ID: 1059650684

View in Genome Browser
Species Human (GRCh38)
Location 9:116313280-116313302
Sequence TGGGGTGGGCAGGAGCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 600
Summary {0: 1, 1: 0, 2: 2, 3: 72, 4: 525}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059650684_1059650698 23 Left 1059650684 9:116313280-116313302 CCCTGGGGCTCCTGCCCACCCCA 0: 1
1: 0
2: 2
3: 72
4: 525
Right 1059650698 9:116313326-116313348 ATATGTGCAGGTGGTGAAAGGGG No data
1059650684_1059650694 11 Left 1059650684 9:116313280-116313302 CCCTGGGGCTCCTGCCCACCCCA 0: 1
1: 0
2: 2
3: 72
4: 525
Right 1059650694 9:116313314-116313336 CAAACATGACTCATATGTGCAGG No data
1059650684_1059650695 14 Left 1059650684 9:116313280-116313302 CCCTGGGGCTCCTGCCCACCCCA 0: 1
1: 0
2: 2
3: 72
4: 525
Right 1059650695 9:116313317-116313339 ACATGACTCATATGTGCAGGTGG No data
1059650684_1059650697 22 Left 1059650684 9:116313280-116313302 CCCTGGGGCTCCTGCCCACCCCA 0: 1
1: 0
2: 2
3: 72
4: 525
Right 1059650697 9:116313325-116313347 CATATGTGCAGGTGGTGAAAGGG No data
1059650684_1059650696 21 Left 1059650684 9:116313280-116313302 CCCTGGGGCTCCTGCCCACCCCA 0: 1
1: 0
2: 2
3: 72
4: 525
Right 1059650696 9:116313324-116313346 TCATATGTGCAGGTGGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059650684 Original CRISPR TGGGGTGGGCAGGAGCCCCA GGG (reversed) Intronic
900265091 1:1753316-1753338 GGGGGTGGGCAGCAGTGCCAGGG + Intronic
900339433 1:2181071-2181093 TGGGGTGGGGAGAAGCAGCAGGG - Intronic
900343673 1:2200744-2200766 TGTGGTGGACAGGAGACCGAGGG - Intronic
900373866 1:2344478-2344500 TGTGGGGTGCAGGAGCCCCAAGG + Intronic
900600130 1:3499295-3499317 AGGGGTGGGCAGGACCCCAGGGG + Intronic
900953728 1:5874338-5874360 GGGAGTGGGCGGCAGCCCCAAGG + Intronic
901143516 1:7050735-7050757 GGGGAGGGGAAGGAGCCCCAGGG + Intronic
901631581 1:10650831-10650853 CGGGCTCGGCTGGAGCCCCAGGG - Intronic
901659404 1:10789144-10789166 GGGTGTGGGCAGGGGCCACAGGG - Intronic
901678043 1:10898300-10898322 CGGGGTGACCAGGAGTCCCAGGG + Intergenic
901810653 1:11765332-11765354 GGGGCTGGGGAGGAGCTCCAAGG + Intronic
901878256 1:12179368-12179390 GGGGGTTCACAGGAGCCCCATGG - Intronic
901923617 1:12552645-12552667 TGAGGTGGGCAGCCGCCCCACGG + Intergenic
902286472 1:15411097-15411119 TGGGGCGGGCAGGAGCGGGAGGG - Intronic
902323177 1:15683121-15683143 GGGGGTGGGGAGGAACACCAGGG + Intergenic
902638385 1:17750351-17750373 TGGGGTGGGGAGCAGCCCCAGGG + Intergenic
902756159 1:18550575-18550597 TGTGATGGGCAGGCGCCACATGG - Intergenic
902777846 1:18685971-18685993 TGGGGTGGGCAGGAGCAAGTTGG - Intronic
902884219 1:19393354-19393376 TGGGGTGAGCGGGAGCCCCTGGG - Intronic
902987249 1:20162365-20162387 TGCAGTGGTCAGGATCCCCAAGG + Intronic
903130715 1:21277958-21277980 TGGGGTGGGGAGGGGACTCAGGG - Intronic
903500148 1:23796164-23796186 TGGGGTGGACAGCAGCCTTAGGG - Exonic
903873068 1:26451144-26451166 TGGGTTGGGCAGTATCACCAGGG + Intronic
904364499 1:30001795-30001817 GGGGCTGGGCAGCAGCACCAGGG - Intergenic
904576663 1:31509336-31509358 TGGGGTGGGAACTGGCCCCAGGG + Intergenic
904675348 1:32195796-32195818 TGTGCTGGTCAGGAGCCCCTTGG + Exonic
905772817 1:40649429-40649451 TGGACTGGGCAGGGGCCCAATGG - Intronic
906519752 1:46460029-46460051 TGGTGTAGGTAGCAGCCCCATGG + Intergenic
906686023 1:47764065-47764087 TGGGATGGTCAGGAGTCCCACGG - Exonic
906919472 1:50048358-50048380 TGGGGTCGCCAGGAGCCCTCAGG - Intronic
907047783 1:51310316-51310338 CAGGGTGAGGAGGAGCCCCAGGG + Intronic
907270425 1:53287910-53287932 AGGGGTGGGCGGGACCCCGAAGG + Intronic
907387284 1:54134287-54134309 TGGGGTGGCCAGGGGCTCAACGG - Intronic
907578165 1:55547369-55547391 TGGGGTGGGCAGGAGGGTTAGGG + Intergenic
908843161 1:68298567-68298589 GGGGGTGGGCAAGAGCAGCAGGG + Intergenic
909561192 1:77010706-77010728 TGGGGTGTCCTGGAGCCACAGGG - Intronic
910218671 1:84867167-84867189 AGGGCTGGGCAGAAGCCCCACGG + Intronic
913045129 1:115067887-115067909 TGGAGTGGGCAGACACCCCAGGG - Intronic
913170930 1:116231619-116231641 GGGGGAGGCCAGGAGTCCCAGGG - Intergenic
914747957 1:150513185-150513207 TGGGGTGGGGAGGTGGTCCAAGG - Intronic
915083042 1:153365149-153365171 TGGGGTGGGAATGAGACCCCAGG + Intergenic
915110494 1:153561714-153561736 TAAGGTGGGCAGGAGGCCCTGGG + Intronic
915424550 1:155813730-155813752 TGGAGGGGGCGGGGGCCCCATGG + Exonic
915474742 1:156147016-156147038 GGAAGTGGGCAGGAGCCCAAGGG + Intergenic
915748496 1:158182988-158183010 CGGGGTGAGCAGGAGCAGCAGGG + Exonic
915755647 1:158256896-158256918 CGGGGTGAGCAGGAGCAGCAGGG + Exonic
915762525 1:158329516-158329538 CGGGGTGAGCAGGAGCAGCAGGG - Exonic
915951072 1:160190346-160190368 GGGGGAGGGAAGGAGCCCCTGGG + Intergenic
915951162 1:160190681-160190703 TGGGGTAGGGAGGGGCCCCTGGG - Exonic
916048098 1:161015844-161015866 TGGGGTGAACAGGAGCAACATGG + Intronic
916159148 1:161891121-161891143 TGGGGTGGCCAGGGGCTCCGAGG - Intronic
918108548 1:181434743-181434765 GGAGGTGGGCAGGAGCCACCTGG + Intronic
918557629 1:185822298-185822320 CGGGGTGGGCAGGAGGTACATGG + Intronic
920315668 1:205074311-205074333 TTGGGCAGGCAGGAGCCCCTAGG - Exonic
921097135 1:211896228-211896250 TGGGGAGGGCAGTAGACCCAGGG - Intergenic
922187080 1:223285264-223285286 TGGGGTGGGCAGGAACACCAAGG + Intronic
922574644 1:226653710-226653732 TGGAGTGGGCTGGAGACACACGG + Intronic
922584310 1:226722253-226722275 TGGAGTGGCAAGGAGCCCCAAGG - Intronic
922707380 1:227796522-227796544 TGGGGCCGGCAGTAGGCCCAAGG - Intergenic
922781139 1:228253196-228253218 AGGGGTGGGCTGAAGTCCCATGG + Intronic
923246334 1:232136358-232136380 TGGGGTTGGCAGGAGGCAGAGGG + Intergenic
924707145 1:246510355-246510377 GGGGATGGGCAGGTGCCCCCTGG - Intergenic
1062927243 10:1326665-1326687 TGTTGTGGGAAGGAGCCCTATGG - Intronic
1063391486 10:5652611-5652633 TGTGGTGGGCAGGAGCCAGCAGG - Intronic
1065625467 10:27624909-27624931 TGGGGCAGGGAGGAGACCCAGGG - Intergenic
1066220966 10:33335902-33335924 TGGGGGTGGCAGGAGCTCCAGGG - Intronic
1066391256 10:34978957-34978979 AGGGGAGGGCTGGCGCCCCAAGG - Intergenic
1066464792 10:35641957-35641979 GGGGGCGGGCATGAGCCCCCGGG - Exonic
1067375662 10:45726187-45726209 TGGGGTGGTCTGGAGTTCCACGG - Intergenic
1067698290 10:48551078-48551100 TGGGGTGGGAAGGAGGCAGAGGG + Intronic
1067847099 10:49733164-49733186 TGGGCTGTGCAGGAGCCCTTGGG - Intergenic
1067883374 10:50066876-50066898 TGGGGTGGTCTGGAGTTCCACGG - Intergenic
1069992537 10:72324155-72324177 ACGGGTGGGCTGGAGCCCCGGGG + Intergenic
1070129693 10:73647830-73647852 TGGGGGGCTCAGGAGCCCCTGGG + Exonic
1070389635 10:75958172-75958194 AGGGGTGGCCAGCAGCCCCAAGG + Intronic
1072538621 10:96381655-96381677 TGGGGTGGGCTGGTGCAACAAGG - Intronic
1072667085 10:97401414-97401436 TCGGATGGGGAGGAGCTCCAAGG + Intronic
1072805570 10:98422253-98422275 TGCGCTGGGCAGCAGGCCCAAGG - Intronic
1072922967 10:99592094-99592116 AGGGGCTGGCAGCAGCCCCAAGG - Intergenic
1073077107 10:100830991-100831013 TGGGCTGGGAAGGTGTCCCAGGG - Intergenic
1073207077 10:101775143-101775165 CGGGCTGGCCGGGAGCCCCAGGG - Exonic
1073451551 10:103612755-103612777 GGGGGTGCACAGGACCCCCATGG - Intronic
1073520200 10:104121603-104121625 TGGGGCGGCCAGAAGCCGCACGG - Intergenic
1074990526 10:118702152-118702174 TGTGGTGGGCAGGGGTCACAAGG - Intronic
1075090986 10:119444121-119444143 TGGAGGGAGCAGGAGGCCCACGG - Intronic
1075408243 10:122208997-122209019 TGGGGCTGGCCGGATCCCCATGG + Intronic
1075591830 10:123697562-123697584 GGGGGTGGGCAGGAGCACCTGGG - Intergenic
1075795438 10:125116559-125116581 AGGGGTGGGCGTGATCCCCAGGG - Intronic
1075961391 10:126570225-126570247 TGAAGGGGGCAGGGGCCCCAAGG - Intronic
1076057437 10:127387066-127387088 TGGGGTGGCCGGGAGGCCCGAGG + Intronic
1076183782 10:128431078-128431100 TGGTGTGGGCCGGGGCACCAAGG - Intergenic
1076421436 10:130335070-130335092 TCTGTTGGGCAGGACCCCCAGGG + Intergenic
1076785716 10:132748936-132748958 TGGGGTGGGCAGGGGCCCAGAGG - Intronic
1076887773 10:133270460-133270482 AAGGGTGGGCAGCAGCCCCTGGG - Exonic
1077134551 11:991960-991982 TGGGCTGGGCAGGTGCCTCCGGG + Intronic
1077178901 11:1203570-1203592 TGGGGTGCCCAGGACCCCCCAGG + Intergenic
1077217020 11:1399176-1399198 TGTTGTGGGCAGGCCCCCCAGGG + Intronic
1077412747 11:2411090-2411112 TGGGCTGGGAAGGAGACACAAGG - Intronic
1077444079 11:2582265-2582287 GAGGGTGGGGAGAAGCCCCATGG - Intronic
1079496672 11:21052227-21052249 TAGGGTAGGCAGGATCTCCAAGG + Intronic
1080089219 11:28324953-28324975 TGGGGGCAGCAGGAGCCACAGGG - Intronic
1080845180 11:36020743-36020765 TGGGCTGGCCAGGATACCCAGGG + Intronic
1081542818 11:44048557-44048579 GGGGGTGGGCAGCATCCTCACGG + Intronic
1081773486 11:45663655-45663677 TGGGGAGGGGAGGGGCACCAGGG - Intronic
1083262053 11:61528452-61528474 TGGGGCAGGCAGCAGACCCAGGG - Intronic
1083796243 11:65018471-65018493 GAGGGTGAGCAGGGGCCCCATGG + Exonic
1084151032 11:67288158-67288180 TGGGGTTGGTAGCAGCCCGAAGG - Intergenic
1084563200 11:69915517-69915539 TGGGGTCTGCTGGAGCCCTAGGG + Intergenic
1084665801 11:70575581-70575603 TGGGGTGGGGAGGAGACACCAGG + Intronic
1085195668 11:74670235-74670257 GGGAGAGGGCAGCAGCCCCAAGG - Intergenic
1085298676 11:75445619-75445641 TGAGGTGGGAAGGATTCCCATGG + Intronic
1085638720 11:78177850-78177872 GGGGGAGGTCAGGAGCCACAGGG + Intronic
1087322176 11:96676655-96676677 TGGGGTGGCCAGCTTCCCCAAGG - Intergenic
1089012194 11:115140381-115140403 AAGGGTGGGCTGGAGCTCCAGGG - Intergenic
1089650850 11:119911888-119911910 TGGTGGGGGCAGGAGTCCCTTGG + Intergenic
1089715459 11:120354423-120354445 TGGGGTGTGTGGGACCCCCATGG - Intronic
1090541689 11:127712868-127712890 TGGGGAGGCGAGGAGCCCTAAGG + Intergenic
1091146815 11:133287463-133287485 TCTGGTGGGCATGAGCCTCAGGG - Intronic
1091402492 12:189379-189401 TGGGGAGAGAAGGAGGCCCAGGG - Intergenic
1091790904 12:3271609-3271631 TGGGGTGGGATGCAGCCACACGG - Intronic
1092428323 12:8390776-8390798 TGGGGTGGGGAGGAGGTGCAGGG - Intergenic
1094477734 12:30854049-30854071 TGGGCTGGGCAGGGGTTCCAGGG - Intergenic
1096046592 12:48567923-48567945 TGGAGTGGGCAGGGGTGCCAAGG + Exonic
1096602833 12:52742436-52742458 AGGGTTGGGCCTGAGCCCCAGGG + Intergenic
1096788336 12:54030392-54030414 CGGGGAGGGCCGGAGGCCCAAGG + Exonic
1097054171 12:56240051-56240073 TGGGGTGGGGAGCAGCCCCTGGG - Exonic
1097264492 12:57737777-57737799 TGGGGCGGCCCGGAGCCCGAAGG - Exonic
1103202020 12:119095502-119095524 TGGGGTGTGCAGCAGCAGCATGG - Intronic
1103615202 12:122147486-122147508 TTGGGTGGGGAAGAGGCCCAGGG + Intergenic
1103883766 12:124186080-124186102 TGGGGTGTGCAGGGGTCCCCGGG + Intronic
1103937883 12:124486103-124486125 AGGAGAGGGCAGGGGCCCCAGGG + Intronic
1103994546 12:124820624-124820646 TGTGGTGAGCAGGGTCCCCAGGG - Intronic
1104270153 12:127276101-127276123 TGGGGTGGGGGGTGGCCCCATGG + Intergenic
1104822694 12:131687417-131687439 TGGGCAGGGCTGGAGCCCCAGGG - Intergenic
1104964021 12:132501029-132501051 TGGGCGGGGAAGGAGCCCAAGGG + Intronic
1106668071 13:31873427-31873449 TGGGGTGGACAGTAGAACCAGGG + Intergenic
1108579289 13:51815069-51815091 TGGGGTGGACAGGAGTTCCATGG - Intergenic
1108845715 13:54676857-54676879 TGGGCTGTGCAGGAGCCCACTGG - Intergenic
1109124880 13:58505500-58505522 TGGGCTGTGCAGGAGCCCACTGG + Intergenic
1109169097 13:59074488-59074510 TCGGGTGGGCAAGAGTTCCAGGG - Intergenic
1112441547 13:99427634-99427656 TGGGGAGGCCAGGAGCCCATAGG + Intergenic
1115431971 14:33329631-33329653 TGGGGTAGGCAGGGGCACGATGG + Intronic
1118318174 14:64738063-64738085 GGGGCTGGGCCGGAGCCCCCAGG + Intronic
1118550138 14:66940793-66940815 TGGGGTGGGGAGGAGTTGCATGG + Intronic
1119618090 14:76111906-76111928 TTGGTGGGGCAGGAGCTCCAGGG + Intergenic
1119850126 14:77861133-77861155 TTGTGGGGGCAGGAGCCACATGG - Intronic
1121569558 14:94937034-94937056 TGGGGTTGGCGGGAGGGCCAGGG + Intergenic
1122018407 14:98816827-98816849 AGGGGTGAGTAGGGGCCCCAAGG - Intergenic
1122323964 14:100871702-100871724 TGGGGGGAGGAGGAGCCCCATGG - Intergenic
1122374964 14:101251441-101251463 TGTGGTGAGGAGGAGCCCCGTGG + Intergenic
1122601805 14:102925324-102925346 TGGGGTGGAAATGAGGCCCAGGG - Intronic
1122685417 14:103502503-103502525 TGGGGTGGGCAGGAGCTGGCTGG + Intronic
1122770596 14:104095970-104095992 AGAGGTGGGCAGCAGCCGCAAGG - Intronic
1122925258 14:104896411-104896433 AGGGGTGGGCAGCAGCCCGGTGG - Exonic
1123123439 14:105928660-105928682 TGGGCTGGGCTGGTGCCCCCAGG + Intronic
1123406085 15:20020164-20020186 TGGGCTGGGCTGGTGCCCCCAGG + Intergenic
1123515415 15:21026812-21026834 TGGGCTGGGCTGGTGCCCCCAGG + Intergenic
1123706574 15:22955289-22955311 TGGGGTCGCCAGCTGCCCCAGGG + Intronic
1124142501 15:27089183-27089205 TGGGGTCAGGAGGAGCCGCAGGG + Intronic
1124625619 15:31306143-31306165 TGGGCGGGGCAGGTGCCCCAGGG - Intergenic
1124998983 15:34752431-34752453 GGGGATGGCAAGGAGCCCCAAGG - Exonic
1125081035 15:35673366-35673388 TTGTTTGGGGAGGAGCCCCAAGG + Intergenic
1125579743 15:40776673-40776695 TGGGGTGGGCCGAGGCCACATGG - Intronic
1126859592 15:52871017-52871039 AGGGGTGTGCAGGTGTCCCAGGG + Intergenic
1127371578 15:58346463-58346485 TGGTGTGGGCTGGACCCCAAGGG + Intronic
1127641600 15:60920952-60920974 TGGGTTGATCATGAGCCCCAAGG - Intronic
1128139202 15:65286800-65286822 TGGGGCGGGAAGCAGCCCCCGGG + Exonic
1128314989 15:66654772-66654794 TGGGGAGGGCAGGGGTCCCTGGG - Intronic
1128512241 15:68320441-68320463 AGGGGTAGAGAGGAGCCCCAGGG + Intronic
1128569642 15:68724799-68724821 TCAGGTGTGCAGGAGCCTCAAGG + Intronic
1128981853 15:72194001-72194023 GGGGGAGGGCAGAAGCCCCTGGG - Intronic
1129044574 15:72722521-72722543 TGGGCTGGGTATGTGCCCCAGGG + Intronic
1129681803 15:77662366-77662388 TGGGGTTGGCTGGAGCCCTTGGG + Intronic
1129738622 15:77979137-77979159 AGGGGCGAGCAGCAGCCCCAGGG - Intergenic
1129847450 15:78774477-78774499 AGGGGCGAGCAGCAGCCCCAGGG + Intronic
1130070981 15:80646777-80646799 TGGAGTGAGCAGGAGCCCACAGG - Intergenic
1130254453 15:82319435-82319457 AGGGGCGAGCAGCAGCCCCAGGG - Intergenic
1130327787 15:82895645-82895667 TGGGCTGGGCTGGGGGCCCACGG + Intronic
1130334049 15:82943676-82943698 TGGGGTGGGCGGTATCCACAGGG - Intronic
1130600512 15:85270535-85270557 AGGGGCGAGCAGCAGCCCCAGGG + Intergenic
1131292453 15:91118510-91118532 GGGGAGGAGCAGGAGCCCCAGGG + Intronic
1131642507 15:94307602-94307624 CGGGATGCACAGGAGCCCCATGG + Intronic
1132388985 15:101425029-101425051 AGGGGCAGGTAGGAGCCCCAGGG + Intronic
1132602464 16:779786-779808 TGGGGTGGGCAGAGGCGGCAGGG + Intronic
1132604343 16:787529-787551 GGGGGGCGGCCGGAGCCCCACGG - Intronic
1132606293 16:795092-795114 TGGGGTGGGCAGGAGCTCAGGGG + Intronic
1132648976 16:1012009-1012031 TGGTGTGAGCAGGAGCACCCGGG + Intergenic
1132684654 16:1157260-1157282 GGGGGTTGGCAGGACCCCCTGGG + Intronic
1132701266 16:1223095-1223117 AGGGGCTGGCAGGAACCCCAAGG - Intronic
1132761080 16:1508967-1508989 GGGGTTGGGCAGCAGCTCCAAGG - Intronic
1132858016 16:2056065-2056087 TTGGGTGGGTGGGACCCCCAGGG + Intronic
1132886982 16:2186664-2186686 GGGGGCAGGCAGGAGCCCCTGGG - Intronic
1132943226 16:2518819-2518841 TGTCCTGGGCAGTAGCCCCAAGG + Intronic
1132974988 16:2706666-2706688 TGGGGAGGGCAGGGGGCCGAGGG + Intronic
1133030968 16:3010978-3011000 TGGGGTGTGCTGGAGCCCACTGG - Intergenic
1133313994 16:4870792-4870814 GGCGGTGGGCAGGAGCACCTTGG + Intronic
1134255809 16:12610373-12610395 TGGGGTGGGAAAGAGACACAGGG + Intergenic
1134840007 16:17394245-17394267 TGAGGTGGCCAGCAGCCACATGG - Intronic
1135517520 16:23148575-23148597 CTGGGCGGGCAGGTGCCCCAGGG + Intronic
1135743362 16:24995639-24995661 CAGGGTGGGCAGGAGAGCCAAGG + Intronic
1136626798 16:31466528-31466550 TGGTGGGGGCACGGGCCCCAGGG - Exonic
1139946649 16:70646778-70646800 GGGAGTGAGCAGGTGCCCCAAGG - Exonic
1141851704 16:86650574-86650596 TGAGGTTGGAAGGAGCCACAGGG - Intergenic
1142218446 16:88841345-88841367 GAGGGTGGGCAGGAGTCCCAAGG - Intronic
1142225525 16:88875429-88875451 GTGGCTGGGCAGGAGCACCAGGG + Exonic
1142232708 16:88907269-88907291 TGGGGACAGCAGGTGCCCCAGGG - Intronic
1142470053 17:158219-158241 TGGGGTGTGCAGCAGCCAGAAGG - Intronic
1142518865 17:491417-491439 CGGGACGGGCAGGAGCGCCAGGG - Intergenic
1142852115 17:2709318-2709340 TGGGGCGGGCAGGCGGCCTATGG + Intronic
1143121316 17:4608892-4608914 GGGGGTGGGCAGGAGATCCCTGG + Intergenic
1143202515 17:5122567-5122589 TGGGCTGGGGAGGGGGCCCAGGG - Intronic
1143339174 17:6195709-6195731 TTGTGTGGCCAGGACCCCCAAGG + Intergenic
1143389135 17:6549817-6549839 GGGGGTGGCCAGGGTCCCCAGGG - Intronic
1143395958 17:6596357-6596379 TGGGGTGGGGAGGAGAGGCATGG + Intronic
1143514812 17:7414311-7414333 AGGGGTGGGCAGGTGGGCCAGGG - Intronic
1144068027 17:11641705-11641727 TGGGGTGGGGAGGGGTGCCAGGG + Intronic
1144531651 17:16044846-16044868 TGGAGTGGGCAGGATCCCACTGG - Intronic
1144673159 17:17144276-17144298 TGGGGCAGGCCGGAGGCCCATGG - Intronic
1144710656 17:17399482-17399504 TGGGCTGGGCCGGAGCCCACAGG - Intergenic
1144887801 17:18475822-18475844 AGGGGATGGCAGGTGCCCCAGGG - Intergenic
1144952763 17:19003195-19003217 TGGGGAGGGGAGGAACCCCAGGG - Intronic
1145101274 17:20079862-20079884 CTGGGTGGGCAGGAGGCGCAAGG + Intronic
1145370801 17:22304745-22304767 GGGGGTCTGCAGGAGACCCAGGG - Intergenic
1145755928 17:27390034-27390056 TGGGGTGGGAAGGGGCCTCCTGG - Intergenic
1145990887 17:29078816-29078838 TGGGGGAGGCAGGAGAGCCAGGG + Exonic
1147659306 17:42108711-42108733 TGGGGGCAGCAGGAGCCACAGGG + Intronic
1147775633 17:42898737-42898759 TGGGGTGGGGAGGAGACTCCAGG + Intergenic
1147793239 17:43025803-43025825 GGGGGGGGGCAGGAGCTCCCGGG + Intronic
1147882891 17:43665359-43665381 TGGGGAGGTCAGGAGGGCCATGG + Intergenic
1148325703 17:46782368-46782390 TGGGGTTGACAGGAGCACCGTGG - Intronic
1149226626 17:54478929-54478951 GGGGGTGGACAGGAGCCCTTTGG - Intergenic
1149611091 17:57958092-57958114 TGGGATAGGGAGGAGGCCCATGG - Intergenic
1150287563 17:63962615-63962637 TGGAGTGGGTGGCAGCCCCATGG + Intronic
1150814620 17:68383358-68383380 TGGGGTGGGCAATGGCACCAGGG - Intronic
1151364135 17:73606273-73606295 TGGGCTGGGCAGGAGCTCCCTGG + Intronic
1151376838 17:73694949-73694971 TGGGCTTGACGGGAGCCCCAAGG + Intergenic
1151395437 17:73819836-73819858 TGGAGCAGGCAGGAGCCCCATGG - Intergenic
1151559962 17:74864739-74864761 TGGGGTGGGGCAGAGCCCCTGGG - Intronic
1151786677 17:76278585-76278607 AGAGGTGGGCAGGAGCCGGAGGG + Intronic
1152537645 17:80959895-80959917 TGGGGAGCCCAGGAGTCCCAGGG - Intronic
1152638978 17:81441904-81441926 TGGGGTGGGCAGGGGCGGCCCGG - Exonic
1152641352 17:81450574-81450596 TGGGGCAGGCAGGAGGGCCATGG - Intronic
1154502288 18:15002914-15002936 TGGAGTGGGCAGGGGCCTGAAGG + Intergenic
1156038204 18:32789550-32789572 TAGGGAGGGCAGCAGCCCCAAGG + Intergenic
1156449828 18:37260815-37260837 TGGGGTGGGCAGAGGGCACAGGG - Intronic
1157706664 18:49813416-49813438 TGGGGAGGGCAGGACCCCGAGGG + Intronic
1157724282 18:49951861-49951883 TGGCATAGGGAGGAGCCCCAAGG - Intronic
1157819256 18:50753510-50753532 TGGGCTGGGCTGCAACCCCAGGG + Intergenic
1158867586 18:61652703-61652725 AGGAGTGAGCAGGAGCCCCATGG - Intergenic
1159438446 18:68447301-68447323 TGGGATGTGCAGGTGGCCCAGGG + Intergenic
1160293516 18:77617018-77617040 TGGGGTGTGCAGGAGGCCATGGG + Intergenic
1160371435 18:78375358-78375380 GGGGGTCAGCGGGAGCCCCACGG + Intergenic
1160533067 18:79576790-79576812 TTGGGTGGGCAGGATGCCCAGGG - Intergenic
1160673086 19:375579-375601 GGGGGAGGGCAGCAGCCCCCTGG - Intronic
1160719455 19:590841-590863 TGGGGTGGGCCGCAGGGCCAGGG + Intronic
1160793652 19:934143-934165 AGGGGCGGGCAGGAGCCGGACGG + Intronic
1160864461 19:1250765-1250787 GGGGGCGGGCAGGAATCCCAGGG + Intronic
1160865134 19:1252957-1252979 TGCGGTTGGCAGGGGGCCCAGGG + Intronic
1160871324 19:1279145-1279167 CTGGGTGGGCAGGTGACCCAAGG + Exonic
1160935340 19:1592132-1592154 TGGGGTGGCGCGGAGCCCGAGGG - Intronic
1161056904 19:2195253-2195275 TGGGGTGGGAAGGAGTTCCCAGG - Intronic
1161318813 19:3631708-3631730 TGGGCTGTGCAGGAGGCCGACGG + Exonic
1161370368 19:3907943-3907965 TGGGCCGGGCTGGAGCCCCAAGG - Intronic
1161394400 19:4037628-4037650 GGGGGCGGGCAGGAGCCCATTGG - Exonic
1161398922 19:4059139-4059161 TGGGGTGGGTAGGAGGGCCCGGG - Intronic
1161469167 19:4447821-4447843 TGGTGCCAGCAGGAGCCCCACGG + Intronic
1161490718 19:4559721-4559743 TGGAGGGGGCAGGCACCCCAGGG - Exonic
1161513889 19:4685827-4685849 TGGGGTGGGCAGGAGAACAAGGG - Intronic
1161584235 19:5096494-5096516 TGAGGTCAGCAGGAACCCCAGGG - Intronic
1163366562 19:16878939-16878961 TGTGGTGGGGCTGAGCCCCAGGG - Exonic
1164028702 19:21380439-21380461 GGGGGTGGACAGGAGCCCTTTGG + Intergenic
1164556460 19:29256490-29256512 TTGGGTGGGGAGGAGGGCCAGGG - Intergenic
1164631723 19:29766204-29766226 TGGGAGGGGTGGGAGCCCCAGGG + Intergenic
1164712082 19:30364093-30364115 AGGTGTAGGCTGGAGCCCCACGG + Intronic
1165404886 19:35623449-35623471 AGGGGTGAGCAGGAGCAACAGGG + Exonic
1165487385 19:36103887-36103909 TGGGGTGGGCAGGAAGGCCAGGG - Exonic
1165642645 19:37403232-37403254 GGTGGTGGGCAGGAGCTCCTTGG + Intergenic
1165858325 19:38893606-38893628 TGGGGAGGCCGGGAACCCCAGGG - Intronic
1165925093 19:39321395-39321417 TGGGGTGGTCTGGATCCCCTTGG - Intergenic
1166765758 19:45251532-45251554 TGGGGGGGGCGGGGGTCCCAGGG - Exonic
1166816764 19:45550944-45550966 CGGGGTTGGCAGGAGTCCCAGGG + Intronic
1167118581 19:47502775-47502797 AGGGGTGGGGAGGAGCCCCTTGG - Intronic
1167158731 19:47754663-47754685 AGGGGTGGGTAGGAGGCCCGGGG - Intronic
1167430900 19:49453832-49453854 TGGGGTGCTCTGGAGGCCCATGG - Intronic
1167443884 19:49526040-49526062 TGGGGTGGGCAGGAGGACCCCGG - Exonic
1167474297 19:49691174-49691196 CGGGGTGGGCAGGACTCCAAAGG + Exonic
1167498295 19:49831601-49831623 GGGCGAGGCCAGGAGCCCCATGG + Intronic
1167590899 19:50403654-50403676 GGGAGTGGGAAGGAGGCCCAGGG - Intronic
925309795 2:2874492-2874514 TGAGATGCTCAGGAGCCCCAGGG - Intergenic
925346750 2:3176976-3176998 TGGGGAGGGAAGAAGCCCCGTGG - Intergenic
925370119 2:3338537-3338559 TGGGGAGGGCAGGCGCAGCAGGG + Intronic
925730827 2:6918266-6918288 TGGGGTGGGTAAGACCCGCAGGG - Intronic
926217447 2:10914111-10914133 AGGGGTGTGCAGGAGCCGCAGGG + Exonic
926289461 2:11517077-11517099 TGGTGTGAGCAGTGGCCCCAGGG + Intergenic
926441146 2:12890033-12890055 TGGGGTGGAAAGGAGCTGCAGGG + Intergenic
926760625 2:16275740-16275762 TAGGGTGGACAGAAGCCACATGG - Intergenic
927307031 2:21585427-21585449 TGGGCAGAGAAGGAGCCCCAAGG + Intergenic
927432784 2:23041094-23041116 TGGAGGTGGCTGGAGCCCCATGG - Intergenic
927576925 2:24208049-24208071 CTGTGTGGGCAGGAGCCCCAGGG + Intronic
927857829 2:26538245-26538267 TGGTTTGGGCAGGAACCCCTGGG - Intronic
928174551 2:29024799-29024821 TGGGGGTGACAGGAGCTCCAGGG - Intronic
929544398 2:42846240-42846262 TGGGCTGGGCAGGAGGGTCACGG + Intergenic
929583798 2:43101198-43101220 CGGGGTGGGCAGGGGGCCCAGGG + Intergenic
930216293 2:48700778-48700800 AGCAGTGGGCAGGAGCCACAAGG + Intronic
930455708 2:51605522-51605544 TGGGGAGGGAAGGAGCCACTGGG - Intergenic
930455715 2:51605541-51605563 TGGGGAGGGAAGGAGCCACTGGG - Intergenic
932475648 2:72004099-72004121 TGGGCTGGGCTGCAGCCTCATGG - Intergenic
932736402 2:74257494-74257516 CGGGCTGGGCAGGAGCACCCTGG + Intronic
933948574 2:87308966-87308988 GGGGGTGGGCAGGATCTCCTTGG + Intergenic
933997291 2:87679294-87679316 TTGAGCGGGCAGGAGGCCCAGGG - Intergenic
934659536 2:96135926-96135948 TGAGGTGGGCAGGAGACCCCAGG - Intronic
934734302 2:96681254-96681276 TGGGGTGGGCTTGAGCCCAGGGG + Intergenic
934989973 2:98914159-98914181 GGGAGGAGGCAGGAGCCCCAAGG + Intronic
935205192 2:100890866-100890888 GGTGGTGGGCAGGAGACCCCTGG + Intronic
936010042 2:108919771-108919793 GGGAGAGGGCAGGTGCCCCACGG - Intronic
936267629 2:111022673-111022695 AGGTGTGGGCAGGACCCCCAGGG + Intronic
936296561 2:111271616-111271638 TTGAGCGGGCAGGAGGCCCAGGG + Intergenic
937415447 2:121710885-121710907 TGGGGAAGGCAGGAGACACAAGG - Intergenic
940830268 2:158457781-158457803 AGGGGTGGGCAGGACCGGCAAGG - Intronic
942149038 2:173056700-173056722 AGGAGTGGGCAGGGGACCCAGGG + Intergenic
942840928 2:180359958-180359980 TGGGGCAGGCAGGAGCCCTGTGG + Intergenic
944290294 2:197997111-197997133 TGGGGAGGGCAGGAGCCAACAGG + Intronic
945801580 2:214438436-214438458 TGGGGAAGGCAAGAGCCTCAAGG - Intronic
946349953 2:219143780-219143802 TGGGGTTGGGAGGAGCCCTGCGG - Intronic
946833143 2:223745312-223745334 TGTGGTGGGTAGGAAACCCATGG + Intergenic
947742131 2:232489514-232489536 TGGGGTGGGGGGCAGCCCCCAGG + Intergenic
947913431 2:233817434-233817456 TGGGCTGGGCAGGAGGACCCTGG + Intronic
948099841 2:235365004-235365026 TGGGGGTGGCCTGAGCCCCAGGG + Intergenic
948208218 2:236173853-236173875 TGGGGTGTCCAGGAGTCCCGGGG - Intergenic
948258337 2:236584501-236584523 AGGGGTGGACAGGAGACCCCTGG + Intergenic
948308739 2:236969407-236969429 AAGGGTGGGCGGGAGGCCCAAGG - Intergenic
948364258 2:237444495-237444517 TGAGGGGCGCAGGAGCCCCGAGG - Intergenic
948702473 2:239768888-239768910 GGGGGTGGCCAGTAGCCACAGGG - Intronic
948785311 2:240349473-240349495 AGGTGTGGGCAGGAGGCCCGGGG - Intergenic
948893483 2:240917902-240917924 TGGGGAGGGCCGGGACCCCAGGG - Intergenic
948923714 2:241080914-241080936 TGGTGAGGGCAGGAGCGACAGGG + Intronic
1168878098 20:1185091-1185113 TGGGGGCGGCAGGAGGCCGAGGG - Intronic
1169030548 20:2403549-2403571 AGGGGTGGGCATGAGCAGCATGG - Intronic
1169141468 20:3229488-3229510 TGGGGAGGGGAGGGGCCGCATGG - Intronic
1169474854 20:5922446-5922468 GGGGAGAGGCAGGAGCCCCAGGG + Exonic
1169761508 20:9100158-9100180 TGGTGCGGGCAGGAGGACCATGG + Intronic
1172035844 20:32010330-32010352 TGGGAGGGGCAGGAACTCCAGGG + Intergenic
1172845426 20:37927508-37927530 TGGGGTGGGCAGGAGCACAGGGG - Intronic
1172973564 20:38890441-38890463 TGTGGTGGGGAGGAGCCCACTGG - Intronic
1173502564 20:43565002-43565024 AGGGGTGGGCAATAGCCCCAGGG - Intronic
1173809547 20:45947763-45947785 TGCGGGGAGGAGGAGCCCCAGGG + Exonic
1173853068 20:46231142-46231164 AGGGCTGGGCAGCAGCACCACGG - Intronic
1174230628 20:49043058-49043080 TGGGATGGGGAGGATTCCCAAGG + Intergenic
1174578618 20:51555253-51555275 TGGGGTAATCAGGAGCCCCTGGG - Intronic
1175322794 20:58101181-58101203 TGGGCTGGGCTGGGGCCCGAGGG + Intergenic
1175546850 20:59783775-59783797 AGGGGGAGGCAGGAGCCCCCAGG + Intronic
1175624807 20:60481411-60481433 TGGGGTGGGAGGAAGCCCTAGGG + Intergenic
1175765168 20:61587361-61587383 TAGTGTGGGCAGGCGTCCCAGGG - Intronic
1175804572 20:61820400-61820422 TGAGGTGGGCAGGTGCCCGGAGG - Intronic
1175826132 20:61937625-61937647 AGGGGTGGGGAGCAGCCACAAGG - Exonic
1175981900 20:62742897-62742919 TGGGATGAACAGGAACCCCACGG - Intronic
1176041924 20:63070244-63070266 TGGGGTGGGGAGGAGGAGCAGGG - Intergenic
1176046630 20:63096345-63096367 TGGGGAAGGCAGAGGCCCCAAGG - Intergenic
1176111433 20:63412568-63412590 AGGACTGGGCAGGAGCCCCAGGG + Intronic
1176160309 20:63644164-63644186 TGAGGTGGGCAGGCACCGCAGGG + Intronic
1176178967 20:63740823-63740845 GGTGGCGGTCAGGAGCCCCAGGG - Intronic
1176256886 20:64157663-64157685 TGGTGTTGGGAGGAGCCCCCTGG + Intronic
1176374856 21:6082008-6082030 TGGGGTTGCTAGGACCCCCACGG + Intergenic
1176862266 21:14017288-14017310 TGGGGGGGTCAGGCACCCCAAGG - Intergenic
1178437845 21:32575414-32575436 GGGGGTGGGCAGGAAGCCCGGGG + Intergenic
1178978496 21:37241239-37241261 TGGTGTGAGCAGGAACCACAGGG - Intronic
1179200243 21:39211562-39211584 TGGTGTGGCCAGAAGCTCCAGGG - Intronic
1179499891 21:41801576-41801598 AGGGGTGGTAAGGTGCCCCACGG + Exonic
1179718493 21:43302334-43302356 TGGGGTGTGCTGTAGCCTCAGGG - Intergenic
1179748619 21:43456237-43456259 TGGGGTTGCTAGGACCCCCACGG - Intergenic
1179874998 21:44262794-44262816 TGGGGTGGGGATGGGCCTCAGGG + Intergenic
1179906423 21:44425494-44425516 TGAAGTGGGCAGGGCCCCCAGGG - Intronic
1179924280 21:44525457-44525479 TGCTGTGGGCAGGTGCCCCAGGG + Intronic
1180149150 21:45938893-45938915 TGGGGTGAGCAGCAGCTCCATGG - Intronic
1181033903 22:20160893-20160915 AGGGGGAGGCAGGAGCCCCCAGG + Intergenic
1181236610 22:21450963-21450985 TGGGGCAGGGAGGATCCCCAGGG + Exonic
1181460360 22:23082722-23082744 TTGGGTGGGCTGGGGCTCCAAGG - Intronic
1182288352 22:29260746-29260768 CGGGGTGGCAAGGAGCCTCAGGG + Exonic
1182358835 22:29734978-29735000 TGGGGTGCCCAGGAGAGCCAGGG + Intronic
1183352554 22:37342371-37342393 GGGGGTGGGCAGGAGACACTGGG - Intergenic
1183669461 22:39264000-39264022 TGGGGTGGGGGGTAGCCCCATGG - Intergenic
1183684970 22:39356538-39356560 TTGGGCGGGCCTGAGCCCCAGGG + Intronic
1183948280 22:41338971-41338993 TGGGGTGGGCAAGAGCCGAAGGG - Intronic
1184264718 22:43341012-43341034 AGGGGTGGGCAGGAGACTTAGGG - Intronic
1184272981 22:43395425-43395447 TGGGGTGGGAGGGAGCCACAAGG - Intergenic
1184651292 22:45920521-45920543 TGGGGTGGGCAGGGGCTCAGTGG + Exonic
1185245554 22:49771112-49771134 TGAGGTGGGCACCAGCCCCGTGG + Intergenic
1185258854 22:49850478-49850500 GGTGGTGGGGTGGAGCCCCATGG - Intergenic
1185277774 22:49957159-49957181 GGGGGTGGACAGGATCCCCAGGG + Intergenic
1185307083 22:50125192-50125214 GGGAGTGTGCTGGAGCCCCATGG + Intronic
1185320680 22:50198972-50198994 TGGGGTCGGCTGGAGCTCCAGGG - Exonic
1185325360 22:50222882-50222904 AGGGGTGAGCAGGAGGCCGAGGG + Intronic
1185385995 22:50531540-50531562 TGGGGTGGCCAGGGGCCCGGGGG + Intronic
949106886 3:210411-210433 TGGGGTGGGCTGGTGGCCCCAGG + Intronic
949505029 3:4719566-4719588 TGTGGTGGGGAAGAGCCCCAAGG + Intronic
949718937 3:6966091-6966113 TGGGCTGGGAGAGAGCCCCAAGG - Intronic
949896224 3:8768992-8769014 CGGGCTGGGGAGGAGCCCCGCGG - Intronic
950040834 3:9918123-9918145 TGGGGTGGGCATGAGGGCCAGGG + Intronic
950107000 3:10394671-10394693 TGGGGTGGGCAGCAGGTCCTGGG + Intronic
950442400 3:13017876-13017898 TGGGATGGGCAGGAGGTCCTGGG - Intronic
950485828 3:13273594-13273616 TGGGATGGGCAGGAGCACGTGGG - Intergenic
950541635 3:13616650-13616672 TGGGGTGGGAAGGAGGCCCTGGG + Intronic
950584341 3:13881667-13881689 AGAGGTGGGCATGAGCCCCAGGG + Intergenic
950709565 3:14804778-14804800 AGGGGTAGGCAGGGGCCTCAAGG - Intergenic
952412175 3:33059165-33059187 TGAGGTGGGTAGCATCCCCAAGG + Intronic
952414322 3:33076532-33076554 TGAGGTGGGCAGGAGGCAGAAGG + Intronic
953211445 3:40878565-40878587 TGTGGTGGTCCAGAGCCCCAGGG + Intergenic
953752064 3:45616533-45616555 TGGGGAAGGCAGGACCTCCAAGG - Intronic
954196949 3:49002627-49002649 GGGAGTGGGCAGGAGGCTCACGG - Intronic
954379879 3:50213678-50213700 TAGGTTGGGCAGGAGGCCCCTGG + Intronic
954392434 3:50274696-50274718 TGGGTTGGGCAGCATCCACAGGG - Intronic
954417427 3:50400207-50400229 AGGGGGGAGCTGGAGCCCCAGGG + Intronic
954426152 3:50444132-50444154 GGGGCTGGGCAGGTCCCCCAAGG + Intronic
954437541 3:50503889-50503911 TGGGGTGGGGAGGAGCGGCAGGG - Intronic
954689406 3:52387751-52387773 TGGGTGGGACAAGAGCCCCAGGG + Intronic
954704039 3:52469293-52469315 TGGGGTTGGCAGTGCCCCCAAGG - Intronic
954955795 3:54517471-54517493 TGGGGTGGACAAGAGGCCCTGGG - Intronic
955225041 3:57053333-57053355 TGGGGCAGGGAGGAGCTCCATGG + Intronic
956172622 3:66444522-66444544 TGGGGCTGGGGGGAGCCCCAAGG - Intronic
956204429 3:66740908-66740930 TGGGGAGGACAGGAGCTCCTGGG + Intergenic
956208274 3:66776579-66776601 AGGGGTGGGCAGGACCCGCATGG - Intergenic
956877798 3:73480582-73480604 TGGGGTAGGCAGGAGGGCCAGGG - Intronic
957035990 3:75293587-75293609 GGGGGTGGGCAGGGGTCCAAAGG - Intergenic
960121473 3:113951633-113951655 TGGTGGGAGCAGCAGCCCCAAGG + Intronic
961313124 3:126016431-126016453 TGGAGTGCACTGGAGCCCCAAGG - Intronic
961819917 3:129570786-129570808 TGTGATGGGCAGCTGCCCCACGG + Exonic
962277897 3:134029782-134029804 GAGCTTGGGCAGGAGCCCCATGG + Exonic
962375750 3:134857477-134857499 TGGAGTGGGCACGGACCCCAGGG - Intronic
962973868 3:140429371-140429393 TGGACCAGGCAGGAGCCCCAGGG + Intronic
963771268 3:149388728-149388750 TGGGGTGGCCAGGAGGCAGAGGG + Intergenic
963879526 3:150513396-150513418 TGAGATTGGCAGGAGCCCCTGGG + Intergenic
966887242 3:184383454-184383476 TGGCGTGGGCAGCAGGCCCCAGG + Intronic
967194468 3:187014505-187014527 TGGGGAGGGCAGGCAGCCCAGGG + Intronic
968655523 4:1776938-1776960 GGGGCTGGGCCGGAGGCCCAAGG - Intergenic
968668378 4:1834019-1834041 TGGGGGGCTCAGCAGCCCCATGG + Intronic
968901315 4:3433298-3433320 TGGGGAGGGCGGGAGCCCGTGGG - Intronic
969124799 4:4939009-4939031 TGAGGTGGGCAGATCCCCCACGG + Intergenic
969143233 4:5098351-5098373 TGGGGTGGTGATTAGCCCCAGGG - Intronic
969676398 4:8616668-8616690 GGGGGTGAGGAGGAGCCACAGGG + Intronic
972245771 4:37244514-37244536 GGGGGTGCGCAGGAGCCTCCTGG - Exonic
972724315 4:41732850-41732872 GGGTGTGGGTAGGATCCCCAAGG - Intergenic
973120467 4:46515551-46515573 TGGGAGGGAAAGGAGCCCCAAGG - Intergenic
973314306 4:48743840-48743862 CGGGGTAGGCTGGAGACCCAGGG - Intronic
973846111 4:54914753-54914775 TGGGGTGCGCTGGAGCCTGAAGG + Intergenic
974013368 4:56627106-56627128 TCATGTGGGCTGGAGCCCCAGGG + Intergenic
975800595 4:78056645-78056667 GGGGGTGGGAGGTAGCCCCAGGG + Intergenic
975863790 4:78704922-78704944 TGTGCTGGGCTAGAGCCCCATGG + Intergenic
976127411 4:81848747-81848769 TGTAGTGGGCAGGAGCCTCACGG - Intronic
982260217 4:153488318-153488340 TGGGGTGGGCGGAAGCAGCACGG + Intronic
983210516 4:164953558-164953580 TGGGTTGGGTTGGGGCCCCAGGG - Intergenic
985650719 5:1105975-1105997 TGGGTGGGGCAGGAGTCCCTGGG - Intronic
985676280 5:1232852-1232874 TCCGGTGGGCAGGAGCTCCAGGG - Exonic
985838547 5:2288808-2288830 TGGGGAGGCCATGAGCCCCAGGG + Intergenic
986267647 5:6204126-6204148 TGCGGTGAACAGGAGCTCCAGGG + Intergenic
990088917 5:52015956-52015978 TGGGCTGGGCTGGAGGCCTAGGG - Intronic
992529696 5:77642380-77642402 TGGGGTGGGATGGGGCCCCCGGG + Intergenic
997230267 5:132237422-132237444 TGTGGTGGGTAAGAGTCCCAGGG - Intronic
998383314 5:141741446-141741468 GGGGGCTGGAAGGAGCCCCAGGG - Intergenic
999101251 5:149027838-149027860 TGTGGTGGGCAGCAGCCCGCTGG - Exonic
999282080 5:150372602-150372624 TGGGCAGGGCTGCAGCCCCAAGG + Intronic
1001535580 5:172495561-172495583 AGGGGTGGGAAGGGGACCCAGGG + Intergenic
1001567345 5:172708037-172708059 TGGGGTGGTCAGGGGCCTCAGGG + Intergenic
1001632646 5:173187467-173187489 TGGTTTGGGCAAGAGCCACAGGG + Intergenic
1002138355 5:177122518-177122540 TGATCTGGGCTGGAGCCCCAAGG + Intergenic
1002181136 5:177431651-177431673 TGGGCTGGGCCGGAACCTCACGG + Intronic
1002523479 5:179803769-179803791 TGGTGTGGGCGGGAGCCCGTGGG - Intronic
1003809815 6:9767408-9767430 TGGGGTGGGCAGGGAGGCCATGG + Intronic
1003991269 6:11488709-11488731 GGGGGTGGGCAGGAAACCCTAGG + Intergenic
1004370989 6:15051855-15051877 TGGGGTTGCAAGGAGCTCCAAGG + Intergenic
1004709450 6:18155702-18155724 GGAGGTGGGCGGGTGCCCCAGGG + Intronic
1005279798 6:24261458-24261480 TGGGATGGGCTGGAGTGCCAGGG + Intronic
1005784336 6:29227606-29227628 TGGGGAAGGAAGGAGCCCTAAGG - Intergenic
1006101639 6:31689483-31689505 TGGGGTGGGGTGGAGGCTCAAGG - Intronic
1006118966 6:31792493-31792515 TTGGGAGGGCAGGAGCCTCGGGG + Exonic
1006131271 6:31870791-31870813 GGGGGTGGGCAGGACACTCACGG + Exonic
1006139722 6:31920949-31920971 GGGCATGGGGAGGAGCCCCATGG + Intronic
1006511577 6:34524417-34524439 TGGGGTGGCCAGGGGACGCAGGG - Intronic
1007355655 6:41313927-41313949 TGGGCTGCTCAGGATCCCCAGGG - Intergenic
1007407282 6:41642349-41642371 TGGGGTGGGCAGGAGGCAAGGGG - Intronic
1007546442 6:42698269-42698291 TCGGGAGGGGAGGGGCCCCAGGG + Exonic
1010324742 6:74551052-74551074 TGGGGTGGGGTGTAGCCTCAAGG + Intergenic
1011941776 6:92851250-92851272 TGGCTTGGGCAGAAGCCCCTAGG - Intergenic
1012424666 6:99100820-99100842 TGGGGTGGGCAGTCACCCTAGGG - Intergenic
1013643755 6:112114624-112114646 TTGGGTGTGCAGGCTCCCCAGGG + Intronic
1015805272 6:137102203-137102225 TGGGGAGGGAAGGAGGCTCAAGG - Intergenic
1017318590 6:153062083-153062105 TGGGGTGGGCGGGAGGCACGGGG - Intronic
1017523341 6:155221255-155221277 TGGGGTGGGCTGGAGGATCAGGG + Intronic
1017726125 6:157277034-157277056 GGGGGTGGGGAAGAGACCCAGGG + Intergenic
1018722348 6:166582040-166582062 TGGGCTGGGCAGGAGGGCCCAGG + Intronic
1018722369 6:166582099-166582121 TGGGCTGGGCAGGAGGGCCCAGG + Intronic
1018900550 6:168049758-168049780 TGGGGTGGGGTGGGGGCCCAGGG + Intergenic
1019284580 7:217173-217195 TCGGGGGGTCAGCAGCCCCAGGG - Intronic
1019322102 7:420442-420464 AGGGGTGGGCAGCGGCCCCTTGG - Intergenic
1019538253 7:1539855-1539877 TGGGGTGGCCAGGAACCCAGCGG - Intronic
1019611600 7:1939630-1939652 GTGCGTGGGCAGAAGCCCCAAGG - Intronic
1019736502 7:2652514-2652536 TGGGGGAAGGAGGAGCCCCAGGG + Intronic
1019922362 7:4171178-4171200 TGGGGTGGCCACGTGCCCCAGGG + Intronic
1019999422 7:4746890-4746912 TGGGGTGGGGAGGGGCAGCAAGG - Intronic
1020111878 7:5452125-5452147 TGGGGCAGGCAGGAGGACCAAGG - Intronic
1020176878 7:5889053-5889075 TATGGTGGCCAGAAGCCCCATGG - Intergenic
1020212585 7:6167263-6167285 AGGGGAGGGCAGGAGACCCTGGG + Intronic
1023803336 7:43853672-43853694 TAGGGTAGGCTGGAGACCCAGGG - Intergenic
1023863797 7:44229422-44229444 TGGGCAGGGCAGGGGCCCCTCGG + Exonic
1023995664 7:45157736-45157758 TGGGGTGGGGCGGGGCCTCAGGG - Intergenic
1024054019 7:45648171-45648193 TGGGGAGGTCAGAAGCCCCAGGG + Intronic
1024293884 7:47827524-47827546 TTGGCTTGGCAGGAGCACCAGGG - Intronic
1024630918 7:51246402-51246424 GAGGATGGGCAGGAGGCCCAGGG - Intronic
1024752202 7:52480115-52480137 TGGAGTGAGCAGCAGCCACATGG - Intergenic
1025173974 7:56787558-56787580 TGGGCTGGGCAGGAGCGCGAGGG - Intergenic
1025698126 7:63790397-63790419 TGGGCTGGGCAGGAGCGCGAGGG + Intergenic
1025724435 7:64044204-64044226 TGTGATGGGGAGGAGCTCCAGGG - Intronic
1025829847 7:65038867-65038889 CGGGCTGGGCAGGAGCGCGAGGG + Intergenic
1027048690 7:75007924-75007946 ACGGGTGGGCAGCTGCCCCAGGG + Intronic
1028233243 7:88330296-88330318 TTGGCTGGGCAGGAGCTCCTGGG + Intergenic
1029081960 7:97981947-97981969 TATGGTGGTCAGAAGCCCCATGG + Intergenic
1029384319 7:100233726-100233748 ACGGGTGGGCAGCTGCCCCAGGG - Intronic
1031605496 7:123763287-123763309 CGGGCTGCGCAGGAGCCCCAAGG + Intergenic
1031986884 7:128168980-128169002 TCGGGTGGCCAGGAGCACCCAGG + Intergenic
1032083011 7:128869467-128869489 CGGACTGGGCGGGAGCCCCACGG + Intronic
1032217523 7:129969154-129969176 TGGGGTGGGCTGCAAGCCCAGGG - Intergenic
1033046905 7:137970601-137970623 TGGGGTGGGCAGGATCCAGGTGG + Intronic
1033151165 7:138916016-138916038 TGTGGTGGGGAGGAGACCAAAGG + Intronic
1034556894 7:151855754-151855776 TGGGGGCGGCAGGAACCACAGGG + Intronic
1035311770 7:157974321-157974343 TGAGCTGGGGAGGAGCCCCGTGG - Intronic
1035371081 7:158379256-158379278 TGGGGTTGGCAGGAGGACCGGGG + Intronic
1035567671 8:652131-652153 TGGGGTGGCATGGAGCACCAGGG - Intronic
1035650301 8:1258905-1258927 TGGGGTGGGCGGGGGCCGCGCGG + Intergenic
1035755671 8:2029988-2030010 CTGGGTGGGCTGGAGACCCAGGG + Intergenic
1036032929 8:4992566-4992588 GGGTGAGGGCAGGAGCCCAAGGG - Intronic
1036359116 8:8065291-8065313 TGGGGTGGGGAGGAGGTGCAGGG + Intergenic
1036614541 8:10378332-10378354 TTGGGTGGGCAGCTGCCCCAAGG + Intronic
1036802378 8:11802382-11802404 TAGGATGCGCAGGAGCCCAACGG - Exonic
1036891842 8:12601661-12601683 TGGGGTGGGGAGGAGGTGCAGGG - Intergenic
1037373158 8:18201665-18201687 TGGGTTGGCCAGCAGCCTCAGGG + Intronic
1037800387 8:22031350-22031372 TGGGGAGGGTAGGACCCTCAAGG - Intronic
1037803643 8:22048273-22048295 AGGGGTGGGGAGGCGGCCCAGGG - Exonic
1038014045 8:23498225-23498247 TTGGGTAGGGAGGAGCCCCCAGG + Intergenic
1038497094 8:28011147-28011169 AGGGATGGGCAGGGGCACCAGGG + Intergenic
1039182427 8:34880938-34880960 TTGGTTGGGCAGGAGCTCCCTGG - Intergenic
1039845542 8:41323188-41323210 GGGTGTGTGCAGGAGGCCCAGGG - Intergenic
1039846479 8:41329445-41329467 TGGCGTGGCCAGGTGACCCAGGG - Intergenic
1039884985 8:41649601-41649623 TGTGGTGGGCAACAGCCCCCTGG + Intronic
1041636629 8:60153039-60153061 CGGGCTGCGCAGGAGCCCAAGGG + Intergenic
1041760778 8:61363883-61363905 TGGGCTAGGCAGGGGCGCCATGG + Intronic
1045347266 8:101304489-101304511 TGGGGTGGGCAGGGGCATGATGG - Intergenic
1046784326 8:118250192-118250214 TGGTATGTGCAGGAGTCCCATGG + Intronic
1047938373 8:129803645-129803667 TGGGATGGGCAGGAGCGCTAAGG - Intergenic
1048743201 8:137585118-137585140 GGAGGTGGGCAGAAGCCACATGG + Intergenic
1049165292 8:141121975-141121997 CGGGGTGTGGAGGAGCCCCGGGG - Intronic
1049348561 8:142152067-142152089 GGGGGTGGGGAGCAGCGCCATGG - Intergenic
1049392871 8:142381160-142381182 AAGGGTGGGCAGGATTCCCAGGG - Intronic
1049527143 8:143133090-143133112 TGGAGTGGGCTGGAGACCCTGGG - Intergenic
1049537444 8:143188915-143188937 GGGGGTGGGCAGGAGCCCAGCGG + Intergenic
1049607487 8:143536488-143536510 GTGGGTGGGCAGAACCCCCAGGG - Intronic
1049649884 8:143760975-143760997 TGCGGAGCGCAGGAGCACCAGGG + Intergenic
1049765471 8:144353389-144353411 TGTGATGGGCAAGAGCCCCATGG - Exonic
1050525685 9:6544308-6544330 ATGGGTGGGCAGGGGCCTCAGGG - Intronic
1051081017 9:13293210-13293232 AGGGAAGGGCATGAGCCCCAAGG - Intergenic
1052832770 9:33229412-33229434 AGAGGTGGGCAGGAGACCCTGGG + Intronic
1053024090 9:34716023-34716045 TGGGGTGGGCTGGGGCCCATGGG + Intergenic
1053907117 9:42852896-42852918 TGGGGTGGGAGGGGGCCCCCAGG + Intergenic
1056817428 9:89811817-89811839 TGGGGTGGGGAGGAGGGCCGGGG + Intergenic
1058547649 9:106077924-106077946 TGTGGTGAGCAGCAGCACCAGGG - Intergenic
1058868819 9:109185426-109185448 TGAGGTGGGCAGGAGCCACCAGG - Intronic
1058903564 9:109462374-109462396 TGGGGTGTGCGGAAGACCCAGGG + Intronic
1059650684 9:116313280-116313302 TGGGGTGGGCAGGAGCCCCAGGG - Intronic
1060539477 9:124419915-124419937 TGGGCTGGGCTGCAGTCCCAGGG - Intergenic
1060839383 9:126781903-126781925 AGGGGACGGGAGGAGCCCCAGGG + Intergenic
1061010374 9:127950988-127951010 CAGGATGAGCAGGAGCCCCAGGG + Intronic
1061150097 9:128823503-128823525 AGGGGTGGGCAGGGCCCCCTGGG + Intronic
1061423377 9:130484154-130484176 AGGGGTTGGCTGGAGCCCAAGGG - Intronic
1061514485 9:131080824-131080846 TGGGGTGGGGAGGAGGACGAAGG - Intronic
1061912067 9:133730228-133730250 TGGGGTGGGAAGCACCCCCGGGG - Intronic
1061965208 9:134009944-134009966 TGGGGTGGGCTGGAGAGTCATGG - Intergenic
1061996769 9:134190103-134190125 TGGGGAGGGCACTAGCCACAGGG - Intergenic
1062056716 9:134472718-134472740 TGGGGTGGGCCAGGGCCCCCAGG - Intergenic
1062265812 9:135685986-135686008 TGCAGTGACCAGGAGCCCCAGGG - Intergenic
1062294467 9:135816830-135816852 AGCGGTGAGCAGGAGCTCCATGG + Intronic
1062337044 9:136075943-136075965 AGGAGTGGGCAGCAGCCCCAGGG - Intronic
1062385080 9:136306090-136306112 TGGGGTGGACAGGAGCAGCAAGG + Intronic
1062427632 9:136513206-136513228 TGGGGTGGGGAGCAGGCCCAGGG - Intronic
1062463886 9:136672799-136672821 TGGGGTGGGGAGGGGGTCCAAGG + Intergenic
1062466515 9:136683966-136683988 TGGTGTGGGCACGTGCTCCATGG + Intronic
1062498195 9:136841437-136841459 TGGAGGGGGCAGGAGCCTGAAGG - Intronic
1062524412 9:136972466-136972488 GGGGGCAGGCAGGAGCCCCCGGG + Intergenic
1062540762 9:137040778-137040800 GGGGGTGGGCAGGGGCAGCAGGG - Intronic
1062592198 9:137279277-137279299 TGGCGTGGGCAAGAGCCACGTGG + Exonic
1186463425 X:9765909-9765931 TGGGGTGGGGGAGAGGCCCAGGG - Exonic
1189317356 X:40065395-40065417 TGGGGTGGCCAGCATCCCCAAGG - Intronic
1190338015 X:49274550-49274572 TGGGGTGGACAGGCTCCCCTGGG - Intronic
1190392859 X:49949364-49949386 TGGGTAGGGCAGGAGATCCATGG + Intronic
1195564229 X:106323322-106323344 TGGGGTGGGCCTGAAGCCCAGGG - Intergenic
1197222181 X:123924808-123924830 TGGGGGGGGCAGGAGGGACAGGG + Intergenic
1199531770 X:148856096-148856118 TGGGGTAGGCAGGTGAGCCAAGG - Intronic
1199739055 X:150715294-150715316 TTGGGTGGGCTGGAGCCCTCAGG + Intronic
1199853296 X:151740359-151740381 TGAGGTGGGCAGGAAGCTCATGG + Intronic
1199869622 X:151886671-151886693 TTGGGTGGAGAGGAGACCCAAGG + Intergenic
1200045145 X:153397096-153397118 CGGGCTGGGGAGGAGCCCCAGGG + Intergenic
1200059841 X:153479348-153479370 TGGGCTGGGCAGCAGCTGCAGGG - Intronic
1200074452 X:153544212-153544234 TGGGCTGGGCTGGAGTCCCTAGG + Intronic