ID: 1059650687

View in Genome Browser
Species Human (GRCh38)
Location 9:116313294-116313316
Sequence TTGGAAAAGGATTCTGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 306}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059650687_1059650696 7 Left 1059650687 9:116313294-116313316 CCCACCCCAGAATCCTTTTCCAA 0: 1
1: 0
2: 1
3: 31
4: 306
Right 1059650696 9:116313324-116313346 TCATATGTGCAGGTGGTGAAAGG No data
1059650687_1059650697 8 Left 1059650687 9:116313294-116313316 CCCACCCCAGAATCCTTTTCCAA 0: 1
1: 0
2: 1
3: 31
4: 306
Right 1059650697 9:116313325-116313347 CATATGTGCAGGTGGTGAAAGGG No data
1059650687_1059650694 -3 Left 1059650687 9:116313294-116313316 CCCACCCCAGAATCCTTTTCCAA 0: 1
1: 0
2: 1
3: 31
4: 306
Right 1059650694 9:116313314-116313336 CAAACATGACTCATATGTGCAGG No data
1059650687_1059650698 9 Left 1059650687 9:116313294-116313316 CCCACCCCAGAATCCTTTTCCAA 0: 1
1: 0
2: 1
3: 31
4: 306
Right 1059650698 9:116313326-116313348 ATATGTGCAGGTGGTGAAAGGGG No data
1059650687_1059650695 0 Left 1059650687 9:116313294-116313316 CCCACCCCAGAATCCTTTTCCAA 0: 1
1: 0
2: 1
3: 31
4: 306
Right 1059650695 9:116313317-116313339 ACATGACTCATATGTGCAGGTGG No data
1059650687_1059650699 18 Left 1059650687 9:116313294-116313316 CCCACCCCAGAATCCTTTTCCAA 0: 1
1: 0
2: 1
3: 31
4: 306
Right 1059650699 9:116313335-116313357 GGTGGTGAAAGGGGACACTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059650687 Original CRISPR TTGGAAAAGGATTCTGGGGT GGG (reversed) Intronic
901062224 1:6476994-6477016 CTGGGAAAGGACTCGGGGGTTGG + Intronic
901596347 1:10388542-10388564 TTGGGAAAGAATGCTGGGCTTGG + Intergenic
902215659 1:14932902-14932924 TTGGAAATGGATTGTGGTGATGG - Intronic
903301646 1:22383443-22383465 TTAGAGAAGGAATCTGGGCTAGG - Intergenic
903829210 1:26164658-26164680 CTGGGAAAGGGGTCTGGGGTGGG + Intergenic
903965683 1:27087755-27087777 CTTGGAAGGGATTCTGGGGTTGG + Intergenic
903974912 1:27143225-27143247 TTGCTAAGGGATTCTGGTGTAGG - Intronic
905422124 1:37854761-37854783 TTTTAAAAGGACTCTGGGGCCGG + Intronic
908094385 1:60721666-60721688 ATGGAAAGGAAATCTGGGGTTGG + Intergenic
910586869 1:88890368-88890390 TTAGAAAAGGAATTTGGGGTGGG - Intronic
911726472 1:101246458-101246480 TTGGAAAAAGTTACTGGTGTGGG + Intergenic
913219767 1:116649981-116650003 TTTGAAATGGATCCTGAGGTAGG - Intronic
913332128 1:117676541-117676563 TTTTAATAGGATTCTGGAGTGGG - Intergenic
913333607 1:117687325-117687347 CTGGAAAAAGATCCTGGGCTAGG + Intergenic
914254278 1:145948501-145948523 TTGGAAAAGGAATCTGGCAATGG - Intronic
914398389 1:147292331-147292353 ATGCAAAAGGATTCTGATGTGGG - Intronic
915243749 1:154542027-154542049 TTGGAGAAGGCTTCTGGTGAAGG + Exonic
915729230 1:158041405-158041427 TTCAAAAAGTATTCTGGAGTTGG + Intronic
917841896 1:178986906-178986928 TGGGAAAAGGGTTGGGGGGTTGG + Intergenic
919647433 1:200109056-200109078 TTTGAAAATGATTCTGGTGCGGG - Intronic
920704167 1:208239830-208239852 TGGGAAGAGTATGCTGGGGTAGG + Intronic
920777304 1:208952322-208952344 TTGGAATAGGATTGTGGGTGGGG + Intergenic
920867971 1:209769000-209769022 ATGGAAAAGTAATTTGGGGTTGG + Intronic
920977206 1:210797464-210797486 TGGGCAAAGGTATCTGGGGTTGG - Intronic
921566242 1:216723874-216723896 TTGGGAAAGGATTCTGCGGAAGG + Intronic
922582645 1:226710143-226710165 TTGGAAAAGAAGTCTGGGGTGGG + Intronic
923215826 1:231846837-231846859 TTGAAAAAAGACTCTGGGATTGG + Intronic
923458258 1:234185170-234185192 CAGGAAAGGCATTCTGGGGTGGG + Intronic
1064195873 10:13243729-13243751 TTGGAAAAGGCTTCTAGAATGGG + Intergenic
1064455180 10:15480772-15480794 TTGGAAAAGTCTTCTGGGCCGGG - Intergenic
1066524192 10:36258500-36258522 TTGGAAGAGGAGGCTTGGGTTGG - Intergenic
1067328684 10:45293929-45293951 TTGGAAAATGATGCTGGTGGAGG - Intergenic
1067377532 10:45741667-45741689 TTGTCAAAGGACTCTGGGGCAGG - Intronic
1067885234 10:50082352-50082374 TTGTCAAAGGACTCTGGGGCAGG - Intronic
1067979898 10:51073729-51073751 TTGGGAAAGGGTTGTGGGGTAGG - Intronic
1068767145 10:60776357-60776379 TGGGGAAAGGATTCTGGAGTGGG - Intergenic
1069757503 10:70782195-70782217 TTGGGAAAGGACTCTGGGGGAGG - Intronic
1070039756 10:72764459-72764481 TTGAAAGATGATTCTGTGGTTGG + Intronic
1072572491 10:96671028-96671050 TTAGAAAATGATTCTGAAGTAGG + Intronic
1073828877 10:107358978-107359000 TAAGAATAGGATTCTGGAGTTGG + Intergenic
1074228685 10:111512643-111512665 CTGGAAAAGGGTTCTGGGTCTGG + Intergenic
1074403431 10:113161116-113161138 ATGGAGAAGGGTTCTGGGGTAGG + Intronic
1074404691 10:113170722-113170744 TTGGAGAATGATTCTGTAGTGGG - Intergenic
1074414556 10:113255875-113255897 TTGAAAAAGGATTATGTTGTAGG - Intergenic
1075079703 10:119375179-119375201 TAGGACAAGAATTCTGGGCTAGG - Intronic
1075175901 10:120160831-120160853 ATGGAAGCAGATTCTGGGGTGGG + Intergenic
1077231968 11:1461761-1461783 TTGGAAAAGGGTGTGGGGGTGGG + Intronic
1078725792 11:13929787-13929809 TGGGAAAAGCATTCAGGGGAAGG + Intergenic
1078868582 11:15322823-15322845 TTGGAAAAGAATGCTGATGTTGG + Intergenic
1079205148 11:18408481-18408503 TTGGAAAAAGATCCTGGAGTTGG - Intergenic
1080352824 11:31404873-31404895 TTTGCAAATGATTCTGGGGAAGG - Intronic
1080795242 11:35557354-35557376 TGGGAACAGGAACCTGGGGTGGG - Intergenic
1080878463 11:36297800-36297822 TTGGAAAGGGGGTCTGTGGTTGG + Intronic
1081871520 11:46384723-46384745 TTGGAAAAGGAGGCTTGGGAAGG - Intergenic
1082083275 11:48028477-48028499 TTTGTTAAGGATTCTGGGCTGGG - Intronic
1082976769 11:59080410-59080432 TTGGAAGAAGATTCAGGGCTAGG + Intergenic
1085466779 11:76729517-76729539 TTCAAACAGGATTCTGGAGTTGG - Intergenic
1086057301 11:82661826-82661848 CTTGAGAAGGATTCTGGGGCTGG + Intergenic
1086228558 11:84541392-84541414 TTGATGAAGGAATCTGGGGTTGG - Intronic
1086404031 11:86484945-86484967 TTAGAATAGAATACTGGGGTGGG + Intronic
1087127145 11:94639585-94639607 TTAGAGAAGGAATCTTGGGTGGG - Intergenic
1090475320 11:127014912-127014934 CTGGAAAAGTCTACTGGGGTTGG + Intergenic
1091612062 12:2019163-2019185 TTAGAAATGGAATCTGGGGCTGG + Intronic
1091936583 12:4439752-4439774 TTTGTACAGGATTCTGGGGAAGG - Intronic
1092296606 12:7204314-7204336 TTGGGAAAGTATTGTGGGGCTGG + Intronic
1093911219 12:24749554-24749576 CTGGAAAAGCATTCTGGCTTAGG - Intergenic
1094395050 12:29996565-29996587 TTGGGCAATGATTCTGGGGAAGG - Intergenic
1094469973 12:30794672-30794694 ATAGAAAAGGCATCTGGGGTGGG - Intergenic
1096128759 12:49140325-49140347 TTATAAAAGGAGTCTGGGGCTGG + Intergenic
1097020917 12:56020481-56020503 GTAGAAAGGGATTCAGGGGTAGG + Intronic
1097492535 12:60288788-60288810 TTTGAAAAGGTTTTTGTGGTAGG + Intergenic
1099491783 12:83297428-83297450 TTGGAAAAGGATTTTTGCATTGG - Intergenic
1099558966 12:84148840-84148862 ATGGAAAAGAAATGTGGGGTTGG + Intergenic
1100379579 12:94049142-94049164 CTGGCAAAGGACTCTGAGGTGGG - Intergenic
1100712806 12:97275856-97275878 CTGAAAAAGAAGTCTGGGGTGGG - Intergenic
1102204241 12:111079244-111079266 CTGGAAAGGGATTCTTGGGGTGG + Intronic
1103802061 12:123544643-123544665 TTCAAAAAGAATTTTGGGGTCGG - Intergenic
1104033035 12:125078967-125078989 TGGGAAAGGGATGATGGGGTGGG + Intronic
1105249211 13:18681948-18681970 TTGGAACAGGTTTTGGGGGTGGG - Intergenic
1105347847 13:19590246-19590268 TTGGAAAAGTCTCTTGGGGTGGG - Intergenic
1105624153 13:22096950-22096972 ATGGGAAAGGACACTGGGGTTGG - Intergenic
1107383021 13:39877210-39877232 TTGGAAAAGGATTCTTACCTAGG - Intergenic
1107778902 13:43878476-43878498 TTGGAAGAGCCCTCTGGGGTAGG - Intronic
1112440350 13:99420495-99420517 GAGGAAAAGGAGTGTGGGGTGGG + Intergenic
1112914482 13:104530007-104530029 TTGGCAAAGGATTTTGGAGTTGG + Intergenic
1113007013 13:105717497-105717519 TTGGAAAAGTCTCCTGGGGTCGG - Intergenic
1115159545 14:30378070-30378092 CAGGAAATGGATTCTGGGGAGGG - Intergenic
1117152242 14:52901348-52901370 TTGAGAAAGGCTTCTGGGGTGGG + Intronic
1118254139 14:64190499-64190521 TTGGAAAGGGATCCTTGGGAGGG + Intronic
1118714218 14:68547900-68547922 TTGGAAAAGGCTGCTTGGGAAGG + Intronic
1119954818 14:78785764-78785786 TTGAAATAGGATTGTGGGGTAGG - Intronic
1120496035 14:85236927-85236949 TTAATAAAGGATTATGGGGTTGG - Intergenic
1121017121 14:90555625-90555647 AAGGAAAAGGACTCTGGGTTAGG - Intronic
1121663553 14:95654159-95654181 TGGGAAGAGCATTCCGGGGTGGG - Intergenic
1121877507 14:97467036-97467058 TGGGAAAAGGATACAGGGGCAGG - Intergenic
1123702558 15:22926375-22926397 TTTAAAAAGGATTCTGGGCCAGG + Intronic
1125164958 15:36692092-36692114 TAAGAAAAGGGGTCTGGGGTGGG - Intronic
1126232909 15:46348215-46348237 TTGAAAAAACATTTTGGGGTTGG + Intergenic
1127646471 15:60964175-60964197 TGGGAAAACCATTCAGGGGTAGG - Intronic
1128979339 15:72175231-72175253 TGGGAAAAGGATTGTGGCCTGGG - Intronic
1129314946 15:74736326-74736348 TTGGAAAAGGATTCGTAAGTTGG - Intergenic
1129387757 15:75205237-75205259 TTGGAATAGGACCCTGTGGTGGG + Intronic
1129635662 15:77314250-77314272 TTGGAACAGGATTTGAGGGTGGG - Intronic
1130217846 15:81989023-81989045 TTTTAAAAGGATTATGAGGTAGG - Intergenic
1130268823 15:82432769-82432791 TTGGAGAAAGATTGTGGGGAGGG - Intronic
1131550463 15:93352496-93352518 GTGGGAAAGGCTGCTGGGGTGGG + Intergenic
1131554502 15:93385527-93385549 TTGGACATGGATGCTGGGCTGGG - Intergenic
1131766579 15:95682247-95682269 TTTGAGAAGGACTCTGGAGTCGG + Intergenic
1132022748 15:98377190-98377212 TGGGTAGAGGAATCTGGGGTTGG - Intergenic
1133431074 16:5737186-5737208 TTAAAAAAAGATTCTGGGCTGGG + Intergenic
1133682708 16:8135342-8135364 TTGGGAGAGGGTTCTGGGCTGGG - Intergenic
1135231559 16:20713041-20713063 TTGGGAAAGAATTTTGGGATTGG - Intronic
1135802796 16:25514195-25514217 GAGGAAAAGGATTCTAGAGTTGG - Intergenic
1135913483 16:26582097-26582119 GTGGAGAAGGACTCCGGGGTTGG + Intergenic
1138580258 16:57936365-57936387 TTGGACAGGGAGTCTGGGATCGG - Intronic
1139583618 16:67887188-67887210 TTGGAATAGGATCCTGGCGGTGG - Intronic
1141320388 16:83003090-83003112 TGGGGAAAGGACACTGGGGTTGG - Intronic
1141788543 16:86217586-86217608 TTTGATGAGGATTATGGGGTTGG - Intergenic
1142111504 16:88334278-88334300 TTTGAAAAAAATTCTGGGGATGG + Intergenic
1142315143 16:89339141-89339163 TGGGATATGGATTCTGGTGTTGG - Intronic
1144016125 17:11198229-11198251 TTTGGAAAGGGCTCTGGGGTGGG + Intergenic
1145091517 17:19990071-19990093 TTGAAAAATGGTTCTGGGCTGGG + Intergenic
1146026697 17:29327619-29327641 TTTGAAAAGGATTGAGGGCTGGG + Intergenic
1147020101 17:37524513-37524535 GTGCAAAAGGACTCTGGTGTAGG + Intronic
1147138970 17:38451103-38451125 CTGGGAAAGGAATGTGGGGTGGG - Intronic
1150032239 17:61751392-61751414 TTGGAAAGGGATACTGGTGATGG + Intronic
1150165544 17:62938142-62938164 ATGGAAGGGGATTCTGGAGTAGG + Intergenic
1150659925 17:67066322-67066344 TGGCAAAAGGATTGTGGGGAGGG - Intergenic
1150827195 17:68487504-68487526 TTGGAAAAGTGGTTTGGGGTCGG + Intergenic
1151708592 17:75786043-75786065 TTGGGAAACTGTTCTGGGGTTGG + Intronic
1152249264 17:79203133-79203155 TCGGGATAGGATTCTGGAGTGGG + Intronic
1152972515 18:177259-177281 TTGGAAAAAGATTCTTGGCCTGG + Intronic
1154073685 18:11178470-11178492 TAGAAAAAGTATTCTGGGGCCGG - Intergenic
1154251418 18:12748109-12748131 GTGGGAAACCATTCTGGGGTGGG - Intergenic
1154439676 18:14377282-14377304 TTGGAACAGGTTTTGGGGGTGGG + Intergenic
1155272869 18:24157875-24157897 TTGCAAAAGGAATGGGGGGTTGG - Intronic
1157311987 18:46559752-46559774 ATGGTAAAGGAGTCTTGGGTTGG - Intronic
1157660201 18:49434562-49434584 GTGGAAAAGGACTCTGGAGTGGG + Intronic
1158260827 18:55604277-55604299 TTCTCCAAGGATTCTGGGGTGGG - Intronic
1164930333 19:32170411-32170433 TGGGAAAAGGCTTCTGGGGAGGG - Intergenic
1165095813 19:33409371-33409393 TTAGAAAAGGTTTCAGGGCTGGG + Intronic
1165329171 19:35131812-35131834 TCGGAACAGGAATCTGGGGAGGG + Exonic
1165944964 19:39436450-39436472 GGGGAAAAGGATTCTGGGAGAGG - Intronic
1166344917 19:42159522-42159544 GTGGACAGGGCTTCTGGGGTGGG - Intronic
1167286384 19:48600998-48601020 TTGGACAAGGCTTCTGGCCTCGG - Exonic
1168380151 19:55913436-55913458 TTGCAAAAGGAGGCTGAGGTAGG + Intronic
926078807 2:9966660-9966682 TTTCAAAAGCATTCTGGGGCAGG - Intronic
927358427 2:22203016-22203038 TGGGAAAATGATTGTTGGGTGGG - Intergenic
927392081 2:22607104-22607126 CTGTAGAAGGAATCTGGGGTGGG - Intergenic
927736478 2:25527231-25527253 TTAGAAAAGGAGTCTGGGCACGG + Intronic
928430988 2:31218236-31218258 TAGGAGAAGGATTTGGGGGTGGG - Intronic
928954367 2:36847772-36847794 TTGAAAAAGTATTCTGGTGGTGG - Exonic
929051175 2:37838245-37838267 TTGGAAAAGGCTTGTTGGGGAGG + Intergenic
930749473 2:54919245-54919267 TTTGAAAAGGATTGGGGGGGGGG - Intronic
930867408 2:56135494-56135516 GGGGAAAAGGAGTCTGAGGTGGG - Intergenic
933249159 2:80009038-80009060 TTGGAGAAGGCATCTTGGGTGGG + Intronic
933739215 2:85520114-85520136 TTGGAAAGGGACTCTGAGGCAGG - Intergenic
934119375 2:88825286-88825308 TAAGAAAAGGAATTTGGGGTTGG - Intergenic
934515686 2:94985088-94985110 GTAGAAAAGGCATCTGGGGTTGG + Intergenic
935134570 2:100288641-100288663 TCAGAAAAGGCTTGTGGGGTTGG - Intronic
935636822 2:105255610-105255632 TTTGAAAAGCATTCTTTGGTGGG - Intergenic
935686010 2:105683411-105683433 TTGGGGAAGGGTTTTGGGGTTGG - Intergenic
936162842 2:110097809-110097831 TAAGAAAAGGAATTTGGGGTTGG - Intronic
936256942 2:110924396-110924418 TTGGAAAAAAATTCTGCTGTGGG - Intronic
937130619 2:119509741-119509763 ATGGAAATGGATACTGGGGATGG - Intronic
938632305 2:133180190-133180212 TGGGTATAGGATTCTGGGATTGG - Intronic
939076618 2:137610043-137610065 TTAGAAGAGGATGCTGGGGATGG + Intronic
939558688 2:143708429-143708451 TTGGAAAAAGATCCTGAGATGGG - Intronic
941103479 2:161324526-161324548 TTGGTAAAGGAGTCTGAAGTTGG + Intronic
943600678 2:189916991-189917013 TTGGAACAGGATTTGGGGGTGGG + Intronic
943690195 2:190861719-190861741 TAGGAAAAGGATGCTGGGCACGG + Intergenic
944106663 2:196086265-196086287 TTGATAATGGAATCTGGGGTGGG + Intergenic
945701278 2:213173951-213173973 TTGAAAAGGGATTTTGGGGATGG - Intergenic
947991109 2:234488135-234488157 TTGGAGAAGGATTTTGAGGGGGG + Intergenic
948782068 2:240327938-240327960 TTGCAACTGGATTTTGGGGTAGG - Intergenic
1169185542 20:3613994-3614016 ATGGAAAAGAATCCTGGGATTGG - Intronic
1171215310 20:23348361-23348383 TTGCTGAAGGATTCTGGGGAAGG - Intergenic
1175406029 20:58729340-58729362 ATGGAAAAGAGTTCTGTGGTTGG + Intergenic
1175599102 20:60258238-60258260 TTTGCAAAGGATTCTGAGTTGGG - Intergenic
1176456065 21:6912459-6912481 TTGGAACAGGTTTTGGGGGTGGG - Intergenic
1176591597 21:8654726-8654748 TGGGAACTGGAGTCTGGGGTGGG - Intergenic
1176834238 21:13777507-13777529 TTGGAACAGGTTTTGGGGGTGGG - Intergenic
1177855686 21:26398024-26398046 TTGGAAAGCGAATCTGGCGTGGG + Intergenic
1178418060 21:32419949-32419971 CTGGAAAAAGAATCTTGGGTTGG + Intronic
1179650449 21:42805039-42805061 TGATAAAAGGATTATGGGGTGGG + Intergenic
1181055960 22:20260603-20260625 GTGGAAGGGGCTTCTGGGGTAGG + Intronic
1181259977 22:21590823-21590845 AGGAAAAAGGAATCTGGGGTGGG - Intronic
1181718883 22:24758192-24758214 TTGGGAAAGGTTTCTGGGTAAGG - Intronic
1184814319 22:46859101-46859123 ATGGAAAAGGATTCTGGTCCCGG - Intronic
1184814344 22:46859204-46859226 ATGGAAAAGGATTCTGGTCCCGG - Intronic
1184814369 22:46859307-46859329 ATGGAAAAGGATTCTGGTCCCGG - Intronic
1184814382 22:46859358-46859380 ATGGAAAAGGATTCTGGTCCCGG - Intronic
1184814407 22:46859461-46859483 ATGGAAAAGGATTCTGGTCCCGG - Intronic
1184814420 22:46859512-46859534 ATGGAAAAGGATTCTGGCCCCGG - Intronic
1184814444 22:46859615-46859637 ATGGAAAAGGATTCTGGTCCCGG - Intronic
1184814457 22:46859666-46859688 ATGGAAAAGGATTCTGGCCCCGG - Intronic
1184814481 22:46859769-46859791 ATGGAAAAGGATTCTGGTCCCGG - Intronic
1184814494 22:46859820-46859842 ATGGAAAAGGATTCTGGCCCCGG - Intronic
1184814516 22:46859923-46859945 ATGGAAAAGGATTCTGGTCCCGG - Intronic
1184814528 22:46859974-46859996 ATGGAAAAGGATTCTGGTCCCGG - Intronic
1184814564 22:46860128-46860150 ATGGAAAAGGATTCTGGTCCCGG - Intronic
1184814577 22:46860179-46860201 ATGGAAAAGGATTCTGGCCCCGG - Intronic
1184814600 22:46860282-46860304 ATGGAAAAGGATTCTGGTCCCGG - Intronic
1184814624 22:46860385-46860407 ATGGAAAAGGATTCTGGTCCCGG - Intronic
1184814637 22:46860436-46860458 ATGGAAAAGGATTCTGGCCCCGG - Intronic
1184814649 22:46860487-46860509 ATGGAAAAGGATTCTGGTCCCGG - Intronic
1184910372 22:47528378-47528400 TTTGAAAAGGAATCTCGGCTGGG + Intergenic
949782459 3:7705337-7705359 TTAGATAATGATTGTGGGGTAGG - Intronic
951314633 3:21174219-21174241 TGGGCAAAGGATTTTTGGGTAGG - Intergenic
951613725 3:24520402-24520424 TTGGAAAAGGCTTCTGTGAAGGG - Intergenic
953470109 3:43159118-43159140 CTGGAAGACCATTCTGGGGTTGG - Intergenic
953672627 3:44975905-44975927 TTGGGAAGGGAAACTGGGGTAGG - Intronic
954140987 3:48605345-48605367 ATGGAGAAGGATTATGGGGTGGG - Intronic
954864185 3:53715070-53715092 TTGGAAAAGGATCCTGTGATAGG + Intronic
955411206 3:58656695-58656717 TAGGATAAAGACTCTGGGGTGGG - Intronic
955412900 3:58667385-58667407 TTGGGAAAAGATTCTGGATTTGG + Intergenic
955609410 3:60741165-60741187 TTGCAAGAGCATTCTGGGGTGGG + Intronic
955808832 3:62764488-62764510 GTGTAAAAGGAGTCTGTGGTTGG + Intronic
955957002 3:64301013-64301035 TTGGAATTGGATACTGGTGTTGG + Intronic
956427504 3:69152056-69152078 TTGGAAAAAGATTGTGGTGATGG - Intergenic
956916857 3:73880911-73880933 CTGGAATAAGATGCTGGGGTAGG + Intergenic
957457673 3:80472970-80472992 GTGGAAAGGGAATATGGGGTTGG + Intergenic
959592600 3:108096476-108096498 TTGGTATGGGATTGTGGGGTTGG + Intergenic
961490508 3:127253981-127254003 GTGGGATAGGATCCTGGGGTGGG - Intergenic
961731283 3:128966863-128966885 TAGAAAAAGCATTCTGGGCTGGG - Exonic
962680613 3:137796079-137796101 CAGGAAGGGGATTCTGGGGTCGG - Intergenic
962756526 3:138469227-138469249 TTGGAACTGCTTTCTGGGGTTGG + Intronic
963296676 3:143554491-143554513 TTGGAAAGGGATGCTAGGGATGG - Intronic
963779715 3:149475092-149475114 TTTAAAAAGGATTGTGGGGAAGG - Intronic
964134646 3:153330829-153330851 GGGGAAAAGTATTCTGAGGTGGG - Intergenic
964373199 3:156023040-156023062 TGAAAAAAGGATTCTGGGTTCGG + Intergenic
967512654 3:190329937-190329959 TTGAAAAAGTATGATGGGGTTGG + Intronic
967763392 3:193250840-193250862 TTGGAAAAAGGTGCGGGGGTGGG - Intronic
968186293 3:196635198-196635220 CTGGAAAAGCAGTCAGGGGTCGG + Intergenic
970185792 4:13451375-13451397 TTGGATTAGGTTTTTGGGGTGGG + Intronic
971501839 4:27326620-27326642 TTAGAAAAACATTCTGGGGTTGG + Intergenic
971880730 4:32366573-32366595 TAAGAAAAGTATTCTGGGGGAGG - Intergenic
972125880 4:35764947-35764969 TTGTAAAAGGAATGTGTGGTAGG - Intergenic
972798303 4:42445187-42445209 CTGAAAAAGGAAACTGGGGTTGG + Intronic
972874777 4:43344670-43344692 TTGGAAAAGGATCTTGAGCTGGG - Intergenic
975725678 4:77289491-77289513 TTGGGTAAGAATACTGGGGTGGG - Intronic
976904642 4:90222088-90222110 ATGGAAATGATTTCTGGGGTGGG + Intronic
977102630 4:92836640-92836662 AAGGAAAAGGATTTTGGTGTAGG + Intronic
978725906 4:111969097-111969119 TTGCCAAAGTCTTCTGGGGTGGG - Intergenic
979502976 4:121461101-121461123 TAGGAAAAGAATTCTAGGGTGGG + Intergenic
980695889 4:136354850-136354872 TTGGAACAGGATTTGGGGGTGGG + Intergenic
981099638 4:140816049-140816071 ATGAAAAAGGATACAGGGGTAGG - Intergenic
981658204 4:147136333-147136355 TTGGAAAAGGATGCTGGAGGTGG - Intergenic
981689941 4:147497290-147497312 TTAGAAAAGAATTCTGGGCCAGG - Intronic
982406849 4:155030324-155030346 ATGGAAATGGATTCTGGATTAGG - Intergenic
982512767 4:156304751-156304773 TTGGAAAAAGATGTAGGGGTGGG + Intergenic
983847983 4:172542763-172542785 GTGGAAAAGTTTTCTGGGTTGGG - Intronic
987088702 5:14491788-14491810 TTGGGAACGGATTCTGGTGTGGG - Intronic
987554362 5:19428056-19428078 CTGGAAGAAGATTCTGGAGTTGG + Intergenic
987958094 5:24766117-24766139 TTTGAAAGGGATCCTGGGCTAGG + Intergenic
988413135 5:30912208-30912230 TTGAAAAAAGATCCTGGGCTGGG - Intergenic
989348596 5:40458055-40458077 TTGGAACAGAATTATGAGGTGGG + Intergenic
989427303 5:41311363-41311385 TTGTAAAAGAATTCTAGTGTAGG - Exonic
992194749 5:74328135-74328157 TTGGAAAAGGATTTTTGTGTAGG - Intergenic
992236864 5:74719074-74719096 TAGGTAAAGACTTCTGGGGTGGG - Intronic
993532744 5:89044185-89044207 TTAAAAAAGGGTGCTGGGGTGGG - Intergenic
996336865 5:122393556-122393578 TTGTTAAATGTTTCTGGGGTAGG - Intronic
997374242 5:133385457-133385479 TTGGAAAAGGAATTCAGGGTGGG - Intronic
999187511 5:149723329-149723351 TTGGAAAAGGAGTCTAGGGGAGG - Intergenic
999876778 5:155815783-155815805 TTGGAAGAGGAGTCTGAGGAAGG - Intergenic
1000805303 5:165783186-165783208 TTTAAAAAGCATTCTGGGGATGG + Intergenic
1001253869 5:170168992-170169014 TTGAAAAAGGAAACTGGGGAAGG + Intergenic
1001823551 5:174727795-174727817 TTGGAAATGGAAGCTGGGTTGGG + Intronic
1002880932 6:1251708-1251730 CTGGGCAAGGCTTCTGGGGTAGG - Intergenic
1003787754 6:9506048-9506070 TAGGAAATAGATTGTGGGGTAGG - Intergenic
1007081623 6:39109214-39109236 TGGGAAATGGGTTCTGGGGCAGG + Intronic
1007726185 6:43917284-43917306 TTGGGTAAGGATTATGGGCTTGG - Intergenic
1009540081 6:64943544-64943566 TTGTAAATGGATTCTGGATTTGG - Intronic
1010080507 6:71856126-71856148 TAGGAAGAGGAATCTGGGGATGG - Intergenic
1010211915 6:73369044-73369066 TTGGGAGGGGATCCTGGGGTAGG - Intronic
1012714570 6:102651714-102651736 TTGGAACAGGATTTGGGGGTGGG + Intergenic
1012814447 6:104004344-104004366 GGGGAGAAGGATTCTGAGGTTGG + Intergenic
1012996249 6:105978027-105978049 TTGGGAAAGGATTCTTGAGAAGG - Intergenic
1013210523 6:107982899-107982921 CTAGAACAGGATTCTGGGGATGG + Intergenic
1015331498 6:131984892-131984914 TTGGAGAAAGTTTTTGGGGTGGG - Intergenic
1017092014 6:150767880-150767902 TTGAAAAAGGATTCTGTAGGAGG - Intronic
1017858614 6:158374664-158374686 TTGGAAAAGGATACTGCTATTGG - Intronic
1020111739 7:5451581-5451603 TGGAAAAAGCATTCTGGGGAGGG - Intronic
1023058229 7:36306705-36306727 TTGGGAAGGGTTTCTGGGTTGGG - Intergenic
1027406700 7:77870138-77870160 TAGGCAAAGAATTTTGGGGTAGG - Intronic
1028047676 7:86143067-86143089 TTGGAAAAGGTTCCAGGAGTTGG + Intergenic
1028559593 7:92159548-92159570 TTGGAAAAGACTTCTGGGAGGGG - Intronic
1031205094 7:118746433-118746455 TTGAAAAAGAATTCAGTGGTAGG + Intergenic
1031927195 7:127650264-127650286 GTGGGTAAGGAATCTGGGGTGGG - Intergenic
1033600292 7:142884277-142884299 TTGCTGAAGGATTCTGGGTTGGG - Intronic
1034070134 7:148176512-148176534 TTGAAAAAGGGCTCTGGGCTGGG - Intronic
1034730894 7:153386678-153386700 TTGGGGAAGGAGTCGGGGGTGGG + Intergenic
1035414877 7:158674583-158674605 TTGGAAAAGTTTTCTGGGCTAGG - Intronic
1036067520 8:5398768-5398790 TTAGACAAGGATTGTGGGTTTGG - Intergenic
1036133880 8:6140988-6141010 TGGGAAAAGGGTGCGGGGGTGGG + Intergenic
1036414629 8:8535578-8535600 ATGGAAAAAGAGACTGGGGTGGG + Intergenic
1039286532 8:36047764-36047786 TTAGGAAAGGATGCTGGGCTAGG - Intergenic
1042832423 8:73046377-73046399 TTGGAACAGGATTTGGGGGTGGG - Exonic
1043837649 8:85064657-85064679 TGGTAAAAGGATTATAGGGTGGG - Intergenic
1044107407 8:88227635-88227657 CTGGAAAAGGATACTAGAGTGGG - Intronic
1044871199 8:96621609-96621631 CTGGAGAAGAATTCTGAGGTTGG - Intergenic
1045225891 8:100245200-100245222 TAAGAAAAGGCTGCTGGGGTCGG - Intronic
1045906582 8:107353408-107353430 TTGGGAAAGAAATGTGGGGTGGG - Intronic
1047264067 8:123289062-123289084 TTGGAAAATTATTCTGGGACCGG + Intergenic
1049996069 9:1035240-1035262 CTTGAAAAGGATTCTGAGGCTGG - Intergenic
1050080096 9:1906985-1907007 TTTGAAATGGATGCTGTGGTTGG - Intergenic
1050080099 9:1907012-1907034 TTTGAAATGGATGCTGTGGTTGG - Intergenic
1050080102 9:1907039-1907061 TTTGAAATGGATGCTGTGGTTGG - Intergenic
1050124705 9:2344658-2344680 ATGCAAAAGGAATCTGGGGTAGG - Intergenic
1051962870 9:22789580-22789602 TTGGCAAAGAATTCTGAGATTGG + Intergenic
1055575955 9:77660440-77660462 TTGGGAAAGGAGTCTTGGGAAGG + Intergenic
1055784684 9:79860047-79860069 ATAGAAAATGAATCTGGGGTTGG - Intergenic
1059650687 9:116313294-116313316 TTGGAAAAGGATTCTGGGGTGGG - Intronic
1060169556 9:121450308-121450330 TTGGGAAACAATACTGGGGTGGG + Intergenic
1060284202 9:122234471-122234493 GTGGTTAAGGATTCCGGGGTTGG + Intergenic
1060679831 9:125552381-125552403 TTGGAAAATTATTCTGTGGAGGG - Intronic
1060834215 9:126742849-126742871 TGGTACAAGGATTCAGGGGTTGG - Intergenic
1062710086 9:137970758-137970780 TGGGAAAAGGCTGCTGGGTTGGG + Intronic
1185989172 X:4873607-4873629 TAGGAAAGGGCTTCTGGGGCAGG - Intergenic
1186156289 X:6729919-6729941 TGGGAAAAGGATACCGGGGCAGG + Intergenic
1186693113 X:12000691-12000713 TTGGAAAGACCTTCTGGGGTGGG - Intergenic
1187091318 X:16099725-16099747 TTGGCAAATGTTTCTGGGGCAGG - Intergenic
1187780937 X:22823328-22823350 TTTGAAAAGGATTCTGTAGATGG + Intergenic
1189944568 X:46164904-46164926 TTGGAAAAGGATTCTTGCCAAGG + Intergenic
1189986105 X:46554659-46554681 ATGGAAAAGGAGTCTGGGCGAGG + Intergenic
1193620582 X:83748555-83748577 TTGGAACAGGATTTGGGGGTGGG + Intergenic
1193758893 X:85441160-85441182 TTTGTCAGGGATTCTGGGGTTGG + Intergenic
1197225083 X:123948949-123948971 TCAGAAAAGGATTCTGGAGTCGG - Intergenic
1197524795 X:127547906-127547928 ATGGAAAAGAAATGTGGGGTTGG + Intergenic
1198739562 X:139826881-139826903 TTGGACAAGAATTATGGGCTTGG - Intronic
1198859135 X:141050627-141050649 TTGAAAATGTATTCTGGGCTGGG - Intergenic
1198903561 X:141536762-141536784 TTGAAAATGTATTCTGGGCTGGG + Intergenic
1198916463 X:141678139-141678161 TTGAAAATGTATTCTGGGCTGGG + Intronic
1199472537 X:148210676-148210698 GAAGCAAAGGATTCTGGGGTAGG - Intergenic
1200330422 X:155291033-155291055 CTGGAAAAGGAATCTGGAGGTGG - Intronic
1200822604 Y:7602342-7602364 TTGGAAAAGGTTACTGAGGCAGG + Intergenic
1200940691 Y:8777091-8777113 TGGGAAAAGGATTCTGGAAGAGG - Intergenic
1202046901 Y:20744578-20744600 TTGGAAAAGACTTCTGGGCTGGG - Intergenic
1202237699 Y:22731675-22731697 TTGGAAAAGGTTACTGAGGCAGG - Intergenic