ID: 1059650685

View in Genome Browser
Species Human (GRCh38)
Location 9:116313281-116313303
Sequence CTGGGGTGGGCAGGAGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 964
Summary {0: 1, 1: 0, 2: 13, 3: 99, 4: 851}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059650685_1059650695 13 Left 1059650685 9:116313281-116313303 CCTGGGGCTCCTGCCCACCCCAG 0: 1
1: 0
2: 13
3: 99
4: 851
Right 1059650695 9:116313317-116313339 ACATGACTCATATGTGCAGGTGG No data
1059650685_1059650697 21 Left 1059650685 9:116313281-116313303 CCTGGGGCTCCTGCCCACCCCAG 0: 1
1: 0
2: 13
3: 99
4: 851
Right 1059650697 9:116313325-116313347 CATATGTGCAGGTGGTGAAAGGG No data
1059650685_1059650698 22 Left 1059650685 9:116313281-116313303 CCTGGGGCTCCTGCCCACCCCAG 0: 1
1: 0
2: 13
3: 99
4: 851
Right 1059650698 9:116313326-116313348 ATATGTGCAGGTGGTGAAAGGGG No data
1059650685_1059650696 20 Left 1059650685 9:116313281-116313303 CCTGGGGCTCCTGCCCACCCCAG 0: 1
1: 0
2: 13
3: 99
4: 851
Right 1059650696 9:116313324-116313346 TCATATGTGCAGGTGGTGAAAGG No data
1059650685_1059650694 10 Left 1059650685 9:116313281-116313303 CCTGGGGCTCCTGCCCACCCCAG 0: 1
1: 0
2: 13
3: 99
4: 851
Right 1059650694 9:116313314-116313336 CAAACATGACTCATATGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059650685 Original CRISPR CTGGGGTGGGCAGGAGCCCC AGG (reversed) Intronic
900129831 1:1082697-1082719 CTGTGGTGGGGAGGAGCCTCAGG + Exonic
900289480 1:1917813-1917835 GTGGGGTGGGCTGGGGCCCTTGG + Exonic
900294480 1:1942080-1942102 CTGTCTTGGGCAGGAGCTCCAGG + Exonic
900316591 1:2060214-2060236 GTTGTGTGGGCAGGAGCTCCTGG + Intronic
900356277 1:2266324-2266346 CTGGGGTCTGCAGAGGCCCCTGG - Intronic
900392901 1:2441395-2441417 TGGGGGTGGGCAGGAGCCTGGGG + Intronic
900401537 1:2474809-2474831 ATGAGGTGGGCAGGGGCCCTGGG + Intronic
900488144 1:2933200-2933222 CTCGGGGGTGCAGGAGACCCAGG + Intergenic
900529928 1:3148162-3148184 GAGAGGTGGGAAGGAGCCCCCGG + Intronic
900560543 1:3303799-3303821 CTGGGGAGCGCAGGAGGCCGTGG + Intronic
900560584 1:3303971-3303993 CTGGGGAGCGCAGGAGGCCATGG + Intronic
900560627 1:3304143-3304165 CTGGGGAGCGCAGGAGGCCGTGG + Intronic
900600129 1:3499294-3499316 CAGGGGTGGGCAGGACCCCAGGG + Intronic
900653623 1:3743971-3743993 GTGGGCTGGACAGGAGCCCGGGG + Intergenic
900965248 1:5952897-5952919 CTGGGGTGGGTAGGGACCCTCGG - Intronic
900993674 1:6109112-6109134 CTGGGCTGGGCAAGGGCCCACGG + Intronic
901063462 1:6484521-6484543 CTGGGGTGGGCAGAGCTCCCTGG + Intronic
901150657 1:7099019-7099041 GCGGGGTGGGCAGGAGCCACAGG - Intronic
901211064 1:7526366-7526388 CAGGGGTGTGCAGTAGCCACGGG - Intronic
901251449 1:7783525-7783547 CGGGTGTGGGGAGGAGCCCAGGG - Intergenic
901649990 1:10737813-10737835 CTGGAGTGGGCCGGGGCCTCCGG - Intronic
901692053 1:10980169-10980191 CTGGGCTGGGCCTGAGGCCCTGG - Intronic
901756097 1:11442455-11442477 CTGGGGCTGATAGGAGCCCCTGG + Intergenic
902387262 1:16083087-16083109 CCAGGGTGGGCACAAGCCCCTGG - Intergenic
902551126 1:17220169-17220191 CAGGAGTGTGCAGGGGCCCCAGG - Intronic
902638384 1:17750350-17750372 CTGGGGTGGGGAGCAGCCCCAGG + Intergenic
902778604 1:18690465-18690487 CAGACGTGGGCAGGAGCCACAGG + Intronic
902884220 1:19393355-19393377 CTGGGGTGAGCGGGAGCCCCTGG - Intronic
903003438 1:20282649-20282671 CTGGCCTGGCCAGGGGCCCCAGG - Intergenic
903067609 1:20709544-20709566 CTCGGGGCCGCAGGAGCCCCTGG - Intronic
903130716 1:21277959-21277981 CTGGGGTGGGGAGGGGACTCAGG - Intronic
903340923 1:22653765-22653787 CTGGGCCGGGCAGGAGCGACTGG - Intronic
903372284 1:22844410-22844432 CAGGGGCTGGCAGGAGACCCAGG + Intronic
903379246 1:22885439-22885461 CTGGGGTTGGCAGGACCTGCAGG + Intronic
903500149 1:23796165-23796187 CTGGGGTGGACAGCAGCCTTAGG - Exonic
903651938 1:24927807-24927829 CTGGGCTGGGCAGCTCCCCCAGG + Intronic
903660742 1:24976649-24976671 CTGGGGTGGGGAGAAGACCTGGG + Intergenic
903774874 1:25786545-25786567 CTGGGGCGGGCATGTGACCCAGG - Intergenic
903859509 1:26356414-26356436 GTGGGGAGGGCAGGAGCTCTGGG - Intergenic
904215480 1:28915082-28915104 GTGCGGTGTGCAGGAGCCTCGGG + Intronic
904287483 1:29461655-29461677 CTGGGGCTGGCAGGGACCCCAGG + Intergenic
904482294 1:30801660-30801682 CTGGGGTAGGGAGGTGCCCAGGG - Intergenic
904646609 1:31972248-31972270 CTAGGGTGGTCTTGAGCCCCTGG - Intergenic
905371186 1:37483418-37483440 CAGGGGCTGGCAGGAGCCCGTGG + Exonic
905649640 1:39647631-39647653 CTGAGGTGGCCATCAGCCCCAGG - Intergenic
905678276 1:39845761-39845783 CTGGGGTGGGGAAGTCCCCCTGG + Intronic
905974904 1:42167843-42167865 CTGGGGTGGGGATGAACACCGGG + Intergenic
906105191 1:43287339-43287361 GTGGGGAAGGCAGGAGTCCCAGG - Intergenic
906177918 1:43791919-43791941 CTGGGCTGGGCAGGGTCTCCTGG + Intronic
906638218 1:47424628-47424650 TTTGGGCTGGCAGGAGCCCCTGG + Intergenic
907179167 1:52553908-52553930 CTGCGGTGGGCTGGAGGCCGTGG - Intergenic
907425153 1:54374901-54374923 CTCAGGTGGGCAGGAGGCCAGGG + Intronic
907762171 1:57371796-57371818 CTGGGGTGTAAAGTAGCCCCTGG - Intronic
910638611 1:89437095-89437117 GTTGGCTGGGCAGGAGCCTCAGG + Intergenic
912122642 1:106491657-106491679 CTGGGCTGGGTAGGAGTTCCTGG - Intergenic
912401600 1:109397927-109397949 CGGGGGTGGGCGGGCGCGCCGGG - Exonic
912452601 1:109776589-109776611 CTAGGGTGGGCACAAGCCACAGG + Intergenic
912985932 1:114430450-114430472 CTGGGCTGGGCTGGATCCCGGGG + Intronic
913045130 1:115067888-115067910 CTGGAGTGGGCAGACACCCCAGG - Intronic
913163758 1:116167669-116167691 GTGGGGTGGACAGGAGCGCCCGG - Intergenic
914341229 1:146762226-146762248 TTGGGCAGGGCAGGAGACCCAGG - Intergenic
914784258 1:150814103-150814125 CTAGGGTAGGCAGCAGCACCAGG + Exonic
915110493 1:153561713-153561735 ATAAGGTGGGCAGGAGGCCCTGG + Intronic
915892658 1:159785666-159785688 CTCCTGTGGACAGGAGCCCCAGG - Intergenic
915951071 1:160190345-160190367 AGGGGGAGGGAAGGAGCCCCTGG + Intergenic
915951163 1:160190682-160190704 CTGGGGTAGGGAGGGGCCCCTGG - Exonic
916507797 1:165443765-165443787 CTTGGCTGGGCAGAACCCCCTGG - Intronic
917133374 1:171764309-171764331 CTCGGGTGGGGAAGGGCCCCAGG - Intergenic
917173313 1:172201790-172201812 CAGGGGTTGGCTGGAGGCCCAGG + Intronic
918045121 1:180936682-180936704 CTGGGCTGGGCAGGAACCAGCGG - Intronic
918189891 1:182163951-182163973 CTGGGGAGGGCAGCAGCAGCAGG + Intergenic
919788842 1:201277138-201277160 CTGGTGTGTGGAGGAGCCCTAGG + Intergenic
919800391 1:201350571-201350593 CTGGGGTGGGCATGGGGCCAGGG + Intergenic
919801855 1:201359118-201359140 CTGGGGTGCCCAGGAGGGCCCGG + Exonic
919887547 1:201946022-201946044 CAGGGGAGGGCTGGAGACCCTGG - Intronic
920126587 1:203698536-203698558 GTGGGGTGGGGAGGAACCCTTGG - Intronic
920185992 1:204159860-204159882 CTGGGGAGGGGAGGAGCTCTTGG - Intronic
920747685 1:208644321-208644343 CTGGCTGGGGCAGGAGACCCTGG - Intergenic
921013289 1:211163041-211163063 CTGGGTTGGGGAGGCTCCCCTGG + Intergenic
921097136 1:211896229-211896251 CTGGGGAGGGCAGTAGACCCAGG - Intergenic
922606656 1:226893904-226893926 CTGGGCTGGGCAAGAGCAGCTGG + Intronic
922754557 1:228088346-228088368 CTGGGGTGTGCAGTGGCCCTCGG + Intronic
922821666 1:228488916-228488938 CAGGGGTGGGCAGAAGCTCTGGG - Intronic
922897715 1:229113411-229113433 CTGGGCCTGGCAAGAGCCCCAGG + Intergenic
923246333 1:232136357-232136379 CTGGGGTTGGCAGGAGGCAGAGG + Intergenic
1064898101 10:20262139-20262161 CTGGGTTGGGGAGGATCCCCTGG - Intronic
1064996353 10:21299936-21299958 CAGAGGTAGGAAGGAGCCCCCGG + Intergenic
1065625468 10:27624910-27624932 CTGGGGCAGGGAGGAGACCCAGG - Intergenic
1066220967 10:33335903-33335925 GTGGGGGTGGCAGGAGCTCCAGG - Intronic
1066464793 10:35641958-35641980 TGGGGGCGGGCATGAGCCCCCGG - Exonic
1066703756 10:38156670-38156692 CCGGGTCGGGCAGGAGGCCCCGG + Intergenic
1067067817 10:43113505-43113527 CTGGGGTGGTCAGGCGCCCCAGG + Intronic
1067102432 10:43342901-43342923 CTGGGGTGAGGAGCAGGCCCTGG - Intergenic
1067698289 10:48551077-48551099 CTGGGGTGGGAAGGAGGCAGAGG + Intronic
1067847100 10:49733165-49733187 CTGGGCTGTGCAGGAGCCCTTGG - Intergenic
1069724596 10:70569062-70569084 CTGGGCTGGGAAAGAACCCCCGG - Intergenic
1069865739 10:71501791-71501813 AGTGGGAGGGCAGGAGCCCCTGG + Intronic
1069992536 10:72324154-72324176 GACGGGTGGGCTGGAGCCCCGGG + Intergenic
1070129692 10:73647829-73647851 CTGGGGGGCTCAGGAGCCCCTGG + Exonic
1070275472 10:75001872-75001894 CAGGGCTGTGCAGGAGCCACCGG + Intronic
1070570897 10:77638562-77638584 CAGGGGTGGGCAGGGCCCCTCGG + Intronic
1070605182 10:77893527-77893549 CTGGGGCGGGCAGGGACTCCTGG - Intronic
1070799887 10:79239155-79239177 CAGAGGTTGGCAGAAGCCCCAGG + Intronic
1071505391 10:86228687-86228709 CTGCTGTGGGCTGGAGCTCCTGG - Intronic
1072010384 10:91298338-91298360 CCGACCTGGGCAGGAGCCCCTGG + Intergenic
1072451188 10:95541022-95541044 CTGGAGTGAGCAGGAGCCTGGGG - Intronic
1072565735 10:96615284-96615306 CTGAGTGGGACAGGAGCCCCTGG + Intronic
1072623858 10:97098585-97098607 CTGGGCTGGGCAGGTGCCCAAGG + Intronic
1072864214 10:99041564-99041586 CTGGGGTGTTCAGGAGTCCAAGG - Intronic
1073077108 10:100830992-100831014 CTGGGCTGGGAAGGTGTCCCAGG - Intergenic
1073144428 10:101271249-101271271 CTGGGGGAATCAGGAGCCCCAGG + Intergenic
1073207078 10:101775144-101775166 CCGGGCTGGCCGGGAGCCCCAGG - Exonic
1073328455 10:102656174-102656196 CTGGGGAGGGCAGGGGGGCCAGG + Intronic
1074384666 10:113007328-113007350 CTGGGGTGGGCAGGGGGCAGGGG - Intronic
1075399183 10:122149382-122149404 CGGTGCTGGGCAGGAGGCCCAGG + Intronic
1075591831 10:123697563-123697585 CGGGGGTGGGCAGGAGCACCTGG - Intergenic
1075690031 10:124388540-124388562 CTGGGCTGGGCAGGAGTGGCAGG - Intergenic
1075802583 10:125161774-125161796 CTGTGTTGGGTCGGAGCCCCGGG + Intergenic
1075808824 10:125209565-125209587 CTTGGGAGGGCAGGAGTCACTGG + Intergenic
1076319678 10:129568762-129568784 CAGAGGTGGGCAGGAGAGCCAGG - Intronic
1076420562 10:130328453-130328475 CTGGTGATGGCAGGAGCCCAGGG + Intergenic
1076421435 10:130335069-130335091 CTCTGTTGGGCAGGACCCCCAGG + Intergenic
1076474952 10:130745409-130745431 CTGGGTTGGGCAGGAGTCGGTGG - Intergenic
1076572313 10:131440870-131440892 CGGGGGTGAGCAGGAGCGCCTGG - Intergenic
1076631191 10:131853266-131853288 CTGGGGTGGGTGGGGGACCCTGG - Intergenic
1076667952 10:132103453-132103475 CTGGGGGGGGGAGGAGCAGCTGG + Intergenic
1076693582 10:132236373-132236395 ATGGGGTGGCCAGGGGCTCCCGG + Intronic
1076721275 10:132394457-132394479 CTGGGCTGGAGAGGAGCCTCGGG - Intergenic
1076775685 10:132696879-132696901 CTGGGGTGGGCAGGAGTTTCAGG - Intronic
1076778148 10:132709462-132709484 CTGGGGTGGGCACGGGACCGCGG - Intronic
1076804758 10:132849818-132849840 CTAGGGTGGGCCTGAGCACCGGG - Intronic
1076847592 10:133076931-133076953 CTGGGCTGGGCAGGTGGCCACGG - Intronic
1076850559 10:133090354-133090376 CTTGGGTGAGCAGGAGCTCTGGG - Intronic
1076887774 10:133270461-133270483 CAAGGGTGGGCAGCAGCCCCTGG - Exonic
1077089360 11:771461-771483 CTGGGGTGGGCCGCAGGGCCTGG - Intronic
1077134550 11:991959-991981 GTGGGCTGGGCAGGTGCCTCCGG + Intronic
1077181270 11:1218306-1218328 CAGGTGTGGGGAGGAGCCCGGGG - Intergenic
1077217019 11:1399175-1399197 CTGTTGTGGGCAGGCCCCCCAGG + Intronic
1077219187 11:1407933-1407955 CCAGGGTGGGCAGGAGACCCAGG - Intronic
1077229248 11:1451225-1451247 CTGGGGTGGACCAGTGCCCCTGG + Intronic
1077324717 11:1958767-1958789 CTGGGGAGTGAGGGAGCCCCTGG - Intronic
1077433605 11:2527847-2527869 CTGGGGAGTGGAGGGGCCCCTGG - Intronic
1077434218 11:2531022-2531044 CCTGGCTGGGCAGGAGCACCTGG - Intronic
1077485196 11:2835241-2835263 CTGGGGTGGCCAGTGGCACCTGG + Intronic
1077611453 11:3645505-3645527 ATGGGGTGGGCATGGGCCCAAGG - Intronic
1078361814 11:10675077-10675099 CTGGGCTGGGAAACAGCCCCTGG + Intronic
1078455537 11:11471820-11471842 CTGGGCAGGGCAGGAGCCAAGGG - Intronic
1078647898 11:13159138-13159160 GTGGGGTGGGCATTAGCCCCTGG + Intergenic
1079110118 11:17600650-17600672 CTGGGGCTGTCAAGAGCCCCTGG - Intronic
1079131539 11:17749656-17749678 CTGGAGTGAGCTGGAGCCCTGGG + Intronic
1081599922 11:44485866-44485888 CAGGGGTGGGAGGGAGACCCGGG - Intergenic
1081668063 11:44928033-44928055 CTGGGGTGGGGAGGGGCTACCGG - Intronic
1083304223 11:61754374-61754396 CTGGGGAGAGCCAGAGCCCCGGG - Intronic
1083487538 11:62993073-62993095 CAGGGCTGGGCAGGAGGCTCTGG + Exonic
1083595265 11:63915948-63915970 CTGTGGTGGGAAGGAGCCTTGGG - Intronic
1083595620 11:63917249-63917271 CTGGGGTGGGAGGGAGGGCCCGG + Intergenic
1083707425 11:64525998-64526020 CTGGGGTGGGCTGAGGCCCTGGG - Intergenic
1083838567 11:65289098-65289120 CTGGGGTGGGAAGGGGTCCTGGG + Intronic
1083841737 11:65308700-65308722 CTGGAGTTGGCAGGAGTCCAGGG + Intergenic
1083959462 11:66006595-66006617 CCAGCGTGGGCAGGAGCCCAGGG - Intergenic
1084166789 11:67378857-67378879 CGGTGGTGGGCAGGAAACCCAGG - Intronic
1084190389 11:67496016-67496038 CTGGGGGGGTCTGGATCCCCAGG - Intronic
1084399023 11:68933026-68933048 CTGGGATGGGGAGGCGACCCTGG - Intronic
1084426107 11:69085330-69085352 CTGGGGTGGGCGGGAAGCCTTGG + Intronic
1085638719 11:78177849-78177871 CGGGGGAGGTCAGGAGCCACAGG + Intronic
1085841476 11:80016194-80016216 CAGAGGTGGACAGGAGGCCCAGG + Intergenic
1086984618 11:93234431-93234453 CTGGGGTAAGCATGACCCCCTGG - Intergenic
1087154278 11:94885587-94885609 CTGGTGAGGGCAGGAGGCCCTGG + Intergenic
1087168921 11:95030961-95030983 CTGGGGTGGGCAGTGGGTCCAGG - Intergenic
1087626753 11:100604248-100604270 CAGGGGTGGCCAGGTGCCTCAGG - Intergenic
1088481676 11:110301009-110301031 TTGGGCTGCGCAGGAGCCCACGG + Intergenic
1088846808 11:113675178-113675200 CTGAGCTGGACAGGAGCCCCAGG + Intergenic
1088996004 11:114997308-114997330 CTGGGCTGGGCAGGAGGAGCAGG + Intergenic
1089494787 11:118902583-118902605 CTGGGGGAGGCAGCCGCCCCTGG - Exonic
1089497726 11:118916213-118916235 GAGGGGTGGGCTGGAGCCCCTGG - Intronic
1089563396 11:119357156-119357178 CAGGGCAGGGCCGGAGCCCCTGG - Intronic
1090073089 11:123561069-123561091 CTGGGGTGGGCTGGAGAGACAGG + Intronic
1090226283 11:125074015-125074037 CTGGGAAGGGCAGGGGCCTCAGG - Intronic
1090381169 11:126328626-126328648 CTGGAGCAGCCAGGAGCCCCAGG + Intronic
1091221840 11:133934380-133934402 CTGGGGTGGGGAAGAGCTGCAGG - Intronic
1202807697 11_KI270721v1_random:13944-13966 CTGGGGAGTGAGGGAGCCCCCGG - Intergenic
1091480318 12:822324-822346 CTGAGGTGGGCAGGACCACAAGG - Intronic
1092142592 12:6194113-6194135 CTGGGGGAAGGAGGAGCCCCAGG + Intergenic
1092428324 12:8390777-8390799 CTGGGGTGGGGAGGAGGTGCAGG - Intergenic
1093369234 12:18346766-18346788 CTGAGGTGGGAAGGAAGCCCGGG - Exonic
1093498197 12:19780689-19780711 TTGGGGTTGGCTGGAGTCCCAGG + Intergenic
1093894695 12:24562768-24562790 CTGGAGGGAGCGGGAGCCCCCGG - Intergenic
1094182368 12:27605344-27605366 CAGTGGTTGCCAGGAGCCCCTGG + Intronic
1096602832 12:52742435-52742457 CAGGGTTGGGCCTGAGCCCCAGG + Intergenic
1096716439 12:53494151-53494173 CTAGGATGGCTAGGAGCCCCTGG + Intronic
1097054172 12:56240052-56240074 TTGGGGTGGGGAGCAGCCCCTGG - Exonic
1097265358 12:57741188-57741210 CTGGGGTGGGCAGGAGGATGTGG + Intronic
1097607100 12:61768941-61768963 CAGGGGTGAGAAGGTGCCCCAGG - Intronic
1101881857 12:108631030-108631052 CTGGGGATGCCAGGAGACCCAGG - Intronic
1101917723 12:108908892-108908914 CTGGGATGGGCATGACACCCAGG + Intergenic
1102491071 12:113289910-113289932 CTGGGCTTGGCGGGATCCCCTGG - Intronic
1103152907 12:118656867-118656889 CTGGTGAGGGCAGGAGCTCTGGG + Intergenic
1103564480 12:121808560-121808582 CTGGGGAGGGGAGAAGCCACAGG - Intronic
1103883765 12:124186079-124186101 CTGGGGTGTGCAGGGGTCCCCGG + Intronic
1103948159 12:124538424-124538446 CTGAGGTGGGAAGGAACCCAGGG + Intronic
1103994547 12:124820625-124820647 CTGTGGTGAGCAGGGTCCCCAGG - Intronic
1104648180 12:130511852-130511874 CTCTGCTGGACAGGAGCCCCTGG + Intronic
1104822695 12:131687418-131687440 CTGGGCAGGGCTGGAGCCCCAGG - Intergenic
1104857069 12:131907368-131907390 CTGGGCTGGGCAGGTGCCTGCGG + Intronic
1104964020 12:132501028-132501050 CTGGGCGGGGAAGGAGCCCAAGG + Intronic
1104966105 12:132509438-132509460 CTGGGGATGGAAGGAGCCGCTGG - Intronic
1104974042 12:132544110-132544132 CTGGGGTGGGGAGTAGCAGCCGG - Intronic
1105005208 12:132717234-132717256 CTCGGGCGGGCAGGAGCCATCGG + Intronic
1105298936 13:19116441-19116463 CTGGGGTGGGGAGGAACCTGCGG - Intergenic
1105433424 13:20357881-20357903 CTGGGGTGAGCAGCAGGCTCGGG + Intergenic
1105697192 13:22900521-22900543 TGGGGCTGGGCAGGAGCCCACGG + Intergenic
1106668070 13:31873426-31873448 CTGGGGTGGACAGTAGAACCAGG + Intergenic
1107188137 13:37547635-37547657 CTGTGTTGGTCTGGAGCCCCTGG + Intergenic
1108707781 13:53005780-53005802 GTGGAGCGGACAGGAGCCCCAGG - Intergenic
1109169098 13:59074489-59074511 CTCGGGTGGGCAAGAGTTCCAGG - Intergenic
1111672604 13:91348494-91348516 GTGGCGTGGGCGGGAGCCCGCGG + Intergenic
1112144152 13:96679410-96679432 CTGGGGTGGTTAGGAGTGCCTGG - Intronic
1113355516 13:109576293-109576315 CAGGGGTGGGCATGAGCTCAGGG - Intergenic
1113516668 13:110908097-110908119 CTGGGCTGAGCTGGAGGCCCGGG - Intronic
1113693201 13:112326553-112326575 CTGGGCTGAGCAGGAGGCACTGG - Intergenic
1113751428 13:112779061-112779083 CTGGAGTGAGGAGTAGCCCCTGG + Intronic
1113759547 13:112837886-112837908 CTGGGGTGGGCAGCAGCCTCAGG + Intronic
1113843480 13:113373209-113373231 CTGTGCTGGGCTGGAGCTCCCGG + Intergenic
1114535287 14:23418616-23418638 CTGGTGTGGGGAGGAGCTCAGGG - Intronic
1114635712 14:24185676-24185698 AGAGGGTGGGCAGCAGCCCCTGG + Intronic
1115651267 14:35404266-35404288 CGGGGCGGTGCAGGAGCCCCGGG + Intronic
1117583198 14:57173678-57173700 CTGTGGTGGGCAGGACTTCCAGG - Intergenic
1119549753 14:75499998-75500020 CTGGGGTTGCCAGGAGTCCCGGG + Intergenic
1119660098 14:76444951-76444973 CTGGGCTGGGCTGGAACTCCTGG - Intronic
1119669260 14:76506303-76506325 CTGGGATGGGCAGAGGCTCCTGG + Intergenic
1121001495 14:90454668-90454690 CTGGGCTAGGCGGGAGCCCGAGG + Intergenic
1121377796 14:93430425-93430447 CCGGGGCGGGCTGGAGCGCCGGG - Intronic
1121525328 14:94615478-94615500 ATGTGCAGGGCAGGAGCCCCAGG - Intronic
1121569557 14:94937033-94937055 CTGGGGTTGGCGGGAGGGCCAGG + Intergenic
1121732645 14:96197309-96197331 CAAGCCTGGGCAGGAGCCCCAGG - Intergenic
1122149375 14:99716671-99716693 GGGTGGTGGGGAGGAGCCCCAGG - Intronic
1122152469 14:99732301-99732323 CTGGGCTGGACAGGGGGCCCTGG + Intergenic
1122362398 14:101175159-101175181 CAGGTGTGGGCAGGAGGCCAGGG + Intergenic
1122531644 14:102431983-102432005 CAGGGGTGGCCTGGAGCCCAGGG - Exonic
1122558411 14:102593354-102593376 CGGGGATGAGCGGGAGCCCCGGG + Intronic
1122601806 14:102925325-102925347 CTGGGGTGGAAATGAGGCCCAGG - Intronic
1122770529 14:104095743-104095765 CTGGGCTGAGCAGGAAGCCCGGG - Intronic
1122973154 14:105160287-105160309 TGGGGGTGGGCAGGAGCCTTGGG - Intronic
1122984806 14:105207151-105207173 CTGGGGTGGGGAGAGCCCCCTGG - Intergenic
1123538185 15:21260971-21260993 CTGGGGTGGGGAGGAACCTGTGG - Intergenic
1123703251 15:22931469-22931491 CAGAGGTGAGCAGGAGCCTCTGG - Intronic
1123923006 15:25083868-25083890 CTGGGGAGTGCAGGAGCCAAGGG - Intergenic
1124045608 15:26147255-26147277 CTGGGTGGGGCAGGAGACTCAGG - Intergenic
1124093856 15:26630172-26630194 TCTGGGTGGGCAGGAGCCCAGGG + Intronic
1124207286 15:27732402-27732424 CTGTGGTGGGCTGGACCCCACGG - Intergenic
1124350152 15:28949333-28949355 CAGGGCCGGGCAGAAGCCCCTGG + Intronic
1124379208 15:29150488-29150510 CTGAGGTGAGGAGAAGCCCCTGG + Intronic
1124563967 15:30798474-30798496 CTTGGGAGGGCAGGCTCCCCAGG - Intergenic
1124625620 15:31306144-31306166 CTGGGCGGGGCAGGTGCCCCAGG - Intergenic
1124645766 15:31436684-31436706 CTGGGCAGTGCAGTAGCCCCAGG - Intergenic
1125328981 15:38564464-38564486 CCGGGGTCGGCCGGAGTCCCGGG - Intronic
1125713421 15:41805195-41805217 CAGAGGTGGGTAGGAGCTCCAGG + Intronic
1125753344 15:42045351-42045373 ATGGGGTGGGGTGGGGCCCCTGG + Intronic
1126055871 15:44729167-44729189 CTGGGCTGGGAAGGAGGACCGGG - Exonic
1127323783 15:57873994-57874016 ATGGGGTGGGCAGGAGACAATGG + Intergenic
1127719168 15:61683014-61683036 CTATGTTGGGCAGGAGCCTCTGG + Intergenic
1127994617 15:64145971-64145993 CCAGGATGGGCAGGAGCTCCAGG - Intronic
1128080050 15:64851728-64851750 GTGGGGTGGAGAGGAGACCCAGG + Intronic
1128139201 15:65286799-65286821 CTGGGGCGGGAAGCAGCCCCCGG + Exonic
1128261868 15:66238245-66238267 CTGGGGTGGGCAGGCGTTTCTGG - Intronic
1128314990 15:66654773-66654795 TTGGGGAGGGCAGGGGTCCCTGG - Intronic
1128345201 15:66848911-66848933 CTGGGGAGGGTAGGCGGCCCAGG + Intergenic
1128512240 15:68320440-68320462 CAGGGGTAGAGAGGAGCCCCAGG + Intronic
1128577112 15:68783812-68783834 CTCAGGTGCTCAGGAGCCCCAGG - Intronic
1128674194 15:69596689-69596711 CTGGGGTGGGCCAGACCCCGAGG - Intergenic
1128813507 15:70588382-70588404 GTGGGGTGGGGAGGAGGCACAGG - Intergenic
1128981854 15:72194002-72194024 AGGGGGAGGGCAGAAGCCCCTGG - Intronic
1129034462 15:72641081-72641103 CTGTGATGAGCAGGAGGCCCAGG + Intergenic
1129111545 15:73340069-73340091 CTGGGGGAGGCAGAGGCCCCAGG - Intronic
1129215420 15:74096135-74096157 CTGTGATGAGCAGGAGGCCCAGG - Intergenic
1129326306 15:74801917-74801939 CAGAGGTGGGCAGGAGTCCTGGG + Intronic
1129681802 15:77662365-77662387 ATGGGGTTGGCTGGAGCCCTTGG + Intronic
1129755026 15:78092861-78092883 CTGGGCTAGGCAGGGGCCCTTGG + Intronic
1129858367 15:78841174-78841196 CTGGGCTGAGCAGGAGCTTCTGG + Intronic
1130543860 15:84840657-84840679 GTGGGCTGGCCAGGAGCGCCAGG - Exonic
1130560463 15:84954217-84954239 CAGGGGTGGGCAGAAGAGCCAGG - Intergenic
1130620064 15:85453284-85453306 TTGGGGGTGGCTGGAGCCCCAGG + Intronic
1130931150 15:88429074-88429096 CAGGGGTTGACAGGAGCCACTGG - Intergenic
1131111980 15:89770177-89770199 GTGGGGAGGGCAGGATGCCCTGG + Intronic
1131388674 15:92029339-92029361 CTGGAGTGGGCATGAGCGGCAGG + Intronic
1132019233 15:98346150-98346172 TTGGGGTGGGCAAGAGGCCAGGG - Intergenic
1132107493 15:99073872-99073894 GTGGGGTGGGGAAGAGACCCAGG - Intergenic
1132302486 15:100784551-100784573 CTGGGGAGGGCTGGAGCACAGGG + Intergenic
1132419011 15:101648563-101648585 CTGGGGAGGGCAGGGGCTCCCGG - Intronic
1132462217 16:61312-61334 CCGGCGGGGGCAGGAGGCCCCGG - Intronic
1132502591 16:291148-291170 CTGGGGTGGGCAGGACCGGGAGG + Intronic
1132602463 16:779785-779807 CTGGGGTGGGCAGAGGCGGCAGG + Intronic
1132604196 16:786968-786990 TTGGGGTGGGCCTGGGCCCCGGG - Intronic
1132606292 16:795091-795113 CTGGGGTGGGCAGGAGCTCAGGG + Intronic
1132648975 16:1012008-1012030 CTGGTGTGAGCAGGAGCACCCGG + Intergenic
1132664154 16:1074008-1074030 CTGGGGAGGGTATGTGCCCCTGG + Intergenic
1132677840 16:1127964-1127986 CTCGGGTGGGCAGCAGCACCAGG + Intergenic
1132684653 16:1157259-1157281 TGGGGGTTGGCAGGACCCCCTGG + Intronic
1132743516 16:1427495-1427517 CTGGGTGGGGCAGCAGCCTCTGG - Intergenic
1132841443 16:1980159-1980181 CTGGGGTGGGCAGGATCACCCGG + Exonic
1132861087 16:2072096-2072118 CTGCGCTGGGCAGGCTCCCCCGG + Intronic
1132878228 16:2149575-2149597 CTGGGATGTGGAGAAGCCCCCGG + Intronic
1132886983 16:2186665-2186687 GGGGGGCAGGCAGGAGCCCCTGG - Intronic
1132971604 16:2691913-2691935 CAGGGATGGGCTGGAGCCACAGG + Intronic
1133002630 16:2858766-2858788 CTGGGAAGGGGAGGAGCCCATGG + Intergenic
1133023664 16:2978043-2978065 CTGGGTTGGGCAGGAGCCTCTGG - Intronic
1133229800 16:4361097-4361119 CAGGGGTGATCAGGAGCCCTTGG + Intronic
1134255808 16:12610372-12610394 CTGGGGTGGGAAAGAGACACAGG + Intergenic
1135517519 16:23148574-23148596 CCTGGGCGGGCAGGTGCCCCAGG + Intronic
1135582613 16:23641230-23641252 CTGGGCCGGGGAGGCGCCCCAGG + Exonic
1136143373 16:28301287-28301309 CTGGGGAGGGCAGGAGAGGCTGG + Intronic
1136172762 16:28498370-28498392 CTGGGGTGGGGAAGAGACCGCGG + Intronic
1136334597 16:29603183-29603205 GAGGGCAGGGCAGGAGCCCCTGG - Intergenic
1136372675 16:29846036-29846058 CTGGTGTGGGCAGCAGGCCTGGG + Intronic
1136373058 16:29848083-29848105 GTGGGGAGGGGAGGTGCCCCTGG + Intergenic
1136568610 16:31084086-31084108 CAGGGTTTGGCAGGAGGCCCCGG + Exonic
1136626799 16:31466529-31466551 CTGGTGGGGGCACGGGCCCCAGG - Exonic
1137530410 16:49275681-49275703 CTGGGCTGGGGAGGAGCCTTTGG + Intergenic
1137705925 16:50535820-50535842 CTGGGGTCGGCAGGAGAGGCAGG - Intergenic
1138507266 16:57484612-57484634 GAGGGGTGGGCAGGGGACCCAGG - Intronic
1138599272 16:58045504-58045526 CTGGGGGCGGAGGGAGCCCCTGG - Exonic
1139476136 16:67203424-67203446 GGCGGGTGGGAAGGAGCCCCTGG - Intronic
1139969392 16:70764277-70764299 CTCTGGTGGCCAGGAGCTCCGGG + Intronic
1139993055 16:70955182-70955204 TTGGGCAGGGCAGGAGACCCAGG + Intronic
1141167490 16:81670083-81670105 CTAGGCAGGGCAGGAGCCCAGGG - Intronic
1141999215 16:87654606-87654628 ATGGGATGGGAAGGAGCCCTGGG + Intronic
1142035310 16:87859019-87859041 GAGGGCAGGGCAGGAGCCCCTGG - Intronic
1142139174 16:88465062-88465084 CTGGGGTGGGTGGGAGCCCTTGG + Intronic
1142214565 16:88824302-88824324 CCTGGGGCGGCAGGAGCCCCAGG + Intronic
1142291976 16:89197353-89197375 CCCGGGAGGCCAGGAGCCCCAGG + Exonic
1142518866 17:491418-491440 CCGGGACGGGCAGGAGCGCCAGG - Intergenic
1142860289 17:2756616-2756638 TTGGGATGGGGAGGAGTCCCAGG - Intergenic
1143349548 17:6277359-6277381 CTGGGATGGAGAGGAGGCCCTGG - Intergenic
1143584780 17:7845634-7845656 ATGAGGCGGGCAGGAGCTCCAGG - Exonic
1143734207 17:8899128-8899150 CTGTGGTGGGCAGGACCCAGTGG + Intronic
1144649965 17:17001298-17001320 CTTGGGAGAGCAGGAGGCCCAGG - Intergenic
1144759928 17:17701397-17701419 ATGGGGTGGGGAGGAGCACAGGG - Intronic
1144952764 17:19003196-19003218 GTGGGGAGGGGAGGAACCCCAGG - Intronic
1145193217 17:20866393-20866415 CTGGGGTGGGGAGGAACCTGTGG - Intronic
1145241301 17:21242271-21242293 CTGGGTTGGGGAGGAGCCCAGGG + Exonic
1145298798 17:21614691-21614713 CTGGGGTGGGGAGGAACCTGTGG + Intergenic
1145403643 17:22568401-22568423 CTGGGGTGGGGAGGAACCTGTGG - Intergenic
1145963533 17:28901427-28901449 CTGGAGGGGGCAGTTGCCCCTGG + Intronic
1145990886 17:29078815-29078837 CTGGGGGAGGCAGGAGAGCCAGG + Exonic
1146161212 17:30560249-30560271 CTGGGGTGAGCTGGACCCCCTGG - Intronic
1146260261 17:31416216-31416238 CTGGAGGAGTCAGGAGCCCCGGG - Intronic
1146617154 17:34366088-34366110 TTGGGCTGGGCAGCAACCCCAGG - Intergenic
1146630481 17:34465949-34465971 CTGGGGAGGGCGGGATGCCCTGG - Intergenic
1147163249 17:38579750-38579772 CTGGGGAGGCCAGGAGCTCAGGG - Intronic
1147187252 17:38719655-38719677 CCGGCGTGGGCTGGAACCCCTGG + Intronic
1147210438 17:38869982-38870004 CTGGGGCGGGCACGCGCCTCGGG - Exonic
1147252974 17:39164830-39164852 CTGGGTTTGGCAGGGCCCCCGGG + Intronic
1147585993 17:41654355-41654377 CAGGGCTGGGCAGGAGCCGAGGG - Intergenic
1147614937 17:41822154-41822176 TTGGGAGGGGCAGGGGCCCCGGG - Intronic
1147793238 17:43025802-43025824 GGGGGGGGGGCAGGAGCTCCCGG + Intronic
1148113817 17:45162866-45162888 CTTGGGTGGGCAGGAGGGCAGGG - Intronic
1148219059 17:45849545-45849567 CTGGGGTGGACAGCAGCCCAGGG + Intergenic
1148748098 17:49929631-49929653 GGGGAGTGGGCAGGAGTCCCCGG - Intergenic
1148800333 17:50221089-50221111 CTGCGCTGGGCAGGATGCCCGGG - Intergenic
1148806538 17:50266769-50266791 CTGGGGGAGGCAGGAGAGCCAGG + Intergenic
1148815992 17:50328624-50328646 CTGGTGTGAGCAGCATCCCCTGG - Intergenic
1149640634 17:58200244-58200266 CAGGGGTGGCCATGAGGCCCCGG - Exonic
1149650400 17:58272877-58272899 CAGGGGTGGCCATGAGGCCCCGG + Exonic
1149992446 17:61390553-61390575 CTGGGGAGGGGAGGGGCCCTTGG - Intronic
1150289150 17:63971704-63971726 ATGGCGTGAGCAGGGGCCCCAGG - Exonic
1150414309 17:64975157-64975179 CTGTGGTGGGCTGGAGGCCTGGG + Intergenic
1150814621 17:68383359-68383381 CTGGGGTGGGCAATGGCACCAGG - Intronic
1151481465 17:74372243-74372265 CCGGAGTGGGCTGCAGCCCCGGG + Exonic
1151484179 17:74388168-74388190 CTGGGCTGGGCAGGAGCAGAAGG + Intergenic
1151540873 17:74764021-74764043 ATGGGGAGGGCAGGGGCCCAGGG - Intronic
1151559963 17:74864740-74864762 TTGGGGTGGGGCAGAGCCCCTGG - Intronic
1151678484 17:75611930-75611952 CTGGGCCGGGCAGGAACCTCAGG - Intergenic
1152094699 17:78266356-78266378 CTAGCTTGGGGAGGAGCCCCTGG + Intergenic
1152094939 17:78267389-78267411 CTGGCTTGGAGAGGAGCCCCTGG + Intergenic
1152205989 17:78974617-78974639 CTGGGAGGGGCAGGGGCCACGGG + Intronic
1152516245 17:80826511-80826533 CTGGGCTGGGCCGGAGGCCCTGG - Intronic
1152537646 17:80959896-80959918 CTGGGGAGCCCAGGAGTCCCAGG - Intronic
1152575174 17:81136695-81136717 CAGAGGTGGGCAGGGGCACCAGG + Intronic
1152660916 17:81541504-81541526 CTGGGGTGGGGAGGGGTGCCAGG - Intronic
1152684738 17:81688422-81688444 CTGGGGTGGGCAGGTCCCGTGGG + Intronic
1152728542 17:81959256-81959278 CTGGGGAGGGCCAGAGCCGCTGG + Intronic
1152790324 17:82275154-82275176 GTGGGGATGGCAGGAGCCCTGGG + Intergenic
1152912693 17:83014030-83014052 CTGGGCTGAGGAGGGGCCCCAGG + Intronic
1152939555 17:83161037-83161059 CTGGCGTGGGCTGGGGCCCAGGG + Intergenic
1152945632 17:83196055-83196077 CTGGGGTGGGCAGAGGCCCGAGG - Intergenic
1153052010 18:908480-908502 CTGGGGTGGGCATCCGCCACGGG + Intronic
1154045951 18:10904967-10904989 CAGGGGTGGGCAGGAAGCACAGG + Intronic
1154294075 18:13134756-13134778 CTCGGCTGCGCAGGAGCCCACGG + Intergenic
1155341488 18:24818580-24818602 CTAGGGAGGGCAGAAGCCACGGG + Intergenic
1156449829 18:37260816-37260838 CTGGGGTGGGCAGAGGGCACAGG - Intronic
1156456327 18:37296721-37296743 CTGGTGTGGGCTGGAGCAACAGG - Intronic
1157706663 18:49813415-49813437 CTGGGGAGGGCAGGACCCCGAGG + Intronic
1157794511 18:50560992-50561014 CCGGGGTGGGCGGATGCCCCGGG + Intronic
1157819255 18:50753509-50753531 CTGGGCTGGGCTGCAACCCCAGG + Intergenic
1157858767 18:51123176-51123198 CTGTTGGGGGCAGGAGGCCCTGG - Intergenic
1158213904 18:55079590-55079612 CTGGACTGTGCAGGAGCTCCGGG - Intergenic
1158282281 18:55840799-55840821 CTGGGGTGGGAGGGAGGCTCAGG + Intergenic
1158601787 18:58862889-58862911 CTGGGGTGGGGAGAAAGCCCTGG - Exonic
1159408737 18:68041398-68041420 CTGCGGTAAGCATGAGCCCCTGG + Intergenic
1160293515 18:77617017-77617039 CTGGGGTGTGCAGGAGGCCATGG + Intergenic
1160434817 18:78841609-78841631 CTGGGGTGGGTTGGAGCTGCTGG + Intergenic
1160465106 18:79069571-79069593 CTGCGGTGGGCTGGGGGCCCCGG - Intronic
1160533068 18:79576791-79576813 CTTGGGTGGGCAGGATGCCCAGG - Intergenic
1160586272 18:79915243-79915265 CTGGGGAGGGCTGAAGCTCCCGG + Intronic
1160708284 19:539953-539975 CTGGGATGGCCAGGCCCCCCAGG + Intronic
1160708330 19:540066-540088 CCGGGGTGGCCAGGCCCCCCAGG + Intronic
1160708362 19:540142-540164 CCGGGGTGGCCAGGCCCCCCGGG + Intronic
1160708379 19:540180-540202 CCGGGGTGGCCAGGCCCCCCGGG + Intronic
1160708396 19:540218-540240 CCGGGGTGGCCAGGCCCCCCGGG + Intronic
1160708429 19:540293-540315 CCGGGGTGGCCAGGCCCCCCGGG + Intronic
1160708446 19:540331-540353 CCGGGGTGGCCAGGCCCCCCGGG + Intronic
1160708463 19:540369-540391 CCGGGGTGGCCAGGCCCCCCGGG + Intronic
1160708480 19:540407-540429 CCGGGGTGGCCAGGCCCCCCGGG + Intronic
1160708497 19:540445-540467 CCGGGGTGGCCAGGCCCCCCGGG + Intronic
1160708514 19:540483-540505 CCGGGGTGGCCAGGCCCCCCGGG + Intronic
1160708531 19:540521-540543 CCGGGGTGGCCAGGCCCCCCGGG + Intronic
1160708548 19:540559-540581 CCGGGGTGGCCAGGCCCCCCGGG + Intronic
1160708565 19:540597-540619 CCGGGGTGGCCAGGCCCCCCGGG + Intronic
1160708582 19:540635-540657 CCGGGGTGGCCAGGCCCCCCGGG + Intronic
1160749453 19:727145-727167 CAGGGTTGGGCAGGAGTCCGGGG - Intronic
1160865133 19:1252956-1252978 CTGCGGTTGGCAGGGGGCCCAGG + Intronic
1160910121 19:1470310-1470332 CTCGGGTGGGCAGAGGCCCTGGG - Exonic
1160935341 19:1592133-1592155 CTGGGGTGGCGCGGAGCCCGAGG - Intronic
1160965561 19:1745671-1745693 TTGGGCTGGGCAGGAGCCGTTGG - Intergenic
1161035043 19:2079811-2079833 TTGGGGTGGACAGCTGCCCCTGG - Intronic
1161200349 19:3011104-3011126 CTGGGGCGGGGAGGAGTCACAGG + Exonic
1161388729 19:4010323-4010345 CTGGGTGGGGCAGGGGCTCCCGG + Intronic
1161396610 19:4047933-4047955 CTGGGCTGGGCGGGGGCGCCGGG + Exonic
1161398923 19:4059140-4059162 CTGGGGTGGGTAGGAGGGCCCGG - Intronic
1161513890 19:4685828-4685850 TTGGGGTGGGCAGGAGAACAAGG - Intronic
1161584236 19:5096495-5096517 CTGAGGTCAGCAGGAACCCCAGG - Intronic
1161989652 19:7677406-7677428 CTTGGAGGGGAAGGAGCCCCCGG - Intronic
1161990385 19:7681196-7681218 CGGGGGCGGCCCGGAGCCCCTGG + Intronic
1161993200 19:7697076-7697098 CTGGTGTGTGCAGGAGCGCAGGG + Intronic
1162040982 19:7971002-7971024 CTGGGGTGGGAAGCAGAGCCGGG + Intronic
1162164379 19:8742632-8742654 CAGAGGTGGGCAGGGGCTCCAGG + Intergenic
1162165451 19:8750100-8750122 CAGAGGTGGGCAGGGGCTCCAGG + Intergenic
1162166516 19:8757556-8757578 CAGAGGTGGGCAGGGGCTCCAGG + Intergenic
1162167582 19:8765012-8765034 CAGAGGTGGGCAGGGGCTCCAGG + Intergenic
1162168521 19:8771310-8771332 CAGAGGTGGGCAGGGGCTCCAGG + Intergenic
1162169591 19:8778760-8778782 CAGAGGTGGGCAGGGGCTCCAGG + Intergenic
1162170270 19:8784074-8784096 CAGAGGTGGGCAGGGGCTCCAGG + Intergenic
1162300446 19:9842017-9842039 CTGGGTTGGACAGGTGCACCTGG + Intronic
1162362302 19:10227454-10227476 CTGGGAGGGGCAGCAGTCCCCGG - Intronic
1162562573 19:11426098-11426120 CTGGGCTGGGCTGGAGTCACAGG + Intronic
1163125002 19:15239848-15239870 GTGAGGTGGGCAGGCACCCCCGG + Intronic
1163226105 19:15962681-15962703 CAGGGGTGGCCAGGAGTCCTCGG + Intergenic
1163268356 19:16234558-16234580 CTGGGGAAGGCAGGGGTCCCTGG - Exonic
1163366563 19:16878940-16878962 CTGTGGTGGGGCTGAGCCCCAGG - Exonic
1163528931 19:17838249-17838271 CTGGAGTGGGTAAGAGGCCCTGG - Exonic
1163712265 19:18853862-18853884 CTTGGGTGGGGAGGAGTCCTGGG + Intronic
1164776779 19:30858919-30858941 CTGGGGGCAGCAGGAGCCCCAGG + Intergenic
1164787586 19:30945844-30945866 CTCGAGTTGGCAGCAGCCCCTGG - Intergenic
1165119125 19:33547806-33547828 CTGAGGTGGGCATGTGCCTCTGG - Intergenic
1165487386 19:36103888-36103910 CTGGGGTGGGCAGGAAGGCCAGG - Exonic
1165490613 19:36120976-36120998 CTGGGGTGGGAATGAGGGCCGGG + Intronic
1165715901 19:38045736-38045758 CTGGGGTGGGCTGGAGGCTGGGG + Intronic
1165820962 19:38675808-38675830 CTGGGTATGGCAGGAGCCCCAGG - Intronic
1165923587 19:39313887-39313909 CTGGGCTTGGGAGGAGGCCCTGG + Intronic
1166010146 19:39935512-39935534 CTGGGATGGGCAGGAGTCTGAGG + Intergenic
1166039432 19:40192625-40192647 CTGGGCTGTGCAGGTGGCCCGGG + Exonic
1166071380 19:40390095-40390117 CTGGGGAGGGGTGCAGCCCCTGG - Exonic
1166121449 19:40689846-40689868 CTGGGGTGGGGTGGAGTCCCAGG + Intronic
1166199285 19:41226169-41226191 CTGGGGTGGGGAGGTGCCCCCGG + Intronic
1166332788 19:42088410-42088432 CTGGGGTGGGGAGAGGTCCCAGG + Intronic
1166366528 19:42280994-42281016 CTGGGGTAGGCAGGGGGACCAGG - Intronic
1166561102 19:43732948-43732970 CTGGGGTGGCCACGATACCCAGG + Exonic
1166764209 19:45243324-45243346 CGGGGGTGGACAGGAGGCCTGGG + Intronic
1166809391 19:45506788-45506810 CCGGGGTGGGCAGGAGGCGCCGG - Intronic
1166816763 19:45550943-45550965 GCGGGGTTGGCAGGAGTCCCAGG + Intronic
1166874939 19:45891253-45891275 CTGGGGAGTGCAGGAGGGCCGGG + Exonic
1167158732 19:47754664-47754686 CAGGGGTGGGTAGGAGGCCCGGG - Intronic
1167259512 19:48450535-48450557 CTGGGGTGTTCAGGAGTCCCGGG + Intronic
1167376365 19:49114453-49114475 CCCGGGTGGGCAGGGCCCCCTGG - Intronic
1167376803 19:49116651-49116673 CTGGGGAGGGCAGTAGGCCCCGG + Intronic
1167756342 19:51415799-51415821 CTGAGGGGGCCTGGAGCCCCAGG - Intronic
1168148367 19:54431720-54431742 CAGGGGTGGGCAGGGTGCCCAGG + Intronic
1168296393 19:55379103-55379125 CTGGGGAGACCAGGAGCCCTGGG - Intergenic
1168643392 19:58044675-58044697 CTGAGATGAGCAGGATCCCCCGG - Intronic
924987889 2:288107-288129 CTGGTGCGGAAAGGAGCCCCCGG + Exonic
925021625 2:574108-574130 CATGGGTGGGCTGGAACCCCGGG - Intergenic
925035270 2:680218-680240 CTGACATGGGCAGGACCCCCTGG + Intergenic
925359597 2:3268182-3268204 CTGGTGTGGGCAGGAAGCCTTGG - Intronic
925370118 2:3338536-3338558 CTGGGGAGGGCAGGCGCAGCAGG + Intronic
925411655 2:3643169-3643191 CAGGGGTGGGAAGCAGCCCAGGG - Intronic
925662011 2:6212737-6212759 CTTGTGAGGGCAGGAGCCCGTGG + Intergenic
925730828 2:6918267-6918289 CTGGGGTGGGTAAGACCCGCAGG - Intronic
926062215 2:9811817-9811839 CTGGCCTGGCCGGGAGCCCCCGG - Intergenic
926165904 2:10522087-10522109 CTGGAATGGGGAGGGGCCCCAGG - Intergenic
926217446 2:10914110-10914132 GAGGGGTGTGCAGGAGCCGCAGG + Exonic
926289460 2:11517076-11517098 CTGGTGTGAGCAGTGGCCCCAGG + Intergenic
926806915 2:16719576-16719598 CTGAGCTGGGCAAGGGCCCCTGG + Intergenic
927073926 2:19557620-19557642 TTGGTGTGTGCAGGATCCCCTGG - Intergenic
927214897 2:20662738-20662760 CTGGGTATGGCAGGAGACCCTGG + Intergenic
927521923 2:23704066-23704088 CTGGGGCCAGCTGGAGCCCCGGG - Intronic
927522218 2:23705982-23706004 CCTGGGTGGGCAGCAGCACCAGG + Intronic
927576924 2:24208048-24208070 TCTGTGTGGGCAGGAGCCCCAGG + Intronic
927578315 2:24219155-24219177 CTGGGGTGGTCACTAACCCCAGG + Intronic
927857830 2:26538246-26538268 CTGGTTTGGGCAGGAACCCCTGG - Intronic
927862018 2:26565966-26565988 CTGCAGTGGGCAGGAGCTCTTGG + Intronic
927875263 2:26651008-26651030 CTGGAGAGGGCAGGGTCCCCGGG + Intergenic
927898524 2:26801924-26801946 CTCGGCTGGGCTGGAGCCCTTGG + Intergenic
928085682 2:28345017-28345039 CTGGTGTGGGCTGGAGTCCCAGG - Intergenic
928174552 2:29024800-29024822 CTGGGGGTGACAGGAGCTCCAGG - Intronic
928435562 2:31252398-31252420 CTGAGGAAGGCAGGAGTCCCTGG - Intronic
928456862 2:31430268-31430290 CAGAGGTGGGCAGGAGTGCCTGG - Intergenic
929080715 2:38119500-38119522 CTTGGGTGGTCAGGAGACCCAGG - Intergenic
929446855 2:42008881-42008903 CTGGCGAGGGCAGAAGCCTCAGG - Intergenic
929583797 2:43101197-43101219 CCGGGGTGGGCAGGGGGCCCAGG + Intergenic
930192929 2:48479005-48479027 AGGGGGTAGGCAGCAGCCCCCGG + Intronic
930455709 2:51605523-51605545 CTGGGGAGGGAAGGAGCCACTGG - Intergenic
930455716 2:51605542-51605564 CTGGGGAGGGAAGGAGCCACTGG - Intergenic
931117911 2:59184413-59184435 CTGGGGTGGGAGGAAGCCGCAGG + Intergenic
931563485 2:63589058-63589080 CAGAGGTGGGCAGGAACCCGGGG - Intronic
932002523 2:67897776-67897798 CTGGGGTGGGGAGAGGGCCCTGG - Intergenic
933085926 2:78053730-78053752 CTGGGCTGGGGAGGATCCCCAGG + Intergenic
933997292 2:87679295-87679317 CTTGAGCGGGCAGGAGGCCCAGG - Intergenic
934561963 2:95318064-95318086 CAGGGGTGGGCAGTGGCCCTGGG + Intronic
934566967 2:95346564-95346586 CTGGGGCGGCCGGGAGCGCCCGG + Intronic
934691044 2:96359481-96359503 CACGGGTGGGCATGACCCCCGGG + Intronic
934734301 2:96681253-96681275 CTGGGGTGGGCTTGAGCCCAGGG + Intergenic
935546662 2:104406635-104406657 TTTGGGTGGGCAGGATGCCCAGG - Intergenic
935601636 2:104928073-104928095 CTGGGGTCAGCAGGGGCCTCTGG + Intergenic
935742401 2:106161164-106161186 CAGGGCTGGGCAGGAGCACAAGG + Intronic
936267628 2:111022672-111022694 GAGGTGTGGGCAGGACCCCCAGG + Intronic
936296560 2:111271615-111271637 CTTGAGCGGGCAGGAGGCCCAGG + Intergenic
937216098 2:120314594-120314616 CTGGGGAGGGAAGGAGGGCCGGG - Intergenic
938266919 2:129934391-129934413 ATGGGGTGCGCAGGAGCCTCTGG - Intergenic
938319829 2:130355635-130355657 CTGGGGCGGGCAGCAGCCTTGGG - Intergenic
938469494 2:131545364-131545386 CTGGGGTGGGGAGGAACCTGCGG + Intergenic
938501045 2:131831491-131831513 CTGGGATGGGCACAAGGCCCGGG - Intergenic
941634628 2:167923362-167923384 CTGGGCTGGTCAGGAACTCCTGG - Intergenic
942200807 2:173569344-173569366 CTGGGCTGAGCAGGAGGCACTGG - Intergenic
942320293 2:174730372-174730394 CTGTGGAGGGCGGGAGCCCCGGG + Intergenic
942991512 2:182208268-182208290 CTGGTGGGGGCAGGGGCCTCAGG + Intronic
943191782 2:184686232-184686254 GTTGGTGGGGCAGGAGCCCCAGG - Intronic
946363906 2:219236718-219236740 ATGGAGTGGGCAGGATCCCTTGG - Exonic
947591774 2:231389980-231390002 CTGGGGTGGGGAGGAGCCGCAGG - Intergenic
947911519 2:233803847-233803869 CTGGGGTGGGGAGGGAGCCCAGG + Intronic
948208219 2:236173854-236173876 TTGGGGTGTCCAGGAGTCCCGGG - Intergenic
948679869 2:239626569-239626591 CTGGGGTGGGGAGACTCCCCTGG + Intergenic
948680026 2:239627293-239627315 CTGGCATGGGTAGGAGCCTCAGG + Intergenic
948706080 2:239793288-239793310 CTGGGGAGGGCTCCAGCCCCAGG - Intronic
948785312 2:240349474-240349496 CAGGTGTGGGCAGGAGGCCCGGG - Intergenic
948804252 2:240446695-240446717 TTGGGTTGGGGAGGAGCCCCAGG - Intronic
948844280 2:240675814-240675836 CTCTGGTGGGCAGCAGCCCTGGG - Intergenic
948849578 2:240699065-240699087 CTCTGGTGGGCAGCAGCCCTGGG + Intergenic
948923713 2:241080913-241080935 CTGGTGAGGGCAGGAGCGACAGG + Intronic
949036689 2:241818728-241818750 CTGAGGTGGGGAGGGGCCCGGGG - Intergenic
1168874702 20:1163427-1163449 CTAGGGTGGGCAGGGGGACCGGG - Intronic
1168878099 20:1185092-1185114 CTGGGGGCGGCAGGAGGCCGAGG - Intronic
1169224377 20:3847010-3847032 CTGGGGTGCGCGGGGGGCCCAGG + Intronic
1169268595 20:4182361-4182383 CCAGGGTGGAGAGGAGCCCCGGG + Exonic
1171512468 20:25696602-25696624 CTGGGGAGGGGCGGAGACCCAGG - Intronic
1171561782 20:26133884-26133906 CTGGGGTGGGGAGGAACCTGTGG - Intergenic
1172112162 20:32553332-32553354 GTGGAGTGGGCTGGAGCCCTGGG - Intronic
1172125117 20:32621114-32621136 CTGGGGTGGGGAGGAGGCTGGGG + Intergenic
1172702266 20:36861005-36861027 CTGGGATGGACAGGGGCCCATGG + Intronic
1172845427 20:37927509-37927531 CTGGGGTGGGCAGGAGCACAGGG - Intronic
1172845999 20:37930366-37930388 CTGGGGTGGTGAGGACTCCCGGG + Intronic
1172969453 20:38862796-38862818 CTGGAGTGGGCAGGAGAGCAGGG - Intronic
1173363888 20:42368084-42368106 CTGGGCTGTGCAGCATCCCCTGG - Intronic
1173502565 20:43565003-43565025 GAGGGGTGGGCAATAGCCCCAGG - Intronic
1173525312 20:43727801-43727823 GGGGGGTGGGAAGGAGCTCCAGG - Intergenic
1173809546 20:45947762-45947784 CTGCGGGGAGGAGGAGCCCCAGG + Exonic
1173857078 20:46257350-46257372 CTGGGGTTGGGAGGAGCCTATGG + Intronic
1174276628 20:49408969-49408991 CTGGGGTGGCCACTAGCTCCTGG + Intronic
1174282162 20:49447182-49447204 CAGGGGTGGGACGGAGCCCTGGG + Intronic
1174578619 20:51555254-51555276 CTGGGGTAATCAGGAGCCCCTGG - Intronic
1175322793 20:58101180-58101202 CTGGGCTGGGCTGGGGCCCGAGG + Intergenic
1175634439 20:60568882-60568904 ATGGGGTGGCCAAGTGCCCCAGG - Intergenic
1175635608 20:60580297-60580319 CTGGGGTGGACAGGAGCTCCTGG + Intergenic
1175702115 20:61147117-61147139 CTGGGATGGCCAAGAACCCCTGG + Intergenic
1175746265 20:61459458-61459480 CTGGGGGGCGCAGGCACCCCTGG - Intronic
1175815264 20:61880266-61880288 CTGGGGAGGGCAGTAGCCTGGGG + Intronic
1175838249 20:62010262-62010284 CTGCGGTGGCCAGGACGCCCAGG + Intronic
1175878732 20:62244128-62244150 CTTGGCTGGGCAGGTGCCCTGGG + Intronic
1175900097 20:62356649-62356671 AGGGGGTGGGCAAGAGCCCCAGG + Intronic
1175940764 20:62536551-62536573 CTGGGGAGGCGGGGAGCCCCTGG + Intergenic
1176018891 20:62952769-62952791 CTGGGCTGGGAGGCAGCCCCGGG + Exonic
1176111432 20:63412567-63412589 CAGGACTGGGCAGGAGCCCCAGG + Intronic
1176128227 20:63485416-63485438 CTGGGGTGGGGAGGAGCACAGGG - Intergenic
1176385167 21:6135440-6135462 CAGAGGTGGGTGGGAGCCCCCGG + Intergenic
1176388720 21:6152503-6152525 CTGGTGTGTGCAGGGGTCCCTGG - Intergenic
1176649527 21:9531750-9531772 CTGGGGTGGGGAGGAACCTGTGG + Intergenic
1178341915 21:31792935-31792957 CTTGGAGGGGCAGGAGGCCCAGG + Intergenic
1178390296 21:32192468-32192490 CTGGGGAGCCCAGGACCCCCAGG + Intergenic
1178437844 21:32575413-32575435 TGGGGGTGGGCAGGAAGCCCGGG + Intergenic
1178909118 21:36660029-36660051 CTGGGCTGAGCTGGAGCCCAGGG - Intergenic
1178978497 21:37241240-37241262 CTGGTGTGAGCAGGAACCACAGG - Intronic
1179442357 21:41404094-41404116 CGGGGCTGGGCAGGAGCTCAGGG - Intronic
1179541274 21:42084523-42084545 CTGGAGAGGCCAGGAGCTCCAGG + Intronic
1179643356 21:42761123-42761145 CAGGAGTGGGAAAGAGCCCCTGG - Intronic
1179732307 21:43374674-43374696 CTTGGGTGGGCGGGGGCCGCAGG - Intergenic
1179734752 21:43385745-43385767 CTGGTGTGTGCAGGGGTCCCTGG + Intergenic
1179738306 21:43402812-43402834 CAGAGGTGGGTGGGAGCCCCCGG - Intergenic
1179906424 21:44425495-44425517 CTGAAGTGGGCAGGGCCCCCAGG - Intronic
1179910313 21:44443999-44444021 CTGGAGTAGGCAGCAGCCCCGGG - Intergenic
1179924279 21:44525456-44525478 GTGCTGTGGGCAGGTGCCCCAGG + Intronic
1179960187 21:44763728-44763750 CTTGGGTGTGTAGGTGCCCCAGG - Intergenic
1179985470 21:44918418-44918440 CTGGGCCTGGCAGGAGCCCTGGG + Intronic
1180071391 21:45438408-45438430 CAGGGCTGGGCAGGGGACCCCGG + Intronic
1180082803 21:45494341-45494363 CTGGGGAGGACAGGAGCCACTGG - Intronic
1180157459 21:45984479-45984501 CTGGCGTGGGCAGGAGGCTGGGG - Intronic
1180560163 22:16609516-16609538 CAGGGATGAGCAGGCGCCCCAGG + Intergenic
1180801442 22:18633931-18633953 CCGGGATGGCCGGGAGCCCCAGG - Intergenic
1180852676 22:19029471-19029493 CCGGGATGGCCGGGAGCCCCAGG - Intergenic
1180871658 22:19150155-19150177 CTGCGGTGGGCAGGCGGCCCGGG + Exonic
1180881148 22:19204306-19204328 TTGTGGGGTGCAGGAGCCCCTGG - Intronic
1180901358 22:19375655-19375677 CTGGTCAGGGCAGGAGCACCTGG + Exonic
1180945755 22:19692246-19692268 CTTAGGTGGGTGGGAGCCCCAGG - Intergenic
1181162252 22:20965770-20965792 CTGGGGGCGCCAGGAGCCCTGGG + Intronic
1181220279 22:21361330-21361352 CCGGGATGGCCGGGAGCCCCAGG + Intergenic
1181236609 22:21450962-21450984 CTGGGGCAGGGAGGATCCCCAGG + Exonic
1181951290 22:26555681-26555703 CTGGGGTGTGCAGGAGGCGGTGG + Intronic
1182117328 22:27764353-27764375 CTGGGCTGGCCAGGTGCCCAAGG + Intronic
1182254827 22:29030806-29030828 CTGGCGCGGGGAGGAGCCGCGGG + Intronic
1182288351 22:29260745-29260767 CCGGGGTGGCAAGGAGCCTCAGG + Exonic
1182358834 22:29734977-29734999 CTGGGGTGCCCAGGAGAGCCAGG + Intronic
1182423712 22:30260925-30260947 CTGTGGTAGGAAGGAGCCCCAGG + Intergenic
1182500255 22:30741452-30741474 CAGTGGTGGCCAGGAGACCCAGG + Intronic
1182919204 22:34064122-34064144 CAGGGGTAGGCACGAGACCCAGG - Intergenic
1183225753 22:36548874-36548896 CTGGGCTGGGAAGGAGGCCATGG + Intergenic
1183258960 22:36781892-36781914 CTGGGGTGGCCATGAGTCCCTGG + Intergenic
1183322569 22:37174051-37174073 AGGGGCTGGGCTGGAGCCCCAGG - Intronic
1183352555 22:37342372-37342394 AGGGGGTGGGCAGGAGACACTGG - Intergenic
1183391233 22:37546560-37546582 CCGGGGAGGTCAAGAGCCCCCGG - Intergenic
1183420935 22:37710817-37710839 ATGGGGTGGGCAGGGCCCCTGGG - Intronic
1183591025 22:38779377-38779399 CTGGGGTGGGGAGCAGCCCTAGG - Exonic
1183948281 22:41338972-41338994 ATGGGGTGGGCAAGAGCCGAAGG - Intronic
1184066524 22:42124727-42124749 CTTGGGTGGGCAGGAACTCTGGG + Intergenic
1184068992 22:42136879-42136901 CTTGGGTGGGCAGGAACTCTGGG + Intergenic
1184264719 22:43341013-43341035 CAGGGGTGGGCAGGAGACTTAGG - Intronic
1184378815 22:44132215-44132237 CAGTGGTAGGCAGGAGACCCTGG + Intronic
1184502484 22:44882534-44882556 CTGGGGTGGGCGGGCGGGCCTGG - Exonic
1184518912 22:44980768-44980790 CTGGGGCGGGCAGAGGACCCTGG - Intronic
1184692508 22:46123675-46123697 GGAGGGTGGGCAGGAGGCCCTGG + Intergenic
1185146783 22:49141503-49141525 CAGGGGTGGGCAGGGGGCACGGG - Intergenic
1185209758 22:49564193-49564215 CGGGGGTGGGCAGGAGTGTCCGG - Intronic
1185275069 22:49947241-49947263 CTGGGGAGGCAAGGGGCCCCAGG - Intergenic
1185277773 22:49957158-49957180 TGGGGGTGGACAGGATCCCCAGG + Intergenic
1185320681 22:50198973-50198995 GTGGGGTCGGCTGGAGCTCCAGG - Exonic
1185333538 22:50261841-50261863 CTGGGGAGGGCCGGAGCCTGGGG + Intergenic
1185377235 22:50488163-50488185 CTGGGTTGGGGAGCAGGCCCTGG + Intronic
1185385994 22:50531539-50531561 TTGGGGTGGCCAGGGGCCCGGGG + Intronic
949919633 3:8990717-8990739 CTGGGGCAGGCAGCAGCCCGGGG + Exonic
949930041 3:9071361-9071383 CTGGGGTGGGCATGAGACCCTGG + Intronic
950040833 3:9918122-9918144 CTGGGGTGGGCATGAGGGCCAGG + Intronic
950106999 3:10394670-10394692 GTGGGGTGGGCAGCAGGTCCTGG + Intronic
950176961 3:10881737-10881759 CTGGGGTGGGAAGGTGCCAACGG - Intronic
950270406 3:11610215-11610237 CTGTGCAGGGCAGAAGCCCCCGG + Intronic
950416116 3:12869787-12869809 CTGAGGTGGGAAGGGGCCACAGG - Intronic
950442401 3:13017877-13017899 TTGGGATGGGCAGGAGGTCCTGG - Intronic
950485829 3:13273595-13273617 CTGGGATGGGCAGGAGCACGTGG - Intergenic
950524200 3:13514034-13514056 CATGGGTGGGCAGAAGCGCCGGG - Intergenic
950541634 3:13616649-13616671 GTGGGGTGGGAAGGAGGCCCTGG + Intronic
950584340 3:13881666-13881688 CAGAGGTGGGCATGAGCCCCAGG + Intergenic
950644344 3:14368203-14368225 CTGGCATGGCCAGGAGGCCCAGG - Intergenic
951415483 3:22417239-22417261 TTGGGCTGAGCAGGAGCCCATGG - Intergenic
952058051 3:29473575-29473597 CTCGGGTGCACAGGAGCCCACGG + Intronic
952901544 3:38114826-38114848 CTGGGGAAGGCACCAGCCCCAGG + Intronic
953211444 3:40878564-40878586 CTGTGGTGGTCCAGAGCCCCAGG + Intergenic
953423058 3:42769956-42769978 CTGGGGCGCGCAGGAGCCCACGG - Intronic
954093141 3:48301278-48301300 CTGGGGTGGGCTTAGGCCCCGGG - Exonic
954214329 3:49116056-49116078 CTGGGGGGGCCTGGAGGCCCCGG - Exonic
954325527 3:49861368-49861390 CTGGGGTGGGCAGCACCTCAGGG - Intronic
954330072 3:49885087-49885109 CTGAGGTGGGGATGGGCCCCAGG + Intergenic
954400688 3:50318014-50318036 CTGGAGTGGGCAGAGCCCCCAGG - Exonic
954417426 3:50400206-50400228 CAGGGGGGAGCTGGAGCCCCAGG + Intronic
954437542 3:50503890-50503912 GTGGGGTGGGGAGGAGCGGCAGG - Intronic
954578247 3:51688660-51688682 CTGGGGAGTGCAGGTGGCCCTGG + Intronic
954689405 3:52387750-52387772 CTGGGTGGGACAAGAGCCCCAGG + Intronic
954701680 3:52453946-52453968 CTGGGGTGGGCAGGCCCACTGGG - Intronic
954955796 3:54517472-54517494 CTGGGGTGGACAAGAGGCCCTGG - Intronic
954973814 3:54674473-54674495 CGGCAGTGGGGAGGAGCCCCTGG + Intronic
955230676 3:57096551-57096573 CTGGGCTGGGCAGGTGCTCATGG + Intronic
955465764 3:59235845-59235867 ATGGGTTTGGCAGGTGCCCCAGG - Intergenic
955948078 3:64214280-64214302 CTGGGGTCGTCCGGAGCCTCTGG - Intronic
955971445 3:64442368-64442390 CTGGGGCAAGCATGAGCCCCTGG - Intronic
956204428 3:66740907-66740929 GTGGGGAGGACAGGAGCTCCTGG + Intergenic
956632638 3:71331386-71331408 TTGGGCTGCGCAGGAGCCCATGG - Intronic
956877799 3:73480583-73480605 ATGGGGTAGGCAGGAGGGCCAGG - Intronic
960101619 3:113747842-113747864 TTGTGGTGTGCAGGAGGCCCAGG + Intronic
960639424 3:119811990-119812012 CAGGGAGGGGCAGGACCCCCCGG + Intronic
961484033 3:127205057-127205079 AGGGTGTGGCCAGGAGCCCCAGG - Intergenic
961519553 3:127459007-127459029 CAGGGGGGAGCAGGAGCCTCAGG + Intergenic
961740979 3:129033019-129033041 CTGGGGAAGCCAGGAGCACCTGG + Intronic
961825935 3:129599104-129599126 AGCGGGAGGGCAGGAGCCCCGGG - Intronic
962012017 3:131401087-131401109 CTGCTGTGGGCAGAAGCCTCAGG + Intergenic
962375751 3:134857478-134857500 CTGGAGTGGGCACGGACCCCAGG - Intronic
963771267 3:149388727-149388749 CTGGGGTGGCCAGGAGGCAGAGG + Intergenic
963879525 3:150513395-150513417 CTGAGATTGGCAGGAGCCCCTGG + Intergenic
964198183 3:154088260-154088282 TTGGGCTGCGCAGGAGCCCACGG - Intergenic
964659483 3:159104601-159104623 CTAAGGTGGGCAGGAGCTCCAGG - Intronic
967005529 3:185379071-185379093 AGGGGGCGGGCAGCAGCCCCAGG + Intronic
968075303 3:195812866-195812888 CTGGGGTGAGCAGAGCCCCCAGG - Intergenic
968090518 3:195895822-195895844 GCGGGGTGGGCTGCAGCCCCGGG - Intronic
968434379 4:576904-576926 GGGGGGTGGGAAGGAGCCCGGGG + Intergenic
968434407 4:576954-576976 GGGGGGTGGGAAGGAGCCCGGGG + Intergenic
968459769 4:718738-718760 CAGGTGTGGGCAGGAGCCCATGG + Intronic
968490144 4:885681-885703 CCTGGGTGGCCATGAGCCCCTGG - Intronic
968504908 4:967215-967237 CGGAGGAGGGCAGAAGCCCCGGG - Exonic
968605359 4:1532690-1532712 TCGGGGTGGGCAGGAGGCTCCGG - Intergenic
968619077 4:1595525-1595547 CTGGGGTTGGTGGGAGCCCTGGG + Intergenic
968652393 4:1765433-1765455 GTGGGCTGGGCAGGAGGCCAGGG - Intergenic
968670636 4:1849182-1849204 CTGAGATGAGCAGGATCCCCTGG + Exonic
968756090 4:2417368-2417390 CTGCAGCGGGCACGAGCCCCAGG + Intronic
968775351 4:2536744-2536766 CTGGGGCGGGCGGGAGCTGCGGG - Intronic
968845380 4:3038284-3038306 CGGGGCTGGGCAGGAGCTGCTGG + Intronic
968901316 4:3433299-3433321 ATGGGGAGGGCGGGAGCCCGTGG - Intronic
968904002 4:3443442-3443464 CTGGGGCGGGCAGGGGGCACTGG + Intronic
968949725 4:3684237-3684259 CTGGGAAGGGAAGGAGCTCCAGG - Intergenic
969143234 4:5098352-5098374 CTGGGGTGGTGATTAGCCCCAGG - Intronic
969243330 4:5916373-5916395 CTGTGGTGGGCAGGGACCCAAGG - Intronic
969303116 4:6309106-6309128 CTGGGCCGCGCAGGAGCCCACGG + Intergenic
969355049 4:6620331-6620353 CCAAGGTGGGCAGAAGCCCCTGG - Intronic
969509621 4:7610394-7610416 CAGGGGTGGGCTGGGGGCCCTGG - Intronic
969704074 4:8782612-8782634 CTGGGGTGGGCAGAGGCCAGTGG + Intergenic
970540465 4:17073249-17073271 CTGTGGTGTGCATGAGCCCTTGG - Intergenic
971114764 4:23631845-23631867 CAGTGGTGGGCAGGAGGCTCCGG - Intergenic
971294630 4:25377377-25377399 CAGAGGCCGGCAGGAGCCCCCGG - Intronic
972173415 4:36375238-36375260 CTTGGCTGCGCAGGAGCCCATGG - Intergenic
973041766 4:45477422-45477444 TTGGGCTGTGCAGGAGCCCATGG + Intergenic
973867036 4:55124909-55124931 CTGGGGTGGGAAGGCGCCTGGGG - Intronic
974000458 4:56506322-56506344 CTAGGGTGGGCAGGGGGCCCGGG - Intronic
974089848 4:57300242-57300264 TTGGGCTGTGCAGGAGCCCATGG + Intergenic
974186825 4:58457219-58457241 CTGGGCTGCGCGGGAGCCCATGG - Intergenic
976846103 4:89490303-89490325 GTGGGGGAGGCAGGAGCCCACGG - Intergenic
978207155 4:106092470-106092492 TTGGGCCGGGCAGGAGCCCACGG + Intronic
979825664 4:125229652-125229674 CTGGGGCGCACAGGAGCCCGTGG + Intergenic
980913772 4:139016038-139016060 CTGGGGCGGGCAGGCGGCGCAGG - Exonic
981550015 4:145934573-145934595 CTGGGGTGAGCCTCAGCCCCTGG - Intronic
982863429 4:160482058-160482080 TTGGGCTGTGGAGGAGCCCCCGG - Intergenic
985003226 4:185505959-185505981 CGGGAGTGGGCTGGAGACCCAGG + Intronic
985650720 5:1105976-1105998 GTGGGTGGGGCAGGAGTCCCTGG - Intronic
985676281 5:1232853-1232875 GTCCGGTGGGCAGGAGCTCCAGG - Exonic
985747599 5:1655896-1655918 CTGGTGTGGCCGGCAGCCCCTGG - Intergenic
985786176 5:1896239-1896261 CTGGTGTGAACCGGAGCCCCTGG + Intergenic
985832087 5:2241152-2241174 CTGCTGTGGGCAGGAGCCCGTGG - Intergenic
985838546 5:2288807-2288829 CTGGGGAGGCCATGAGCCCCAGG + Intergenic
986176269 5:5354618-5354640 ATGGCGTGGGCAGGAGCCACAGG + Intergenic
986446318 5:7824580-7824602 GGGAGGAGGGCAGGAGCCCCGGG - Intronic
986721565 5:10564254-10564276 CTGGGGTGGGCGGGACCGCGGGG - Intergenic
986963631 5:13244475-13244497 TTGGGCTGTGCAGGAGCCCATGG - Intergenic
987283771 5:16436471-16436493 CTTGGGTGCACAGGAGCCCACGG - Intergenic
987620307 5:20331686-20331708 CTGGGGGGAGGAGGACCCCCTGG - Intronic
990000520 5:50886364-50886386 CTGGGGTGGGAAGGAGCATGGGG + Intergenic
990382600 5:55231899-55231921 CTGGGGTGGGCCTGGGGCCCGGG - Intronic
990404387 5:55473795-55473817 GTATGGTGGGCAGGAGCCTCTGG - Intronic
991143563 5:63274412-63274434 CTGGGTTGGGGAGGTTCCCCTGG + Intergenic
991227010 5:64285347-64285369 CTGGGGTGGGTAGCAGCACTGGG + Intronic
991414209 5:66375766-66375788 CTGGAGTTGCCAGGAACCCCTGG + Intergenic
992529695 5:77642379-77642401 GTGGGGTGGGATGGGGCCCCCGG + Intergenic
994055059 5:95405749-95405771 GTGGGGTGTGGATGAGCCCCAGG + Intronic
996451327 5:123629011-123629033 CTGGGGTGGCCGGGAGCCGGGGG - Intergenic
997732668 5:136192527-136192549 CTGGGGTCGGCGGGACCCGCGGG - Intergenic
997955366 5:138274643-138274665 CGGGGGAGGGCCGGCGCCCCGGG + Exonic
998095345 5:139393115-139393137 CAGGGGTCGGCAGGAGGCGCAGG + Exonic
998157468 5:139795191-139795213 GTGGGGTGAGAAGGAGCCTCGGG - Intergenic
998333814 5:141352457-141352479 CTGTGGTTGGGAGGAACCCCGGG - Exonic
999269306 5:150287112-150287134 CTGTGGAGAGCAGGAGCCCCAGG + Intronic
999386203 5:151156184-151156206 CTGGGGAGGGCAGGAGGCAGAGG - Intronic
999834378 5:155353161-155353183 CTGAGGTGAGCCAGAGCCCCCGG + Intergenic
1001567344 5:172708036-172708058 CTGGGGTGGTCAGGGGCCTCAGG + Intergenic
1001632645 5:173187466-173187488 CTGGTTTGGGCAAGAGCCACAGG + Intergenic
1001877841 5:175216657-175216679 CGGGGGTGTGCATGAGGCCCAGG - Intergenic
1001961417 5:175882310-175882332 CTGGGGAGGCCTGGGGCCCCTGG - Exonic
1001997438 5:176173678-176173700 CTGGGGAGGCCAGGGGCCCAAGG - Intergenic
1002523480 5:179803770-179803792 TTGGTGTGGGCGGGAGCCCGTGG - Intronic
1002641595 5:180633080-180633102 CGGGGGTGGGGTGGAGCCCAGGG + Intronic
1002959739 6:1903837-1903859 CTTGGGTGGGCAGGAACCTGGGG + Intronic
1003062848 6:2876130-2876152 CCGGGGTGGGCAGGGGACCGTGG + Intergenic
1004053110 6:12108460-12108482 TTGGGCTGCGCAGGAGCCCACGG + Intronic
1004100586 6:12606178-12606200 ATGGGGTGGGTAGGAGCGGCTGG + Intergenic
1004544639 6:16586148-16586170 ATGGGGTGGGAAGCAACCCCTGG - Intronic
1006118965 6:31792492-31792514 TTTGGGAGGGCAGGAGCCTCGGG + Exonic
1006130519 6:31866199-31866221 CTGGGAGGGGCAGGAGCTACTGG - Intronic
1006135436 6:31892963-31892985 CTGGGTTAGCCTGGAGCCCCAGG + Intronic
1006439620 6:34045731-34045753 CATGGGTGGGCAGGAACCCCAGG + Intronic
1006581314 6:35079308-35079330 ATGGGGAAGGCAGGAGCCGCTGG - Intronic
1006986993 6:38182505-38182527 CTGGTGTGGGAAGGGGGCCCTGG - Intronic
1007407283 6:41642350-41642372 GTGGGGTGGGCAGGAGGCAAGGG - Intronic
1007788809 6:44297427-44297449 CTGTGGTGGGGAGGAGGCGCGGG + Intronic
1008034194 6:46729117-46729139 CTGGGGTGTGGAGGAGCCTGGGG + Intronic
1011192904 6:84751836-84751858 CTGAGGTGGGCAGGGGCACAGGG + Intronic
1012424667 6:99100821-99100843 CTGGGGTGGGCAGTCACCCTAGG - Intergenic
1013666486 6:112354641-112354663 CAGGGATGCCCAGGAGCCCCAGG - Intergenic
1016389614 6:143561598-143561620 CTGGGGAGGGCAGCACCCACAGG + Intronic
1017042051 6:150315599-150315621 CAGGGATGGGCAGCAGCCACTGG - Intergenic
1017096763 6:150811743-150811765 ACGGGAAGGGCAGGAGCCCCTGG + Intronic
1017318591 6:153062084-153062106 GTGGGGTGGGCGGGAGGCACGGG - Intronic
1017483300 6:154879790-154879812 CTTGGCTGTGCAGGAGCCTCTGG - Intronic
1017523340 6:155221254-155221276 CTGGGGTGGGCTGGAGGATCAGG + Intronic
1017717510 6:157222906-157222928 CTGGGGTGGGGCTGGGCCCCTGG + Intergenic
1018254382 6:161903949-161903971 CTGGGGTGGGCAGGAGAAACAGG + Intronic
1018501074 6:164411604-164411626 CCAGCGTGGGCAGGAGCACCAGG + Intergenic
1019128937 6:169859631-169859653 CTGGGGTGGGCTGTGGCTCCTGG + Intergenic
1019276193 7:177273-177295 CTGGGGAGGGAAGGAGCTCGGGG - Intergenic
1019284581 7:217174-217196 CTCGGGGGGTCAGCAGCCCCAGG - Intronic
1019413955 7:919023-919045 CTGGGGTGGGCTGGCCTCCCAGG + Intronic
1019428843 7:989246-989268 GTGGGGTCTGCAGGAGTCCCAGG - Exonic
1019571632 7:1715529-1715551 CAGAAGTGGGCAGGAGACCCAGG - Intronic
1019647067 7:2136613-2136635 CTGTGGAGAACAGGAGCCCCTGG - Intronic
1019715613 7:2537971-2537993 CCGGGCTGGGCTGGAGCCCTGGG + Exonic
1019922361 7:4171177-4171199 ATGGGGTGGCCACGTGCCCCAGG + Intronic
1020101674 7:5397415-5397437 CTGTGGTGGGCAGGAGCCGTTGG - Intronic
1020212584 7:6167262-6167284 CAGGGGAGGGCAGGAGACCCTGG + Intronic
1022363261 7:29684644-29684666 CTGGGCCGGGAAGCAGCCCCCGG + Intergenic
1022698124 7:32729116-32729138 CTGGGCCGGGAAGCAGCCCCCGG - Intergenic
1022698135 7:32729143-32729165 CTGGGCCGGGAAGCAGCCCCTGG - Intergenic
1023862914 7:44226516-44226538 ATGGGGTGGGCAGGGGGCCAGGG + Exonic
1023898200 7:44452536-44452558 CTGGGATGGGCATGAATCCCAGG + Intronic
1024054018 7:45648170-45648192 GTGGGGAGGTCAGAAGCCCCAGG + Intronic
1024293885 7:47827525-47827547 CTTGGCTTGGCAGGAGCACCAGG - Intronic
1024474696 7:49798300-49798322 CTGGCGTGGTCAGCAGGCCCAGG - Intronic
1025093683 7:56082083-56082105 CAGGGCTGGGCCGGTGCCCCTGG - Intronic
1025173975 7:56787559-56787581 CTGGGCTGGGCAGGAGCGCGAGG - Intergenic
1025276091 7:57581809-57581831 CTGGGGTGGGGAGGAACCTGTGG + Intergenic
1025698125 7:63790396-63790418 CTGGGCTGGGCAGGAGCGCGAGG + Intergenic
1025724436 7:64044205-64044227 CTGTGATGGGGAGGAGCTCCAGG - Intronic
1025829846 7:65038866-65038888 CCGGGCTGGGCAGGAGCGCGAGG + Intergenic
1025927950 7:65974247-65974269 CTAGAGTGGGAAGGAGACCCTGG - Intronic
1027048689 7:75007923-75007945 CACGGGTGGGCAGCTGCCCCAGG + Intronic
1027214339 7:76174134-76174156 CTGGTCTGGGCAGGAGCCAGGGG + Intergenic
1027219843 7:76206827-76206849 CTGCAGTGGGCAGGAGGCCAGGG - Intronic
1028233242 7:88330295-88330317 GTTGGCTGGGCAGGAGCTCCTGG + Intergenic
1029124643 7:98287764-98287786 CTGGTGTGGGCGGGGCCCCCAGG + Intronic
1029192457 7:98781352-98781374 CAGGGGTGAGCCTGAGCCCCTGG + Intergenic
1029374296 7:100168579-100168601 CTGGGATGGGCGGGAGGGCCCGG - Exonic
1029384320 7:100233727-100233749 CACGGGTGGGCAGCTGCCCCAGG - Intronic
1029701355 7:102248718-102248740 CGGGGCTGGGCAGGGGCCCCGGG - Exonic
1030077027 7:105745713-105745735 TTGGGAGGGGCAGGAGGCCCTGG + Intronic
1030234342 7:107242470-107242492 CTGGGGATGGCTGGAGGCCCAGG - Intronic
1031178323 7:118380924-118380946 TAGGAGTGGACAGGAGCCCCTGG + Intergenic
1032217524 7:129969155-129969177 CTGGGGTGGGCTGCAAGCCCAGG - Intergenic
1032508743 7:132455303-132455325 CAGGGGTGGGGAGGGGCGCCTGG + Intronic
1032538432 7:132683910-132683932 CTGGGATGGGAAGGAGGCACCGG - Intronic
1033156079 7:138958221-138958243 CTGGGGTGGGCGTGGGCGCCAGG - Intronic
1033589448 7:142797396-142797418 CCAGGGTGGGCAGGAGCTCGGGG + Intergenic
1033610713 7:142961265-142961287 TCAGGGTGGGCAGAAGCCCCAGG + Intronic
1033758578 7:144418040-144418062 TTGGGCTGTGCAGGAGCCCACGG + Intergenic
1034460256 7:151194119-151194141 CTGGGCAGGGCAGGAGGACCTGG + Intronic
1034461585 7:151200564-151200586 GTGGGGTGGGGAGGAGCCCTGGG + Intronic
1034846688 7:154452679-154452701 CAGGGGTGGCAAGGGGCCCCTGG - Intronic
1035311861 7:157974679-157974701 CTGGGGTGGGCAGGGCTCCATGG + Intronic
1035371080 7:158379255-158379277 CTGGGGTTGGCAGGAGGACCGGG + Intronic
1035381961 7:158446090-158446112 CTGGGTGGGGCAGGAGCCTGGGG - Intronic
1035476707 7:159149164-159149186 CTGGGGTGGGAGGGGGACCCGGG - Intergenic
1035656662 8:1313069-1313091 CTGGTGTGTGCCGGAGCCCCTGG + Intergenic
1036359115 8:8065290-8065312 CTGGGGTGGGGAGGAGGTGCAGG + Intergenic
1036891843 8:12601662-12601684 CTGGGGTGGGGAGGAGGTGCAGG - Intergenic
1037262933 8:17027618-17027640 CTGGGATGGGCAGCATCCCCCGG - Exonic
1037804261 8:22050416-22050438 CAGGGGTGGGCCGGAGAGCCGGG - Intronic
1037969709 8:23163599-23163621 CCGGGCTGGGCAGGAGCGACCGG - Intronic
1038038010 8:23702662-23702684 CTGGGGAAGGCAGGTGCGCCGGG + Exonic
1038457523 8:27687062-27687084 CAGGGGTGGGCAGGTGACTCAGG + Intergenic
1039214298 8:35251899-35251921 AAGAGGTGGGCAGGAACCCCTGG + Intronic
1039505342 8:38048055-38048077 CTAGGGTGGGCTGGAACTCCTGG - Intronic
1039846480 8:41329446-41329468 CTGGCGTGGCCAGGTGACCCAGG - Intergenic
1039894318 8:41705498-41705520 CTGGAGGGGGCGGGAGCTCCTGG + Intronic
1040277861 8:46023137-46023159 CTGGGGTGGTCATGAGCCCATGG - Intergenic
1042108777 8:65356641-65356663 CTGGGTTGGGGAGGCTCCCCTGG + Intergenic
1043529853 8:81137309-81137331 CTGGTGGGGACGGGAGCCCCGGG + Intergenic
1044125673 8:88456409-88456431 CTGGGTTGGGGAGGGTCCCCTGG - Intergenic
1045343303 8:101273024-101273046 CTGGGTAGGGCAGGGGTCCCAGG - Intergenic
1046284278 8:112074382-112074404 GTGGGCTGGGCTTGAGCCCCTGG - Intergenic
1047100151 8:121667516-121667538 TGGGGCTGCGCAGGAGCCCCCGG + Intergenic
1047274728 8:123396793-123396815 CAGGGGTGGGGAGGAGACGCCGG - Intronic
1048186851 8:132249729-132249751 TTGGGCTGTGCAGGAGCCCACGG + Intronic
1048220229 8:132534307-132534329 GTGGGGTGGGGAGGAGCACTAGG - Intergenic
1049165293 8:141121976-141121998 GCGGGGTGTGGAGGAGCCCCGGG - Intronic
1049251956 8:141593973-141593995 CAGGGGCGGGCAGGGGTCCCAGG + Intergenic
1049392872 8:142381161-142381183 CAAGGGTGGGCAGGATTCCCAGG - Intronic
1049399422 8:142418286-142418308 CTGGGTGGAGCGGGAGCCCCAGG + Intergenic
1049409338 8:142465410-142465432 CTGGGGACTGCAGGAGCCTCTGG + Intronic
1049527144 8:143133091-143133113 GTGGAGTGGGCTGGAGACCCTGG - Intergenic
1049649883 8:143760974-143760996 CTGCGGAGCGCAGGAGCACCAGG + Intergenic
1049804976 8:144534593-144534615 AGGCTGTGGGCAGGAGCCCCTGG + Intronic
1049854410 8:144852622-144852644 TTGGAGTGGGAAGGAGCTCCTGG - Intronic
1049944646 9:581853-581875 CTGAGGTGTGCAGCAACCCCAGG - Intronic
1050986578 9:12091074-12091096 CTGGGCAGAGCTGGAGCCCCTGG + Intergenic
1052378439 9:27742787-27742809 CTGGGCAGGGGAGGATCCCCTGG + Intergenic
1052832769 9:33229411-33229433 AAGAGGTGGGCAGGAGACCCTGG + Intronic
1052974368 9:34400585-34400607 CTGGGGTGGGGCCAAGCCCCTGG + Exonic
1053024089 9:34716022-34716044 TTGGGGTGGGCTGGGGCCCATGG + Intergenic
1053166337 9:35846425-35846447 CGGGGGTGGCCCGGGGCCCCAGG + Intronic
1053198403 9:36136881-36136903 CTGGGGAGTGCGGGAGCCCGGGG + Intronic
1053354892 9:37437318-37437340 CTGGGGTGGGAAGCAGAGCCAGG - Intergenic
1053398077 9:37792999-37793021 CTAGGGTGGTCAGGAACTCCTGG - Intronic
1053607776 9:39678755-39678777 CTGGGATGCTCAGGAGCCCAAGG - Intergenic
1053865625 9:42435115-42435137 CTGGGATGCTCAGGAGCCCAAGG - Intergenic
1054245759 9:62663654-62663676 CTGGGATGCTCAGGAGCCCAAGG + Intergenic
1054559884 9:66698185-66698207 CTGGGATGCTCAGGAGCCCAAGG + Intergenic
1054823515 9:69547843-69547865 CTTGGGTTGGTAGGAACCCCAGG - Intronic
1054870422 9:70043723-70043745 CTGGGCGGGGCGGGAGCCTCGGG + Exonic
1055293180 9:74805681-74805703 CAGGGATGCCCAGGAGCCCCAGG + Intronic
1056587300 9:87937325-87937347 CTGGGGTGGGGAGGAACCTGTGG - Intergenic
1056609577 9:88115618-88115640 CTGGGGTGGGGAGGAACCTGTGG + Intergenic
1056817427 9:89811816-89811838 GTGGGGTGGGGAGGAGGGCCGGG + Intergenic
1057152935 9:92809887-92809909 CTGCGGTGGGAGGGGGCCCCAGG + Intergenic
1057294723 9:93828330-93828352 CAGGGGTCCGCAGCAGCCCCTGG + Intergenic
1057920398 9:99092447-99092469 GTGGGAAGGGCAGGTGCCCCTGG - Intergenic
1058908566 9:109499954-109499976 CCGGGCGGGGCCGGAGCCCCCGG + Intergenic
1059406014 9:114098653-114098675 CTGGGGAGGGTAGGACACCCTGG + Intronic
1059451807 9:114375971-114375993 CTGGCTTGGGCAGGAAGCCCTGG - Intronic
1059650685 9:116313281-116313303 CTGGGGTGGGCAGGAGCCCCAGG - Intronic
1060139936 9:121201393-121201415 TTGGGGAGGGCAGGAGGCTCAGG + Intronic
1060423629 9:123486895-123486917 CAGGGGTGGGCATGCGACCCTGG + Intronic
1060539478 9:124419916-124419938 CTGGGCTGGGCTGCAGTCCCAGG - Intergenic
1060583113 9:124770204-124770226 CCGGGGCGGGCTGGAGCCCTCGG + Intronic
1060590062 9:124810904-124810926 CTGGTGTGGGGTGGAGGCCCTGG + Exonic
1060596298 9:124851144-124851166 CTAAGCTGGGCAGGGGCCCCAGG - Intergenic
1060819940 9:126655393-126655415 CTGTGCTGGGCAGGTGTCCCTGG - Intronic
1060938365 9:127528856-127528878 CTGCTTAGGGCAGGAGCCCCGGG + Intronic
1061150096 9:128823502-128823524 CAGGGGTGGGCAGGGCCCCCTGG + Intronic
1061255533 9:129452883-129452905 CTGGAGTGGGCAGCAGGGCCAGG - Intergenic
1061306671 9:129736461-129736483 CTGGGGTGGGCGGGCTCCGCAGG - Intergenic
1061508945 9:131048916-131048938 CTGGGGTAGGAGGGAGCCCCAGG - Intronic
1061571039 9:131477601-131477623 CTCGGGTGGGGAGGAGCGGCAGG - Intronic
1061598333 9:131647397-131647419 CTGGGGCGAGAAGGAGCCCTCGG + Intronic
1061682491 9:132249988-132250010 GTGGGGTGGGCAGGGGCTTCGGG - Intergenic
1061780832 9:132995175-132995197 CTGGGGCGGGGAGGTGGCCCAGG + Intergenic
1061912068 9:133730229-133730251 GTGGGGTGGGAAGCACCCCCGGG - Intronic
1061946451 9:133911018-133911040 CTGGGGTGCTCAGGAGGCCACGG - Intronic
1061949492 9:133928395-133928417 CTGGGGTGGGGAGCTGCCTCAGG - Intronic
1061996770 9:134190104-134190126 CTGGGGAGGGCACTAGCCACAGG - Intergenic
1062022837 9:134327190-134327212 CCCGGGTGGGCAGGGTCCCCCGG + Intronic
1062102153 9:134733951-134733973 TCAGGGTGGGCAGGTGCCCCTGG + Intronic
1062198708 9:135289118-135289140 CTCGCGTGATCAGGAGCCCCCGG - Intergenic
1062219951 9:135409774-135409796 CTGAGCAGGGCAGGAGGCCCAGG + Intergenic
1062253168 9:135608464-135608486 CTGGAGAGGGCAGGAACCACGGG + Intergenic
1062265813 9:135685987-135686009 CTGCAGTGACCAGGAGCCCCAGG - Intergenic
1062268657 9:135699063-135699085 CTTGGGCGGGCCCGAGCCCCGGG + Exonic
1062311439 9:135939787-135939809 CTGGGGGCGGCAGGAGGCCGAGG + Intronic
1062318605 9:135979791-135979813 CTGGGGTGGTCTGCAGACCCAGG - Intergenic
1062327144 9:136017823-136017845 GTAGGGTGTGCAGGAGCCCAGGG - Intronic
1062337045 9:136075944-136075966 GAGGAGTGGGCAGCAGCCCCAGG - Intronic
1062351651 9:136142560-136142582 TTGGGGAGGGAGGGAGCCCCAGG - Intergenic
1062375872 9:136261696-136261718 CTGGGCTGGGAAAGAGCCTCAGG + Intergenic
1062385536 9:136309542-136309564 CTGAGGGTGGCTGGAGCCCCTGG - Intergenic
1062427633 9:136513207-136513229 CTGGGGTGGGGAGCAGGCCCAGG - Intronic
1062432582 9:136532676-136532698 CTGGGGCTGTCAGGAGCCCTGGG + Intronic
1062524411 9:136972465-136972487 TGGGGGCAGGCAGGAGCCCCCGG + Intergenic
1062540763 9:137040779-137040801 CGGGGGTGGGCAGGGGCAGCAGG - Intronic
1203627268 Un_KI270750v1:35298-35320 CTGGGGTGGGGAGGAACCTGTGG + Intergenic
1186799715 X:13080568-13080590 CTGTGGTTGGCAGGGGCCACGGG + Intergenic
1187425732 X:19175901-19175923 CTGTGGAGGGCAGAAGCCCTTGG + Intergenic
1190050737 X:47146767-47146789 CTGTGTTGGCCAGGAGCCCAGGG + Intronic
1190338016 X:49274551-49274573 CTGGGGTGGACAGGCTCCCCTGG - Intronic
1190369366 X:49726740-49726762 CTGTGGTGGGGAGGGGCTCCAGG - Intergenic
1192760229 X:74088654-74088676 AGGGGGTGGGCTGGAGTCCCTGG - Intergenic
1193108612 X:77705083-77705105 CTGGGTGCAGCAGGAGCCCCGGG - Intronic
1193933051 X:87581161-87581183 CAGGGGTGGCCAGAAGCCCTGGG - Intronic
1194866512 X:99075360-99075382 CTGGACTGGGCAGGAGACACTGG - Intergenic
1195505753 X:105654965-105654987 CAAGGGTAGGCAGAAGCCCCCGG + Intronic
1195676611 X:107511727-107511749 CAGGTGTGGGCAGGAGCTTCTGG - Intergenic
1198256180 X:134925930-134925952 TTGGACTGTGCAGGAGCCCCAGG - Intergenic
1198296934 X:135296158-135296180 CTGGGATGGAAAGGACCCCCGGG - Intronic
1198800084 X:140439520-140439542 CTGGCGGGGGCACGAGCCGCTGG + Intergenic
1200035667 X:153327863-153327885 CTGGGTAGGGGAGGATCCCCTGG + Intergenic
1200044437 X:153393554-153393576 CTGGGGAGGGCTGGAGAACCGGG + Intergenic
1200045144 X:153397095-153397117 CCGGGCTGGGGAGGAGCCCCAGG + Intergenic
1200217697 X:154375208-154375230 CTGGGGTGGGCAGCAGAAACAGG + Intergenic
1201469134 Y:14314739-14314761 TTGGGCTGTGCAGGAGCCCACGG - Intergenic