCTGCTATAGGCAATGAGGAAGG + Intergenic
1157483314 18:48069784-48069806 TTTGAGAAAGGCAAGGATGAAGG + Intronic
1157612756 18:48968635-48968657 ATTGAGGTAGGAAAGAAGGAAGG - Intergenic
1157905339 18:51564530-51564552 ATTCAGATAGGGAAAGAGGTGGG - Intergenic
1158304587 18:56090773-56090795 CTTCAGATAAGAAATGAGGAAGG + Intergenic
1158789848 18:60765334-60765356 TTTGAGGTAAGCACTGAGGAAGG - Intergenic
1164482552 19:28624441-28624463 ATTCAGTTAGGAAGTGAGGAAGG - Intergenic
1164810073 19:31148500-31148522 ATTGAGATGGGCTTAGAGGAAGG - Intergenic
1164982207 19:32622555-32622577 CTTGACATTGGCAATGAGAAAGG - Exonic
1165643253 19:37408229-37408251 ATTGAGATAGGTAATCTGGGTGG - Intergenic
1165645249 19:37430755-37430777 ACTGAAAGAGGCACTGAGGAGGG + Intronic
1167413714 19:49359999-49360021 AGTGAGGAAGGCAGTGAGGAGGG - Exonic
1167566511 19:50260963-50260985 ATAGGGAGAGGTAATGAGGAAGG - Intronic
1168113802 19:54209602-54209624 AGGGAGATGGGCAATGAGGGTGG + Intronic
1168321355 19:55511886-55511908 ATTCGGATAGGCAATGAGTATGG + Intronic
1168497707 19:56867873-56867895 ATTCAGATAGGCAAAAAAGATGG - Intergenic
925175771 2:1782612-1782634 ATTCAGATGGGACATGAGGAGGG + Intergenic
925654162 2:6126869-6126891 AGAGAGATAGGAAATGAGGTTGG + Intergenic
926366075 2:12134042-12134064 ATGGAGAGAGGGAAGGAGGATGG - Intergenic
926550167 2:14291828-14291850 ATTGAGATGGGCAGTGGGGGAGG + Intergenic
926723762 2:15981981-15982003 ATTGGGCTAGGCACTGTGGAGGG - Intergenic
926782340 2:16484875-16484897 ATTTGGATAAGCAAAGAGGAAGG + Intergenic
931023677 2:58082232-58082254 ATTGAAATAGGCAAGGAGTCAGG + Intronic
931107373 2:59071168-59071190 ATTCAGATAGGAAGAGAGGAAGG + Intergenic
933446492 2:82386901-82386923 ATTGAAAGAGACATTGAGGAAGG + Intergenic
934870492 2:97860863-97860885 ACTGAAAGAGGCAATGAAGAGGG + Intronic
935726767 2:106030538-106030560 AGTGAGTAAGGCAAGGAGGAAGG + Intergenic
936936018 2:117838933-117838955 ATTGATAAAGTCAGTGAGGAAGG + Intergenic
937507870 2:122557230-122557252 ATTGAGATAGGTAATGCTAAGGG - Intergenic
937659467 2:124413959-124413981 ATTGAGAGATGGAGTGAGGAGGG + Intronic
937677621 2:124609194-124609216 ATAGAGATAAGCAAAGAGGAGGG + Intronic
938599151 2:132819709-132819731 ATTTAAAGAGGGAATGAGGATGG + Intronic
938665025 2:133526150-133526172 ACAGAGAAAGGGAATGAGGAAGG + Intronic
938665502 2:133531155-133531177 ATGGTGAAAGGGAATGAGGAAGG + Intronic
938794968 2:134710339-134710361 TTTGAGTTTGGAAATGAGGAGGG - Intronic
938956936 2:136307557-136307579 ATTTAACTAGGCAAGGAGGAAGG + Intergenic
939165750 2:138639630-138639652 ATAGAGATAAGAAATGAGGTAGG + Intergenic
939166065 2:138642539-138642561 TTAGATATAGGCAATGAGGGAGG - Intergenic
940518983 2:154718553-154718575 ATTGAGGCAGGCAGTTAGGAAGG - Intronic
940795235 2:158070754-158070776 ATTGAAAGAGGCACTGAAGAGGG + Intronic
942307302 2:174621289-174621311 AATGAGACAGGCAATGAAGGAGG + Intronic
942921857 2:181383818-181383840 ATTGAGATCAGCAGTGGGGATGG - Intergenic
944159298 2:196641683-196641705 ACTGTTATAGGCAATGAGGCGGG - Intronic
944265953 2:197726656-197726678 ATTAAGCTAGGCCATGAAGAAGG + Intronic
944943929 2:204661193-204661215 TTTGAGATGGGGAAAGAGGAAGG - Intronic
945309978 2:208300252-208300274 TTTTGGATAGGCAGTGAGGAAGG + Intronic
945762836 2:213935476-213935498 ATTGCGATAGACAATAAAGATGG - Intronic
946497749 2:220213046-220213068 AGGGAGAGAGGCATTGAGGAAGG + Intergenic
948095338 2:235328994-235329016 ATTGAGAAGGGGATTGAGGAGGG + Intergenic
948577817 2:238965540-238965562 AGTGAGATCGGCAGGGAGGAAGG - Intergenic
1169761726 20:9102310-9102332 ATAGAGGTAGCCAATGAAGATGG + Intronic
1170047708 20:12103362-12103384 ATTGTTATAGGCATGGAGGAAGG + Intergenic
1170059460 20:12244318-12244340 GTTGAGAAAGGCACTGAGGCTGG + Intergenic
1170817556 20:19727668-19727690 GGTGGGCTAGGCAATGAGGAAGG + Intergenic
1171274001 20:23839648-23839670 ATTCAATTAGGAAATGAGGAAGG + Intergenic
1171997112 20:31740064-31740086 GTTGAGAAAGGAAATGAGAAAGG - Intronic
1172466223 20:35156746-35156768 ATTGAAATAGACAGTGAGCATGG - Intergenic
1173204353 20:40980880-40980902 GTTGAAAGAGGCAATGAAGAGGG - Intergenic
1175287694 20:57848717-57848739 AGGGAGAAAGGAAATGAGGAAGG - Intergenic
1181415769 22:22757813-22757835 TTTGTCATAGGCAATGGGGAAGG + Intronic
1183362020 22:37387753-37387775 TTTGAGAGAGGCAGTGAGCAGGG - Intronic
1183963855 22:41429485-41429507 ACTGAGTCAGGCAATGATGAGGG + Intergenic
949856951 3:8470544-8470566 AATAAGAAAGACAATGAGGATGG + Intergenic
950173564 3:10855897-10855919 ATCAACATAGGCAAAGAGGAAGG - Intronic
950282872 3:11721651-11721673 ACTCAGACAGGGAATGAGGAAGG + Intergenic
951278440 3:20717796-20717818 ACTGAAATAGGAACTGAGGAAGG - Intergenic
953974985 3:47375620-47375642 AGTCACAGAGGCAATGAGGAGGG - Intergenic
954594443 3:51813276-51813298 AGTGTGATAGGAAGTGAGGAAGG - Intergenic
954921815 3:54197860-54197882 TTGGAGATAGGAAATGGGGAAGG - Intronic
955502214 3:59596795-59596817 ATTGAGACTGGCAATGTGGAAGG + Intergenic
956469517 3:69551834-69551856 ATTAAGGTAGACAATGTGGACGG - Intergenic
957907736 3:86579064-86579086 ATTGCAAGAGGCATTGAGGAGGG - Intergenic
959716528 3:109439479-109439501 TTTGAGGTAGGAGATGAGGAAGG + Intergenic
959963906 3:112332870-112332892 ACTGAGAAAGGAAATGAGGTGGG - Intronic
960719160 3:120608630-120608652 AATGACATGTGCAATGAGGAAGG + Intergenic
960862931 3:122169610-122169632 ACTGAAAGAGGCACTGAGGAGGG - Intergenic
961204126 3:125067400-125067422 ATTGACAGTGGGAATGAGGAAGG + Intergenic
961801461 3:129453322-129453344 ACTGAGAGTGGCAATGGGGAAGG + Intronic
962393229 3:134991776-134991798 ACTGACTTAGGGAATGAGGAGGG - Intronic
962842847 3:139251467-139251489 ATGGAGATAGTCAAGGAGTAAGG - Intronic
963247622 3:143077137-143077159 AAGAAGATAGGCAGTGAGGAAGG - Intergenic
963319300 3:143795809-143795831 ATTGGGACTGGCAATGAGGAAGG + Intronic
964059969 3:152509439-152509461 ATTAAGATAGACAGTGAGGCGGG + Intergenic
965274427 3:166662993-166663015 GTTGAAACAGGCATTGAGGAGGG - Intergenic
967470245 3:189852604-189852626 ATTCAGACAAGAAATGAGGAAGG - Intronic
970166505 4:13243595-13243617 ACTGAGATGGGCCATGAGAAAGG - Intergenic
970951920 4:21766276-21766298 ATTGAGATAGTAAATGAGATCGG - Intronic
970979715 4:22082078-22082100 GTGGTGAGAGGCAATGAGGAGGG + Intergenic
971510401 4:27417049-27417071 ATTTGGATAAGTAATGAGGAGGG + Intergenic
971642505 4:29153849-29153871 ATGGAGGAAGGCAAAGAGGAAGG + Intergenic
971689569 4:29815399-29815421 AGTGAGATAGGGCAGGAGGAGGG + Intergenic
973172787 4:47166030-47166052 ATTGAGATAGGAAATGGGCCAGG - Intronic
976284623 4:83359544-83359566 CTTTAGATAAGCAGTGAGGAGGG + Intergenic
976532148 4:86167909-86167931 ATTCAAATAGGAAAAGAGGAAGG + Intronic
977325820 4:95573190-95573212 ATTGAAAGAGGCATTGAAGAGGG - Intergenic
977346017 4:95817211-95817233 ATTGAGATAGGAAATAAAAAGGG - Intergenic
978212787 4:106157708-106157730 ACTGAAAAAGGCACTGAGGAGGG - Intronic
978497668 4:109377570-109377592 AGTGAGAGAGGAAATCAGGAAGG + Intergenic
978769022 4:112434223-112434245 ATTGAGAGAAGAAAAGAGGAAGG - Intronic
978963337 4:114710921-114710943 AATGTGAGAGGCAATGGGGAGGG - Intergenic
979960513 4:127015311-127015333 ATTGGGATGAGGAATGAGGAAGG - Intergenic
980860590 4:138495138-138495160 ATTGAGTGAGGCAATGGGGTTGG + Intergenic
982392640 4:154882316-154882338 AAGGAGATAGGGAAGGAGGAAGG + Intergenic
982821799 4:159949891-159949913 ATAGAGATAGGTAAGTAGGAAGG - Intergenic
983500013 4:168487963-168487985 ATTGCGTGAGGCAATGAAGAGGG + Intronic
983897289 4:173095252-173095274 AAGGAAGTAGGCAATGAGGATGG + Intergenic
985208642 4:187568425-187568447 ATGGAGGGAGGGAATGAGGAAGG - Intergenic
986092521 5:4524238-4524260 ATAAAGTTAGGAAATGAGGATGG - Intergenic
986961856 5:13222603-13222625 ACTGAGAGAGGCATTGAAGAGGG + Intergenic
989158373 5:38366568-38366590 ATTGAGATTGGCAATGGGCAAGG + Intronic
990398046 5:55404749-55404771 ATGGAGAGAGGTAAGGAGGAAGG - Intronic
990636294 5:57731682-57731704 AGTGAGGCAGGAAATGAGGATGG + Intergenic
990638070 5:57751130-57751152 GTTGTGATAGGCAAGGAGGGCGG - Intergenic
991039943 5:62164831-62164853 AGTGACATAGGCCATGAGGGTGG - Intergenic
991620425 5:68539487-68539509 GAAGAGGTAGGCAATGAGGAAGG + Intergenic
993287469 5:86017249-86017271 ATTGAAAGAGGCATTGAGGATGG - Intergenic
993748249 5:91629825-91629847 TTTGAGATAAGCAATGAGACAGG - Intergenic
994014676 5:94951668-94951690 GCTGAGATAGGCAATGAAAAAGG - Intronic
994277626 5:97857593-97857615 ATTGAGATAGAAAATTAGCAAGG + Intergenic
994945058 5:106377164-106377186 AGTGAGAAAGGGAAGGAGGAAGG - Intergenic
995543872 5:113210518-113210540 ATTGAGAAAGGGACTGAGAATGG + Intronic
995564690 5:113421767-113421789 ACTGACAAAGGCAATGGGGAAGG - Intronic
995601556 5:113802916-113802938 ATTAAGAAAGGCAAACAGGAAGG - Intergenic
996354677 5:122582387-122582409 ACTGAAATAAGAAATGAGGAAGG - Intergenic
1000171650 5:158708173-158708195 ACTGAGAGGGGCAATGAGAAAGG + Exonic
1000241651 5:159414316-159414338 TTTGAGATAGCCCATGTGGATGG + Intergenic
1000437938 5:161236279-161236301 CTTGAGATCAGCAATTAGGAGGG - Intergenic
1000469827 5:161627553-161627575 ATGGAGGAAGGGAATGAGGACGG - Intronic
1000529564 5:162402510-162402532 ATTAAGATAGGCAGTGAGAAGGG + Intergenic
1001165832 5:169366019-169366041 AGTGAGATAGGGCATGAGAAGGG - Intergenic
1001752166 5:174139972-174139994 ACTGAGCTTGGCAATGAGAAAGG + Intronic
1002895702 6:1378921-1378943 ATTGAGTTAGGCACGGAGCAGGG - Intergenic
1003597476 6:7487238-7487260 ATTGAGGAAGGAGATGAGGAGGG - Intergenic
1006054119 6:31368226-31368248 ATTCAGATAATAAATGAGGAAGG - Intergenic
1006726312 6:36201535-36201557 AGTGAGACTGGCGATGAGGAAGG + Exonic
1007081098 6:39104852-39104874 ATGGTGATGGGCAATGAAGAGGG + Exonic
1007504291 6:42323042-42323064 ATTCAGATAGGCAATGGAGAGGG - Intronic
1008076127 6:47148066-47148088 CTTTAGTTTGGCAATGAGGAGGG - Intergenic
1008329219 6:50225264-50225286 ATTCAGTTAGGAAAAGAGGAAGG - Intergenic
1008668592 6:53743316-53743338 ATTCATATAGGCTAGGAGGAAGG + Intergenic
1009039585 6:58160093-58160115 ATTGAAAGAGGCACTGAGAAAGG - Intergenic
1009215482 6:60914932-60914954 ATTGAAAGAGGCACTGAGAAAGG - Intergenic
1009371040 6:62904450-62904472 ATTGAAAGAGGTATTGAGGAGGG + Intergenic
1009818602 6:68770185-68770207 AGTGAGATAGGCACTCTGGAAGG + Intronic
1009950128 6:70385972-70385994 ACTGAGATAGGAAATGGAGAAGG + Intergenic
1010038038 6:71348380-71348402 GTAAAGATAGGCAATGAGGATGG - Intergenic
1010082263 6:71877623-71877645 ATTGAGATATGCAGTGATCAAGG + Intergenic
1012252763 6:96997165-96997187 ATTGAGCAAGCAAATGAGGAAGG + Intronic
1012338017 6:98085002-98085024 ATTCAATTAGGCAAAGAGGAAGG - Intergenic
1013908432 6:115245819-115245841 ATTGAAAGAGGCACTGAGGCAGG + Intergenic
1014306614 6:119750713-119750735 ATCCAAATAGGCAAAGAGGAAGG - Intergenic
1014941470 6:127445069-127445091 TCTGAGCTAGGCAGTGAGGATGG + Intronic
1015591587 6:134827792-134827814 ATTGTGCTAGGCAATGATCATGG + Intergenic
1016977072 6:149819837-149819859 AGTGAGATAGGAAATCAAGATGG - Exonic
1017531591 6:155297766-155297788 TTTGAAACAGGTAATGAGGAAGG + Intronic
1018367877 6:163139952-163139974 ACTTGGATAGGCAAAGAGGAAGG - Intronic
1020621097 7:10520147-10520169 ATTGGATTAGGCAATTAGGATGG - Intergenic
1021205676 7:17777021-17777043 CTGGGGATAGGGAATGAGGAGGG - Intergenic
1021829900 7:24595228-24595250 ATTAAGATAGGCAATACGGGAGG + Intronic
1024771437 7:52728132-52728154 ATTGAGATAGGGAATGCAGGAGG + Intergenic
1028837127 7:95387167-95387189 ATTCAGTTAGGAAAAGAGGATGG + Intronic
1028968143 7:96826156-96826178 AGTGAGATGGGGAATGAAGAGGG + Intergenic
1029631777 7:101756531-101756553 ATTGACAGAAACAATGAGGAGGG + Intergenic
1030656505 7:112173995-112174017 GTGGGGAAAGGCAATGAGGAAGG - Intronic
1032288322 7:130561708-130561730 ATTGGGATAGACAAAGAGGTGGG - Intronic
1034397994 7:150841973-150841995 CCTGAGAGAGGCACTGAGGAGGG + Intronic
1034649516 7:152678677-152678699 AGTGAAAAAGGCAAAGAGGAAGG + Intergenic
1034874817 7:154715923-154715945 ATTAAGATGGGAAATGAAGAAGG - Intronic
1035346796 7:158205662-158205684 ATTGAAAGAGGCACTGAAGAGGG + Intronic
1035954239 8:4058494-4058516 ATTCAGTTAGGAAAAGAGGAAGG - Intronic
1036290574 8:7485997-7486019 ATTGAGACAGGTAAGGAGAAGGG - Intronic
1036330913 8:7825540-7825562 ATTGAGACAGGTAAGGAGAAGGG + Intronic
1037338885 8:17820712-17820734 ATTGAGTAAGGGAATGAAGACGG - Intergenic
1037385865 8:18340645-18340667 ATTCAGATAGAAAATCAGGAAGG + Intergenic
1037485479 8:19342848-19342870 ATGGAGAAAGGGAAAGAGGAGGG + Intronic
1037764622 8:21764769-21764791 CTTGAGAAAGGCAATGATGGTGG - Intronic
1038098100 8:24338831-24338853 ATTGAGAATGGCAATAAGAATGG + Intronic
1038347999 8:26749834-26749856 ATGGAGATAGGAAATGAGAGAGG - Intronic
1038539988 8:28384368-28384390 GTTGAGATAGGCTGTGAGGTGGG - Intronic
1038676548 8:29628021-29628043 ATTGAGTTTGGTTATGAGGATGG + Intergenic
1041744899 8:61197989-61198011 ATGGAAAGAGGCATTGAGGAGGG - Intronic
1042060956 8:64817090-64817112 ATTCAGAAAGGAAATGAGAAAGG + Intergenic
1043214868 8:77573540-77573562 ATTGAAAGAGGCACTGAAGAGGG + Intergenic
1043567190 8:81561558-81561580 ACTGAGAGAGGCACTGAAGAGGG + Intergenic
1043802529 8:84628341-84628363 AATGGGATAGGGAGTGAGGAAGG - Intronic
1044460984 8:92443671-92443693 ACTGAGATTGGAAATGAAGAAGG + Intergenic
1045459092 8:102411770-102411792 ATTGAGACAGACAATGCGGATGG - Intronic
1045713460 8:105014051-105014073 ATTGTGATAGGCACTCAGTAGGG + Intronic
1045728679 8:105207229-105207251 ATAGAAATATGTAATGAGGAAGG + Intronic
1045944290 8:107778061-107778083 ACTGAGATAAGCAAAGAGAAGGG + Intergenic
1046245336 8:111552827-111552849 ATTGAGAGAGACACTGAGAAGGG - Intergenic
1046551214 8:115719504-115719526 ACAGAGATAGTCAATGAGCAAGG - Intronic
1048680970 8:136841599-136841621 GTTGTGCTAGGCACTGAGGATGG + Intergenic
1053095337 9:35322393-35322415 ATGGAGATAGGCCAGGAAGAAGG + Intronic
1056180231 9:84075885-84075907 ATTGAAAGAGACATTGAGGAGGG + Intergenic
1057660727 9:96999127-96999149 CCTTAGACAGGCAATGAGGAAGG + Intronic
1058940770 9:109810802-109810824 CTTGAGTTGGGAAATGAGGAAGG + Intronic
1059647132 9:116278944-116278966 ATTGAGATAGGCAATGAGGAAGG - Intronic
1059749702 9:117236466-117236488 AATGTGATAAGCAATGAAGAGGG + Intronic
1060304361 9:122397671-122397693 ACTGAAAGAGGCACTGAGGAGGG + Intergenic
1186132153 X:6479414-6479436 ATTGAGATAGGGAAGCATGATGG - Intergenic
1186462687 X:9760917-9760939 ATAGAGATAGGAAGAGAGGAAGG + Intronic
1186602051 X:11048718-11048740 ATTGAAAGAGGCATTGAAGAGGG - Intergenic
1187223639 X:17354779-17354801 TCTGTGATAGGCACTGAGGAGGG - Intergenic
1187437089 X:19281767-19281789 CTAGAGCAAGGCAATGAGGAGGG + Intergenic
1188027481 X:25225981-25226003 ATTGAAAGAGGCATTGAGGAGGG + Intergenic
1188459095 X:30402267-30402289 ATTGAGATAGCAAAGGAGAATGG - Intergenic
1189405583 X:40720260-40720282 ACTGAAAGAGGCATTGAGGAGGG + Intronic
1190014972 X:46819100-46819122 ATTGAAAGAGGCACTGAAGAAGG + Intergenic
1190439867 X:50466706-50466728 ATTGAACTAGGCACTGAGAAAGG + Intronic
1192222959 X:69209962-69209984 ACCGAGATAGGTAATGAGGGAGG + Intergenic
1192551098 X:72054205-72054227 ATTGACATATGCAAGCAGGAAGG - Intergenic
1193289461 X:79754468-79754490 ACTAAGATAGGCACTGAAGAGGG - Intergenic
1193344518 X:80389155-80389177 ACTGAGACAGGCACTGAAGAGGG - Intronic
1193563483 X:83048455-83048477 ATTGAAAGAGGCACTGAAGAGGG - Intergenic
1194095630 X:89635903-89635925 ATTGAAAAAGGCATTGATGAGGG + Intergenic
1194329106 X:92559532-92559554 ATTAAAAGAGGCACTGAGGAGGG + Intronic
1194626211 X:96229404-96229426 ATTGAAAGAGGCACTGAAGAGGG + Intergenic
1194656725 X:96582347-96582369 ATTGAACTAGGCCTTGAGGATGG + Intergenic
1196704898 X:118708572-118708594 TTTGAGATATGCAATGGGAAAGG - Intergenic
1197939657 X:131776646-131776668 AGATAGATAGGCAATGAGCACGG + Intergenic
1198371581 X:135994504-135994526 ATTTAAATAAGTAATGAGGAAGG - Intronic
1198600134 X:138274691-138274713 AATAAGATAGACAAAGAGGAAGG + Intergenic
1198663287 X:138995053-138995075 ACTGAAAGAGGCAATGAAGAGGG + Intronic
1200370110 X:155715983-155716005 ATGGAAAGAGGCATTGAGGAGGG - Intergenic
1200448629 Y:3297271-3297293 ATTGAAAAAGGCATTGATGAGGG + Intergenic
1200637809 Y:5678722-5678744 ATTAAAAGAGGCACTGAGGAGGG + Intronic
1200834681 Y:7721768-7721790 AATGAAATAGGCTATGAAGAGGG + Intergenic