ID: 1059650686

View in Genome Browser
Species Human (GRCh38)
Location 9:116313290-116313312
Sequence AAAAGGATTCTGGGGTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 320}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059650686_1059650696 11 Left 1059650686 9:116313290-116313312 CCTGCCCACCCCAGAATCCTTTT 0: 1
1: 0
2: 2
3: 39
4: 320
Right 1059650696 9:116313324-116313346 TCATATGTGCAGGTGGTGAAAGG No data
1059650686_1059650699 22 Left 1059650686 9:116313290-116313312 CCTGCCCACCCCAGAATCCTTTT 0: 1
1: 0
2: 2
3: 39
4: 320
Right 1059650699 9:116313335-116313357 GGTGGTGAAAGGGGACACTTCGG No data
1059650686_1059650698 13 Left 1059650686 9:116313290-116313312 CCTGCCCACCCCAGAATCCTTTT 0: 1
1: 0
2: 2
3: 39
4: 320
Right 1059650698 9:116313326-116313348 ATATGTGCAGGTGGTGAAAGGGG No data
1059650686_1059650694 1 Left 1059650686 9:116313290-116313312 CCTGCCCACCCCAGAATCCTTTT 0: 1
1: 0
2: 2
3: 39
4: 320
Right 1059650694 9:116313314-116313336 CAAACATGACTCATATGTGCAGG No data
1059650686_1059650695 4 Left 1059650686 9:116313290-116313312 CCTGCCCACCCCAGAATCCTTTT 0: 1
1: 0
2: 2
3: 39
4: 320
Right 1059650695 9:116313317-116313339 ACATGACTCATATGTGCAGGTGG No data
1059650686_1059650697 12 Left 1059650686 9:116313290-116313312 CCTGCCCACCCCAGAATCCTTTT 0: 1
1: 0
2: 2
3: 39
4: 320
Right 1059650697 9:116313325-116313347 CATATGTGCAGGTGGTGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059650686 Original CRISPR AAAAGGATTCTGGGGTGGGC AGG (reversed) Intronic
901883492 1:12207422-12207444 AAAAGGATGCTGGGGTTTTCTGG - Exonic
902041679 1:13497036-13497058 ACAAGGAATCTGGGGTGCCCAGG + Intronic
902072617 1:13753699-13753721 AAAGGGATGCTGAGCTGGGCTGG + Intronic
904376236 1:30084172-30084194 AAAAGGATCCTGGTGAGGGAAGG + Intergenic
904741645 1:32681669-32681691 AAAAAGATTCTAGAGTTGGCCGG - Exonic
905817774 1:40965333-40965355 AAATGGAATCTGGGATGGGGAGG + Intergenic
906362410 1:45174870-45174892 AAAAGTATTCTGGGGTGATAAGG - Intronic
908400773 1:63771305-63771327 AAAAAAATGCTGGGGTGGGGGGG - Intergenic
908686888 1:66730752-66730774 AAAAGGATTCTGAGGCAGGATGG - Intronic
910479062 1:87638759-87638781 AAAAGAATTCAAGGGTGAGCTGG - Intergenic
910566194 1:88645481-88645503 TAAAGGACTCTGGGGTGGGAAGG + Intergenic
911095054 1:94048132-94048154 AAATGGCCCCTGGGGTGGGCTGG + Intronic
913063504 1:115229063-115229085 AAAAGGATTGTGGGCTGGTTGGG + Intergenic
914393163 1:147240278-147240300 AAATGGATTCAGGGCTGTGCAGG + Intronic
914691113 1:150028531-150028553 AAAAGAATTCTGGAGTTGGATGG - Intergenic
915015173 1:152726314-152726336 AAATGGGTGTTGGGGTGGGCTGG + Intergenic
915710730 1:157895761-157895783 GAAAGAATTCAAGGGTGGGCTGG - Intronic
916069926 1:161163991-161164013 CAGAGGATTCCGGGGTGGACAGG + Intronic
916437197 1:164788052-164788074 AAAAAGCTGCTGGGGTGGGGAGG + Intronic
918532796 1:185541574-185541596 ACAAGGATTCTGGGGAGAGACGG - Intergenic
919115498 1:193276012-193276034 AAAAGGATCCAGTGGTGGGCAGG + Intergenic
919893570 1:201993905-201993927 TAAATGATTGTGGGGTGGGGGGG - Intronic
920181663 1:204135552-204135574 AGGAGGATTCTGGGATGGGGTGG - Intronic
920184259 1:204150837-204150859 ACAGGCATTCTGGGGTGGGGTGG - Intronic
920278950 1:204829001-204829023 GAAAGGGTGTTGGGGTGGGCAGG - Intronic
920555824 1:206903690-206903712 AAAGGGATGATGGGGTGAGCTGG - Intronic
921434448 1:215101399-215101421 AAAGGTTTTTTGGGGTGGGCAGG + Intronic
922274177 1:224061464-224061486 AAACGGCTTCAGGGGTGTGCAGG - Intergenic
1063106497 10:2997008-2997030 AAAAAGATTATGGGGTGGGGGGG + Intergenic
1065114223 10:22468979-22469001 TGAAGGATTCTGGAGTGAGCAGG + Intergenic
1065150863 10:22821866-22821888 AAAAGGTTTCAGAGGTGGGGTGG - Intergenic
1066009061 10:31176668-31176690 CAAATGATTATGGGGTTGGCAGG - Intergenic
1067360316 10:45572900-45572922 AAAAGGATTGTAGGGTGGCGGGG - Intronic
1067820879 10:49529076-49529098 AAGAGGAGTCTGGCGTGGCCAGG - Intronic
1068584064 10:58776813-58776835 AAGAGGATTCTGGGAAGGGGAGG - Intronic
1068773988 10:60851913-60851935 GAAAGGATTCTGCCCTGGGCTGG - Intergenic
1068946379 10:62733651-62733673 AAAAGTATTTTGGGGTGGTGGGG + Intergenic
1069627948 10:69880047-69880069 GAAAGCATCCTGGGCTGGGCCGG + Intronic
1069789383 10:71009990-71010012 AAAAGGAGTCTCTGGTTGGCTGG + Intergenic
1069947689 10:71999095-71999117 AAACGGAATCTGGGCTGGACAGG + Intronic
1070169455 10:73921710-73921732 AAAAAAATTCTGGGCTGGGCGGG - Intronic
1070546563 10:77457410-77457432 GAAAGGACTCTGGGGAGGGCAGG - Intronic
1070719025 10:78743657-78743679 AAGAGGATACTGGGGAGTGCAGG - Intergenic
1071532863 10:86402267-86402289 AAAAGGGTTCTGGGCAGGGCAGG - Intergenic
1071728176 10:88220306-88220328 TTTAGGATTTTGGGGTGGGCAGG + Intergenic
1074919741 10:117994974-117994996 GAAGGGATTCTGTGCTGGGCTGG + Intergenic
1075591832 10:123697572-123697594 AGAAGGCTGCGGGGGTGGGCAGG - Intergenic
1076686266 10:132199775-132199797 AAAAGGACTCTGAGGCGTGCAGG + Intronic
1077021331 11:418397-418419 AGATGGATGCTGGGGTGGGATGG + Exonic
1080775993 11:35387224-35387246 CAAATCATTCTGGGGTGGGTGGG + Intronic
1081965888 11:47169396-47169418 AAAAGGGGTCTAGGGTTGGCAGG + Intronic
1082032574 11:47616221-47616243 AAGAAGAGTGTGGGGTGGGCTGG - Intergenic
1083157369 11:60832487-60832509 AAGGGGATTATGGGTTGGGCAGG - Intergenic
1084711792 11:70848070-70848092 AAAAGGAGTCTGAGGTCCGCTGG + Intronic
1084940246 11:72608611-72608633 CAAAGGATTTGGGGGTGGGGTGG + Intronic
1086404032 11:86484949-86484971 AATAGAATACTGGGGTGGGAAGG + Intronic
1088252845 11:107876609-107876631 AATACTATTCTGTGGTGGGCAGG - Intronic
1089808046 11:121109252-121109274 GAAAGGATTCTGGCGTGAACTGG - Exonic
1090127900 11:124108225-124108247 AAAAGGATCCTGGGGTAAGGAGG - Intergenic
1090359812 11:126164456-126164478 AAAAGGATTTGGTGCTGGGCTGG - Intergenic
1090686077 11:129121507-129121529 AAGAAGATTCTGGTGTGGACTGG + Intronic
1090712408 11:129399564-129399586 AAAAGAATTCAAGGGTGAGCTGG + Intronic
1092653910 12:10664757-10664779 AAAATGATTTTGGTGTGGGAGGG + Intronic
1094728946 12:33152710-33152732 AAAAGGATTTGGAGGTGGTCTGG - Intergenic
1095558768 12:43540164-43540186 AAAAGAATTCTGTGGTTGGCCGG - Intronic
1096633608 12:52945121-52945143 AAAAGGAATCTGGGGTGGAATGG - Intronic
1098988393 12:77037043-77037065 TAAAGAATTCTAGGTTGGGCCGG - Intronic
1099887849 12:88553896-88553918 TAAAGAAGTCTGGGGTGGGAGGG + Intronic
1099956398 12:89354999-89355021 AAAGGGCTTCTGGAGTGGGACGG + Intergenic
1101317863 12:103645868-103645890 AAATGGCTTCTGGGCGGGGCTGG + Intronic
1101438859 12:104687773-104687795 AAAAAAATTTTGGGGGGGGCGGG - Intronic
1101632165 12:106505678-106505700 AAAGGCACTCTGGGGAGGGCAGG - Intronic
1102963022 12:117105824-117105846 TAAAGGATACTTTGGTGGGCAGG - Intergenic
1104679491 12:130739677-130739699 CAGAGGATGCTGGGGTGGGCAGG - Intergenic
1104904523 12:132206113-132206135 GACAGGATTCTGTGGTGGGTGGG - Intronic
1107865198 13:44696408-44696430 AAAAGGAGTGTGGGCTGGGCCGG + Intergenic
1107992016 13:45826994-45827016 AAAAGGAATTGGTGGTGGGCAGG - Intronic
1108933264 13:55858757-55858779 ACAAGGATGCAGGGGTGGGGAGG - Intergenic
1111975672 13:94964686-94964708 AAAAAGATTCGGGAGTGGGGAGG + Intergenic
1112133471 13:96549823-96549845 AGAAGGTGTCTCGGGTGGGCAGG - Intronic
1112338155 13:98531549-98531571 AAAAGGTGTCTAGGGTTGGCTGG - Intronic
1114310557 14:21462929-21462951 AAAAGGATTATGGGGTATTCTGG + Intronic
1115595101 14:34901610-34901632 TAAAGGATTCGGGGGTGGGGGGG + Intergenic
1117642703 14:57817180-57817202 ATAAGGATTGTGGGGTTGGCTGG + Intronic
1119510044 14:75203877-75203899 GAGAGGATTCTGGTGTAGGCTGG - Intergenic
1123456339 15:20429834-20429856 AGGAGGATGGTGGGGTGGGCGGG + Intergenic
1123661727 15:22570523-22570545 AGGAGGATGGTGGGGTGGGCGGG - Intergenic
1124148589 15:27156002-27156024 AAAAGTATTCTGTCGTGGCCAGG + Intronic
1124165668 15:27323754-27323776 GAAAGGGTTCTGGGGTGTGCAGG - Intronic
1124577374 15:30921826-30921848 AAGAGGGATTTGGGGTGGGCAGG - Intronic
1124625234 15:31304015-31304037 AACTGTGTTCTGGGGTGGGCAGG - Intergenic
1125164956 15:36692088-36692110 AAAAGGGGTCTGGGGTGGGGCGG - Intronic
1125451074 15:39808211-39808233 AAAAGGATTCTGGAGTTGAGGGG - Intronic
1126810477 15:52398050-52398072 AAAAACATTCTGTGGTGGGAAGG + Intronic
1128178693 15:65580959-65580981 AAAAATGTTCTGGGGTGGCCAGG + Intronic
1130353924 15:83113141-83113163 CAAAGCATGCTGGGGTTGGCAGG - Intronic
1130686500 15:86042202-86042224 TAAAGCATCCTGGAGTGGGCTGG - Intergenic
1131181699 15:90244527-90244549 AAAAGAAGTCTTGGGTTGGCTGG + Exonic
1131550464 15:93352500-93352522 GAAAGGCTGCTGGGGTGGGCTGG + Intergenic
1134286723 16:12868258-12868280 GAAAGGCTTCTGGGCTGGGAGGG - Intergenic
1134600107 16:15527165-15527187 AAAAAAATTCTGGGGAGGGATGG - Intronic
1134835396 16:17356641-17356663 CAAGGGTTTCTGGGGTGGACTGG - Intronic
1135790511 16:25390055-25390077 AAAAAGATTATGGGGAGGGATGG - Intergenic
1135921082 16:26649480-26649502 GAAAGGAGTCAGGGCTGGGCAGG - Intergenic
1135957176 16:26965653-26965675 GAAAGGATTCTGGGGTCTCCAGG + Intergenic
1135994902 16:27240469-27240491 TGATGGATGCTGGGGTGGGCTGG - Intronic
1136403870 16:30032109-30032131 GAAAGGACTGCGGGGTGGGCTGG + Intronic
1136548831 16:30970944-30970966 AAAAGGATTCTGGGCTGAAAAGG - Intronic
1136582905 16:31164807-31164829 AAAAGCATTTTGGGGAGGGATGG - Intergenic
1140509766 16:75498715-75498737 AAGAGGATGCTGGCCTGGGCAGG - Intergenic
1140515564 16:75538923-75538945 AAGAGGATGCTGGCCTGGGCAGG - Exonic
1140557993 16:75943627-75943649 AAAAGTAATCGGGGGTGGGGTGG + Intergenic
1140865897 16:79061992-79062014 AAAATGATTCTAAGGTGGGGAGG - Intronic
1141512542 16:84522026-84522048 TAAAGTATTCAGGGTTGGGCTGG - Intronic
1141847345 16:86619832-86619854 GAAAGAATTCAAGGGTGGGCTGG - Intergenic
1141908696 16:87044039-87044061 AAAAAAATTCTGAGGTGGCCAGG - Intergenic
1142837025 17:2594359-2594381 AAAAGTATTCTTGGGTTGGAAGG + Intronic
1143116080 17:4582521-4582543 AGAGTGATTCTGGGGTGGGAAGG - Intergenic
1143282740 17:5766926-5766948 AAAAGGATAGGGAGGTGGGCAGG - Intergenic
1143764366 17:9127819-9127841 AAAAGTATTCTAGGTTGGTCGGG + Intronic
1143916597 17:10298113-10298135 CAAAGGCATTTGGGGTGGGCTGG + Exonic
1145786085 17:27594748-27594770 AAGGGGAATGTGGGGTGGGCAGG - Intronic
1146071195 17:29683452-29683474 AAAAGGATGGTGGGCGGGGCGGG - Intronic
1146263289 17:31435544-31435566 AAAAGGTTTGGGGGTTGGGCTGG - Intronic
1146712644 17:35056006-35056028 TTAAGGATTTTGGAGTGGGCTGG - Intronic
1146727947 17:35170896-35170918 GAAAGGAGTCTGGGGGGGCCTGG - Intronic
1147150880 17:38512945-38512967 AAAGGGAATCTAGGGAGGGCTGG + Intergenic
1148100485 17:45087497-45087519 AAAAGGATTCTGGAAGGGACTGG + Intronic
1148853328 17:50565367-50565389 AATAGGCTTGTGGGGTGGGGCGG + Intronic
1149295726 17:55260691-55260713 AAAAGAATTCAAGGGGGGGCCGG + Intergenic
1150284398 17:63947012-63947034 AAGGGGCCTCTGGGGTGGGCTGG - Intronic
1150995056 17:70307566-70307588 CAAAGCATTCTGGACTGGGCTGG - Intergenic
1151359396 17:73579533-73579555 ATCTGGATTCTGGGGTGGGTAGG - Intronic
1151682672 17:75630052-75630074 AAACTGTCTCTGGGGTGGGCTGG + Intronic
1152034775 17:77865425-77865447 AAAGGGATTCTGAGGAGGGCTGG + Intergenic
1152263934 17:79282560-79282582 AATAGGGGTGTGGGGTGGGCAGG + Intronic
1156458541 18:37308262-37308284 CAAAGGAGTTTGGGGTGGGGAGG - Intronic
1157132695 18:45022264-45022286 TACAGGTTTCTGGGGTGGCCAGG - Intronic
1157574376 18:48733796-48733818 GCAAGCACTCTGGGGTGGGCTGG - Intronic
1157660203 18:49434566-49434588 AAAAGGACTCTGGAGTGGGGAGG + Intronic
1158506047 18:58046033-58046055 AAAGGTATTTTGGGGTGGGAAGG + Intronic
1158551107 18:58437153-58437175 AAAGGAATTCTGGGTTGGGGAGG - Intergenic
1158613178 18:58961926-58961948 GAAGGGATTCTAGGGTCGGCTGG + Intronic
1159744588 18:72215233-72215255 ATAAGGATCCTGGGTTGGGAAGG - Intergenic
1159794374 18:72823583-72823605 AAAAGGATGGAGGTGTGGGCAGG + Intronic
1160040244 18:75338662-75338684 AAAATAATCCGGGGGTGGGCGGG + Intergenic
1160503221 18:79412455-79412477 AAAAGGAGTGGGGGGTGGGGAGG - Intronic
1161039077 19:2100503-2100525 GAAAGGATGCTGGTGTGGGCCGG + Intergenic
1161392066 19:4026421-4026443 AAAAGAAATGTGGGATGGGCAGG - Intronic
1162939216 19:13997931-13997953 GAAAGGAGTTTGGGGAGGGCAGG - Intronic
1162992682 19:14313565-14313587 ATAAGAATTCTGGAGGGGGCCGG + Intergenic
1163357176 19:16821392-16821414 AACAGGATTCTGGGGCGGGGTGG + Intergenic
1164907572 19:31979790-31979812 AGAAGGAGTTTGGGGTGGGGTGG - Intergenic
1165126507 19:33601647-33601669 AAAAGGATAATTTGGTGGGCAGG - Intergenic
1165185720 19:34019376-34019398 GGAGGGATTTTGGGGTGGGCTGG - Intergenic
1165285077 19:34834952-34834974 CAAAGGATTCAAGGGTGAGCTGG - Intergenic
1165434336 19:35788133-35788155 GAACGGCTTCGGGGGTGGGCAGG - Exonic
1166702975 19:44892749-44892771 ACAAGGTCTCTGGGCTGGGCAGG - Intronic
1167460728 19:49623644-49623666 AAAAGAATTCTGGGGTAGATGGG + Intronic
1167999086 19:53430904-53430926 AAAAGTATTTTGGGGGGGCCAGG + Intergenic
1168654940 19:58120343-58120365 AGATGGATTCTGGGGTAGCCTGG - Intergenic
925490113 2:4382217-4382239 AAAAAGATTCTGGGTTCAGCTGG + Intergenic
926285867 2:11487751-11487773 AAAAGGGTTGTGGTGTGGGGAGG - Intergenic
926561611 2:14423824-14423846 AAAAGAATGATGTGGTGGGCAGG - Intergenic
926886980 2:17606863-17606885 AAAGGTCTTCTGGGGTGGGAAGG + Intronic
927157721 2:20231228-20231250 GGAAGGAGTCTGAGGTGGGCTGG + Intergenic
927186462 2:20485837-20485859 ATAAGGATCCTGGGGTTGGGGGG + Intergenic
927653672 2:24928026-24928048 AAAAGATTTCTAGGGTGGCCGGG - Intergenic
927790058 2:26002728-26002750 AAAAGGAGTCTGGAGGGGCCAGG + Intergenic
928095861 2:28404662-28404684 AGAAGGATCCTGCTGTGGGCAGG - Intronic
928103679 2:28453810-28453832 GAAAGGAGCCTGGGGTGGCCTGG + Intergenic
929254245 2:39792100-39792122 ACAATGATTCTTGGGTGGTCTGG + Intergenic
929389475 2:41453026-41453048 AATAAGAGTCTGGGCTGGGCCGG - Intergenic
930130518 2:47845148-47845170 CAAAGGATTCCAGGGTGGGGTGG - Intronic
930184059 2:48394139-48394161 AAAAGGTTTCTGAGGAGGGTTGG + Intergenic
930878691 2:56248250-56248272 AGATGTATTCTGGGGTTGGCTGG + Intronic
931223348 2:60308076-60308098 AAAATTGTTCTAGGGTGGGCAGG + Intergenic
931399886 2:61921737-61921759 AAAATAATACTGGGTTGGGCTGG - Intronic
932258242 2:70305152-70305174 AAAATGATTCTTGGCTGGGGCGG + Intergenic
935636820 2:105255606-105255628 AAAAGCATTCTTTGGTGGGGTGG - Intergenic
935808244 2:106770141-106770163 CAAAGGATCCTGGGATGGGGTGG - Intergenic
935881351 2:107569138-107569160 AAAAGGAAACTGGGATGGCCAGG - Intergenic
938560858 2:132470756-132470778 GAAAGGCTTCCTGGGTGGGCGGG + Intronic
940122858 2:150286953-150286975 AAAAGAATTCAAGGGTGAGCTGG + Intergenic
940177154 2:150890983-150891005 AAAAGCATTCTGGAGAGGGATGG + Intergenic
940646314 2:156396177-156396199 AATATGATTATGGGGTGGGGGGG + Intergenic
940920914 2:159305644-159305666 AAAAGAATTCTGGGGATGGATGG + Intergenic
941053870 2:160765762-160765784 AAGAGGATTCTGGGCAGGGAAGG - Intergenic
942839883 2:180347634-180347656 AAAAGGACTGTGGAGTTGGCTGG + Intergenic
943878321 2:193102552-193102574 AACCTGATTCTGGGGTGGTCTGG + Intergenic
945461467 2:210114332-210114354 AATAGGATTTTGGGTTGGCCAGG - Intronic
947612391 2:231532002-231532024 GAAAGGATTCTGTGGTGCCCTGG + Intergenic
947927587 2:233935334-233935356 ACAAGGATGCTGGGGTGAGTGGG + Intronic
1169027923 20:2385655-2385677 AGAGGGATTATGGGGTGGGTGGG + Intronic
1169446055 20:5671923-5671945 AAAAGGATTCTGATGCAGGCCGG - Intergenic
1169660612 20:7974614-7974636 AAAAGGCTAATGGGGTCGGCGGG - Intergenic
1170577851 20:17677969-17677991 AAAAGGTTTCGGGACTGGGCAGG + Intronic
1170941835 20:20854476-20854498 AAAAGCTCTCTGAGGTGGGCAGG - Intergenic
1171167665 20:22986045-22986067 AAACAGATCCTGGGTTGGGCAGG - Intergenic
1173526042 20:43733543-43733565 AAAAAGGTTGTGGGGTGGGCAGG - Intergenic
1175599100 20:60258234-60258256 CAAAGGATTCTGAGTTGGGGAGG - Intergenic
1177735521 21:25084219-25084241 AAAAAGATAATGGGGTGGGGAGG - Intergenic
1178631883 21:34268543-34268565 AAAAGGATGGTGGTGTGGGCTGG + Intergenic
1179100939 21:38355252-38355274 AAGAGGAGGCTGGGGTGGACAGG + Intergenic
1179633666 21:42693886-42693908 TAAAAGATTCCTGGGTGGGCTGG - Intronic
1180797699 22:18614827-18614849 AAAAGGACACTGGGGTGGATGGG + Intergenic
1181224018 22:21380433-21380455 AAAAGGACACTGGGGTGGATGGG - Intergenic
1181254614 22:21554384-21554406 AAAAGGACACTGGGGTGGATGGG + Intronic
1181256558 22:21566712-21566734 AAAAGGATTATAGGGTGGGAGGG - Intronic
1181259976 22:21590819-21590841 AAAAGGAATCTGGGGTGGGAAGG - Intronic
1182342394 22:29634021-29634043 AAAAGGTGTCTGGGGAGTGCTGG + Intronic
1182752547 22:32653509-32653531 TAAAGGACTCTGGGTTTGGCTGG - Intronic
1182971572 22:34584138-34584160 AAAAGAATTCAAGGGTGGGCTGG + Intergenic
1183165935 22:36147478-36147500 TGAAGGATTCCGGGGTTGGCTGG + Intronic
1183335509 22:37243893-37243915 AGATGGCTTCTGGGGTGGGGTGG + Intronic
1183551777 22:38491877-38491899 AAAAAAATTGTGGGGGGGGCAGG + Intronic
1183834048 22:40437391-40437413 AAAAGGAAGCTGGGGTGGGGTGG - Intronic
1184681509 22:46074708-46074730 ACAAGGACTATGGTGTGGGCTGG + Intronic
1184902098 22:47452824-47452846 GACAGGATGCTGGGGTGGGAAGG - Intergenic
1184934831 22:47713755-47713777 AGAAGGACCCTGGGGTTGGCAGG + Intergenic
949836929 3:8279738-8279760 CAAAGGAGGCTGGGGTTGGCGGG - Intergenic
950570102 3:13794548-13794570 AACATGATGGTGGGGTGGGCTGG + Intergenic
950886425 3:16366585-16366607 AAAAGGACCATGAGGTGGGCGGG - Intronic
951534678 3:23729874-23729896 AAAAGGAAGCAGGAGTGGGCAGG - Intergenic
954042060 3:47895993-47896015 AGAAGCAATCTGGGGTGGGGGGG + Intronic
954140986 3:48605341-48605363 AGAAGGATTATGGGGTGGGCAGG - Intronic
954661373 3:52228712-52228734 CAAAGGTTTCTGGGCTGTGCTGG + Exonic
955411205 3:58656691-58656713 ATAAAGACTCTGGGGTGGGCAGG - Intronic
955985771 3:64572745-64572767 AAGAGGCTTCTGGGTGGGGCTGG + Intronic
956674548 3:71722023-71722045 AAAAGGGTCCTGGGTGGGGCAGG + Intronic
957675329 3:83357099-83357121 AGAAGGATTATGGGGTGGAGGGG + Intergenic
960310507 3:116110966-116110988 AAAGGGGTTCTCTGGTGGGCAGG + Intronic
961100924 3:124198459-124198481 TAAAGGCTTCTGAGGTGGGAGGG + Intronic
961429148 3:126868079-126868101 AAAAGGCTTCCAGGGTAGGCAGG - Intronic
962970899 3:140400924-140400946 AAAAGTATTCTGGCCTGGTCAGG - Intronic
963607317 3:147422237-147422259 AGATGGATTTTGGGGTGGGAGGG + Intronic
967654693 3:192033025-192033047 AAAAGGATTATGGGATTGGTTGG - Intergenic
968075965 3:195816297-195816319 AAAAGGAGGCCGGGCTGGGCAGG - Intergenic
968914492 4:3491393-3491415 AGAAGGAAGCTGGGGTGAGCAGG - Intronic
970508573 4:16757458-16757480 CAAATGATGCTGGGGTGGGATGG + Intronic
971301631 4:25446786-25446808 AAAATGTTCCTGGGGTGGGCTGG + Intergenic
971304052 4:25464911-25464933 TAAATGATGCTGGGGTGGGGTGG - Intergenic
972519430 4:39839744-39839766 AATATGATTCTGGGGGGGGGGGG + Intronic
972547980 4:40099905-40099927 AAAAGGTGGCGGGGGTGGGCAGG - Intronic
972988554 4:44795587-44795609 ATAAGTATTCTGGGGTTGTCAGG + Intergenic
973662369 4:53121274-53121296 GGATTGATTCTGGGGTGGGCTGG + Intronic
975494942 4:75027196-75027218 GGAACCATTCTGGGGTGGGCAGG - Intronic
975956746 4:79849720-79849742 AAAAAGATTCTGTGATGGACTGG + Intergenic
976333455 4:83858427-83858449 AAAAGGAGTGGGGGGTGGGCGGG + Intergenic
976382893 4:84420340-84420362 AAAAGAATACTGGGAAGGGCAGG + Intergenic
976592134 4:86859636-86859658 ACAAGGATTCTGGTGGGGCCAGG + Intergenic
976788028 4:88844839-88844861 AAGAGCATTCTGGAGTTGGCTGG + Intronic
976805483 4:89041622-89041644 AAAAGGATACTGTGGCAGGCCGG + Intronic
978278788 4:106984911-106984933 CAAAAGATTATGGGCTGGGCCGG + Intronic
978348901 4:107800690-107800712 AACAGGACTGTGGGCTGGGCAGG - Intergenic
978538177 4:109785536-109785558 AAAAAGATTTTGGGGAGGGCGGG - Intronic
979033055 4:115677341-115677363 GAAAGTCCTCTGGGGTGGGCAGG + Intergenic
982532893 4:156569848-156569870 AAAAGGATTTTGGGGTAGAAAGG + Intergenic
983429102 4:167625102-167625124 CAAAGGATTCTGGAGTTGGATGG - Intergenic
985146987 4:186903545-186903567 GAAAGGCTTCAGGAGTGGGCAGG - Intergenic
986288029 5:6374968-6374990 AAAAGGATCTTGGGGTCGTCAGG - Intronic
987132711 5:14872870-14872892 AAAGGGACTCTGGGCAGGGCTGG + Intergenic
988964411 5:36402061-36402083 AAAAGGATCCTGTAGTTGGCAGG + Intergenic
990598402 5:57333465-57333487 AAAGTGATGCTGGGGTGAGCTGG + Intergenic
992222482 5:74586431-74586453 AAAAAAGTTCTGGGGTGGGGAGG + Intergenic
994765776 5:103915561-103915583 GAAGGGATTCCAGGGTGGGCAGG - Intergenic
995774928 5:115714801-115714823 AACAGTCTTCTAGGGTGGGCAGG - Intergenic
995902543 5:117087272-117087294 AAAAGGTTTCTGGGAGAGGCTGG + Intergenic
996247021 5:121276654-121276676 AAAAGGATAGAGGGGAGGGCAGG + Intergenic
997374079 5:133384504-133384526 AGAACCATCCTGGGGTGGGCAGG + Intronic
998468371 5:142363976-142363998 AAAAGGATAAAGGGGTGGGAAGG + Intergenic
998471702 5:142388780-142388802 AACAGGATTCTGTGGAAGGCAGG + Intergenic
1000730549 5:164829144-164829166 ATTTGGATTCTGGGGTGGGGTGG + Intergenic
1002275731 5:178103424-178103446 GAAAGAATTCTGGTGTGGGGCGG - Intergenic
1004014811 6:11722625-11722647 AAAAATATTCTGGGGTGGGGTGG + Intronic
1005402825 6:25451993-25452015 AACAGTATTCTGGGGGGGGGAGG - Intronic
1005520582 6:26597385-26597407 GTGAGGATGCTGGGGTGGGCGGG + Intronic
1006197485 6:32254850-32254872 AAGAGGATGATGGGGTGGGGTGG + Intergenic
1006304622 6:33211636-33211658 AAATGGATTCTGGGTTGGGGTGG - Intronic
1006409314 6:33863126-33863148 ACAAGGATTCTGGGGGGAGGTGG + Intergenic
1006789670 6:36691605-36691627 ATAAGGATTATGGGGTTGGTTGG - Intergenic
1007156963 6:39754234-39754256 ATAAAGATTTTGAGGTGGGCAGG - Intergenic
1007785932 6:44279293-44279315 CAAGGGCTTGTGGGGTGGGCTGG + Exonic
1007896672 6:45369168-45369190 AAAAGGAGGCTGGGGAGGTCAGG - Intronic
1008378800 6:50820388-50820410 ATTAGGATTCGGGGGGGGGCAGG - Intronic
1008629798 6:53352479-53352501 AAAAGGATTGTGGGGGGAGGCGG - Intergenic
1010203406 6:73301991-73302013 AAAAAAATTCTGGAATGGGCTGG + Intronic
1010355917 6:74933027-74933049 AAAAGAATTCTAGGTTGCGCAGG + Intergenic
1011629206 6:89308555-89308577 TAGGGGAATCTGGGGTGGGCAGG - Intronic
1011706138 6:90003277-90003299 ACAAGGAGGCTGTGGTGGGCAGG - Intronic
1015138825 6:129907032-129907054 AAAAAGATTGTGGAGGGGGCTGG + Intergenic
1015906319 6:138120967-138120989 AAAAGAATTATGGGGTAGTCCGG + Intergenic
1017092013 6:150767876-150767898 AAAAGGATTCTGTAGGAGGCAGG - Intronic
1018254381 6:161903940-161903962 AACAGGGAGCTGGGGTGGGCAGG + Intronic
1019642572 7:2112182-2112204 GAAAGCATGCTGGGGTGGCCAGG + Intronic
1021250785 7:18322892-18322914 AGGAGGATTCTGGGAAGGGCTGG + Intronic
1021494552 7:21260060-21260082 CAAATGCTTCTGCGGTGGGCAGG + Intergenic
1021920507 7:25480531-25480553 ATAAGGATTATGGGGTGAGCTGG - Intergenic
1022098895 7:27157568-27157590 GGAAGGTTTCTGGGGTAGGCCGG + Intronic
1022395614 7:29985758-29985780 AGAAGGAGTATGTGGTGGGCTGG - Intronic
1023197523 7:37657511-37657533 ACAAGGATCATGGAGTGGGCTGG - Intergenic
1023546432 7:41322775-41322797 AAAAGGAGAATGGGTTGGGCAGG + Intergenic
1026320783 7:69266086-69266108 AAAAAAATCTTGGGGTGGGCCGG - Intergenic
1026404445 7:70050658-70050680 AAAAAGAATCTGGAGTGGGATGG - Intronic
1026846463 7:73701556-73701578 AAAAGGGCTGTGGGCTGGGCAGG - Intronic
1026877839 7:73889958-73889980 GAAAGAATTCAAGGGTGGGCCGG - Intergenic
1027377441 7:77566424-77566446 TAAAGACTTCTGGGGTAGGCTGG + Intronic
1027556225 7:79668113-79668135 AAAAGCATTCTGTAGTGGGGAGG + Intergenic
1028600818 7:92598561-92598583 AAAAGGATTAATGGGAGGGCAGG - Intergenic
1028814125 7:95124842-95124864 AAAAGGCTTCTTGTGGGGGCAGG - Intronic
1028881259 7:95882567-95882589 AGAAAGATCCTTGGGTGGGCTGG + Intronic
1028985952 7:97008061-97008083 AAAAGGATTCTAGGCTGGGGTGG - Intronic
1029154865 7:98509419-98509441 AAAAAGATCCTGGGGCGGCCGGG - Intergenic
1030086199 7:105818088-105818110 AAAAGCATTCTGGTGAGTGCTGG + Intronic
1030915569 7:115308356-115308378 AAATGGATTCTGGGGTGAGGAGG + Intergenic
1030951510 7:115795941-115795963 AAGAGGAAGCGGGGGTGGGCCGG - Intergenic
1032755616 7:134888145-134888167 AAAGAGATTCTGGGCTGGGAAGG - Intronic
1033243004 7:139696279-139696301 AAAAGCAGTCTTGGCTGGGCAGG + Intronic
1038255221 8:25945095-25945117 CATAGGAGTCTGGGGTGGGGCGG - Intronic
1039107854 8:34008718-34008740 AAAAATATTCTGGGGTGGGAGGG + Intergenic
1040620178 8:49083347-49083369 AAAAAGATTCTGTGTTGGCCTGG + Intergenic
1041375033 8:57204171-57204193 GAGAGGATTGCGGGGTGGGCGGG + Intergenic
1041787466 8:61650410-61650432 GAAGGGATTGTGGAGTGGGCAGG - Intronic
1042440312 8:68818434-68818456 CAAAGGATTGTGGGGTGGTCAGG + Exonic
1042485483 8:69341766-69341788 AAATGCATTCTGGGATGTGCAGG - Intergenic
1043749275 8:83915344-83915366 AAATGGATGCTGGGGTGGTGTGG - Intergenic
1043937104 8:86155011-86155033 AACAGGACCCTGGTGTGGGCTGG - Intergenic
1047488180 8:125351712-125351734 AAAAATATTGTGGGGTTGGCCGG + Intronic
1047855063 8:128900769-128900791 AAAAGCATTTTGGGTTGGGTGGG - Intergenic
1048636669 8:136303882-136303904 AAAAGGATTCTACAGTAGGCGGG - Intergenic
1049315209 8:141962383-141962405 AAGAGGAGTCTGGGGAAGGCTGG - Intergenic
1049548106 8:143244009-143244031 AAATGGAGTCTCTGGTGGGCCGG + Intergenic
1051143946 9:14007313-14007335 AAAAGGATGCTGCAGTGGGTAGG + Intergenic
1051273948 9:15381276-15381298 AAAAGGATCCCAGGGTTGGCTGG - Intergenic
1051536977 9:18170287-18170309 AAAAGGAAGCTGGGGAAGGCTGG + Intergenic
1052812185 9:33071198-33071220 AAAAGGCTGGGGGGGTGGGCAGG + Intronic
1052832907 9:33230187-33230209 CAAAGGATCCTGGGGTGTGCTGG - Intronic
1055292287 9:74794876-74794898 AAAAAGAGTGTGGGGTGGTCAGG - Intronic
1055688333 9:78802266-78802288 AAAAGTATTCATGGCTGGGCCGG - Intergenic
1057458843 9:95240563-95240585 AAAAAAATTTTGGGGTGGGGTGG - Intronic
1057769709 9:97956902-97956924 ACAGGGATGCTGGGCTGGGCAGG + Intergenic
1057910299 9:99015203-99015225 GAAGGGACTCTGGGGTGGGTGGG + Intronic
1058547321 9:106074358-106074380 AGAAGGATTCTCTGGGGGGCAGG + Intergenic
1059470072 9:114498322-114498344 AAAAGGATAGAGGAGTGGGCAGG + Intronic
1059609575 9:115878180-115878202 GAAAGGATCCAGTGGTGGGCGGG + Intergenic
1059650686 9:116313290-116313312 AAAAGGATTCTGGGGTGGGCAGG - Intronic
1060429646 9:123539564-123539586 AAGGGGATTCTAGGGTGGGCAGG + Intronic
1060834214 9:126742845-126742867 ACAAGGATTCAGGGGTTGGTTGG - Intergenic
1061565155 9:131433741-131433763 AAAAGGATGCTGGGGTCAGCAGG - Intronic
1061888084 9:133603042-133603064 AAAGGGCACCTGGGGTGGGCAGG + Intergenic
1062180220 9:135187412-135187434 AAAGGGTCTCTGGTGTGGGCAGG + Intergenic
1062519296 9:136950979-136951001 ACAGGGAATCTGGGGTGGGAGGG + Intronic
1062544388 9:137054999-137055021 AACAGGCTTCTGGGGACGGCTGG + Intergenic
1186793581 X:13022985-13023007 AAAAGAATCCTGGGGTAGGGGGG + Intergenic
1187402928 X:18978342-18978364 AAAAGGCTGCTGGGGAGGGTAGG - Intronic
1187892558 X:23950175-23950197 AGAGGGTTTCTGGGGTGGTCAGG - Intergenic
1188007027 X:25022681-25022703 AAAAGGGATCCCGGGTGGGCTGG - Intergenic
1189495429 X:41504169-41504191 CAAAGAATCCTGGGGTGAGCTGG + Intergenic
1190726280 X:53192824-53192846 CAAGGGACTCAGGGGTGGGCGGG + Exonic
1195177944 X:102328863-102328885 CAAAGGTTGCTGGTGTGGGCGGG + Intergenic
1195180920 X:102358230-102358252 CAAAGGTTGCTGGTGTGGGCGGG - Intergenic
1201917233 Y:19195478-19195500 AATAGAATCCTGGGGTGGGCAGG + Intergenic