ID: 1059650513

View in Genome Browser
Species Human (GRCh38)
Location 9:116312052-116312074
Sequence AGGGTTTTATCTAGTCTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059650513_1059650514 -6 Left 1059650513 9:116312052-116312074 CCATGTAGACTAGATAAAACCCT No data
Right 1059650514 9:116312069-116312091 AACCCTGCCAACCCCTTCCATGG No data
1059650513_1059650518 4 Left 1059650513 9:116312052-116312074 CCATGTAGACTAGATAAAACCCT No data
Right 1059650518 9:116312079-116312101 ACCCCTTCCATGGCCCATCTAGG No data
1059650513_1059650523 16 Left 1059650513 9:116312052-116312074 CCATGTAGACTAGATAAAACCCT No data
Right 1059650523 9:116312091-116312113 GCCCATCTAGGAAGATTCCTTGG 0: 1
1: 0
2: 0
3: 11
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059650513 Original CRISPR AGGGTTTTATCTAGTCTACA TGG (reversed) Intronic