ID: 1059650688

View in Genome Browser
Species Human (GRCh38)
Location 9:116313295-116313317
Sequence TTTGGAAAAGGATTCTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 287}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059650688_1059650697 7 Left 1059650688 9:116313295-116313317 CCACCCCAGAATCCTTTTCCAAA 0: 1
1: 0
2: 3
3: 28
4: 287
Right 1059650697 9:116313325-116313347 CATATGTGCAGGTGGTGAAAGGG No data
1059650688_1059650694 -4 Left 1059650688 9:116313295-116313317 CCACCCCAGAATCCTTTTCCAAA 0: 1
1: 0
2: 3
3: 28
4: 287
Right 1059650694 9:116313314-116313336 CAAACATGACTCATATGTGCAGG No data
1059650688_1059650696 6 Left 1059650688 9:116313295-116313317 CCACCCCAGAATCCTTTTCCAAA 0: 1
1: 0
2: 3
3: 28
4: 287
Right 1059650696 9:116313324-116313346 TCATATGTGCAGGTGGTGAAAGG No data
1059650688_1059650695 -1 Left 1059650688 9:116313295-116313317 CCACCCCAGAATCCTTTTCCAAA 0: 1
1: 0
2: 3
3: 28
4: 287
Right 1059650695 9:116313317-116313339 ACATGACTCATATGTGCAGGTGG No data
1059650688_1059650698 8 Left 1059650688 9:116313295-116313317 CCACCCCAGAATCCTTTTCCAAA 0: 1
1: 0
2: 3
3: 28
4: 287
Right 1059650698 9:116313326-116313348 ATATGTGCAGGTGGTGAAAGGGG No data
1059650688_1059650699 17 Left 1059650688 9:116313295-116313317 CCACCCCAGAATCCTTTTCCAAA 0: 1
1: 0
2: 3
3: 28
4: 287
Right 1059650699 9:116313335-116313357 GGTGGTGAAAGGGGACACTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059650688 Original CRISPR TTTGGAAAAGGATTCTGGGG TGG (reversed) Intronic
900091380 1:922221-922243 TTTGGAGAGGGAGGCTGGGGAGG - Intergenic
901193829 1:7428605-7428627 TTTAGAATAGGACTCAGGGGAGG - Intronic
903494943 1:23759587-23759609 CTTGGAAATGGAATCTGGGGAGG + Exonic
906295895 1:44648940-44648962 TCTGGAAAAGGCTTCTGGGAGGG + Intronic
910355095 1:86344177-86344199 TCTGGGAAAGGGTTGTGGGGAGG - Intergenic
910586870 1:88890369-88890391 ATTAGAAAAGGAATTTGGGGTGG - Intronic
914742515 1:150477146-150477168 TTTGGAAAGGGATAATGGGTCGG + Intergenic
916710756 1:167405179-167405201 TTTGGAAAATGAATTGGGGGCGG - Intronic
917191820 1:172426197-172426219 TTTGGAAAAGGATGCAGGGGAGG - Intronic
917955560 1:180093666-180093688 TTTGCTAAAGGATTTTGGGCCGG + Exonic
919647434 1:200109057-200109079 TTTTGAAAATGATTCTGGTGCGG - Intronic
920221857 1:204410217-204410239 TATGGAAAAGGAGCCTGGAGAGG - Exonic
920518026 1:206601067-206601089 TGTAGGATAGGATTCTGGGGTGG - Intronic
920689122 1:208132282-208132304 TTAGGAAAAGGGTTCAGAGGCGG - Intronic
920777303 1:208952321-208952343 ATTGGAATAGGATTGTGGGTGGG + Intergenic
921379823 1:214513024-214513046 TTTGGACCAGGATTCTTGGTGGG - Intronic
922582644 1:226710142-226710164 ATTGGAAAAGAAGTCTGGGGTGG + Intronic
922755122 1:228092150-228092172 TTTGAAAAAGAACTCTGGGTGGG + Intronic
923318332 1:232804138-232804160 TTTGGAAATGTATCATGGGGAGG - Intergenic
1063349781 10:5343472-5343494 TTTGGAGAAGGATTTTAGGGGGG + Intergenic
1064195872 10:13243728-13243750 TTTGGAAAAGGCTTCTAGAATGG + Intergenic
1064455181 10:15480773-15480795 CTTGGAAAAGTCTTCTGGGCCGG - Intergenic
1067106533 10:43370690-43370712 TTTGGAAAAGAATTAAGGAGGGG + Intergenic
1068584067 10:58776818-58776840 TAAGGAAGAGGATTCTGGGAAGG - Intronic
1068767146 10:60776358-60776380 CTGGGGAAAGGATTCTGGAGTGG - Intergenic
1069786746 10:70993118-70993140 TTGGAAGAAGGATTCTGGGAAGG - Intergenic
1070841127 10:79488532-79488554 TGTGGCCAAGGATTCTGGGAGGG + Intergenic
1071144479 10:82551723-82551745 TTGGGACAGGGATTCTGGGCTGG - Intronic
1072063364 10:91839357-91839379 TTTGGAGATGGAGTCTGGGTTGG + Intronic
1074477884 10:113789267-113789289 TTTGGAAAAAGCTTCAAGGGAGG + Intergenic
1075080016 10:119377143-119377165 TTTGGAGAAAGATTGTGGGCAGG + Intronic
1077231967 11:1461760-1461782 TTTGGAAAAGGGTGTGGGGGTGG + Intronic
1079320401 11:19447157-19447179 TTTGGAAAAGGATTCAGGTTAGG - Intronic
1080416049 11:32070811-32070833 TTTGCAAAAGGAGACTGGGAGGG - Intronic
1081459873 11:43262580-43262602 TTTGGACAAGGTGCCTGGGGTGG - Intergenic
1082083276 11:48028478-48028500 TTTTGTTAAGGATTCTGGGCTGG - Intronic
1083855477 11:65391005-65391027 GGGGGAAAAGGGTTCTGGGGGGG - Intronic
1084973565 11:72784256-72784278 TCTGGGAGAGGAGTCTGGGGAGG + Intronic
1085038471 11:73313358-73313380 TATGGGAAAGGAGGCTGGGGAGG - Intronic
1086646253 11:89224571-89224593 TTTGGAAAAGTATGCTTGGAAGG - Intronic
1089206139 11:116764629-116764651 TTTGGAAAAGAATTCTGATTAGG + Intronic
1090014172 11:123071135-123071157 TTTTAAAAAGTATTCTGGGCCGG + Exonic
1090033208 11:123225442-123225464 TTTGGAAAACCATTCTGGGAGGG + Intergenic
1093198167 12:16153811-16153833 TTTTGAAAAAAATTCTGGGGGGG + Intergenic
1093397081 12:18695700-18695722 TTTGGAATAAGAGTCTGGTGAGG + Intronic
1094586177 12:31779397-31779419 TCTGGAATTGGACTCTGGGGTGG + Intergenic
1094858937 12:34437197-34437219 TCTGAAAAAGGACTCTTGGGAGG - Intergenic
1095390296 12:41698107-41698129 CTTGGAAATGGATTTTTGGGGGG - Intergenic
1096038127 12:48490859-48490881 TTTGGAAAAGGAAACAAGGGAGG + Intronic
1096633609 12:52945126-52945148 AAAGGAAAAGGAATCTGGGGTGG - Intronic
1099712053 12:86240650-86240672 TTTGGAAAGAGAGTCAGGGGAGG - Intronic
1101025052 12:100594329-100594351 TTTGGGAAATTATTATGGGGAGG + Intronic
1101806474 12:108068580-108068602 TTTAAAAAAGGATTTTGGTGGGG + Intergenic
1102157750 12:110744063-110744085 TTTGGAAGAGGATGCCTGGGTGG - Intergenic
1103263321 12:119608404-119608426 TGTGGACAAGAAATCTGGGGGGG - Intronic
1104147878 12:126053294-126053316 TTTGGAAAAGGGGTATGTGGTGG + Intergenic
1106992901 13:35444671-35444693 TTTGGAAAAAGATCTTTGGGAGG - Intronic
1107152249 13:37125409-37125431 TTCTGCAAAGGTTTCTGGGGTGG - Intergenic
1107210356 13:37846052-37846074 TTTGGTAAAGTATTCTTGGTTGG - Intronic
1108773001 13:53728384-53728406 TTTGGAACATGGTTCTCGGGGGG + Intergenic
1109046687 13:57421933-57421955 TTTGGCAATGGATGCGGGGGTGG + Intergenic
1109297665 13:60553816-60553838 TTTGGGAAAAGATTTTGGTGGGG + Intronic
1109374674 13:61476344-61476366 TATGGAAAGGGAATCTGTGGGGG + Intergenic
1110187738 13:72694406-72694428 TTTGGAGAGGAATTCTGAGGAGG - Intergenic
1111301389 13:86355296-86355318 TTAGGAGATGGATTTTGGGGAGG - Intergenic
1115026589 14:28754468-28754490 TTTGGAAAAAATTTTTGGGGAGG - Intergenic
1115159546 14:30378071-30378093 GCAGGAAATGGATTCTGGGGAGG - Intergenic
1115846515 14:37541552-37541574 TTTGAAAAAGGATTTTTAGGTGG - Intronic
1117152241 14:52901347-52901369 CTTGAGAAAGGCTTCTGGGGTGG + Intronic
1118254138 14:64190498-64190520 TTTGGAAAGGGATCCTTGGGAGG + Intronic
1118476856 14:66125693-66125715 TTTGGAAACTGCATCTGGGGAGG - Intergenic
1118805326 14:69231591-69231613 TTCTGATAAGGAGTCTGGGGTGG - Intronic
1118902283 14:69996585-69996607 TTGAGAAATGGATTCTGGGCAGG + Intronic
1121346311 14:93138213-93138235 TCTGGAAGAGCATTCTGGTGGGG + Intergenic
1123784948 15:23662194-23662216 TTTGGAAAGGACTTCTGGGTTGG - Intergenic
1123936054 15:25194594-25194616 CTTGGAGAAGGATCCTGGGCAGG + Intergenic
1124363542 15:29055372-29055394 TTTGGAAAAGGATTTTTTGAAGG + Intronic
1124962889 15:34411132-34411154 TTTGGAAAAGGATTTTTTGACGG + Intronic
1124979512 15:34557354-34557376 TTTGGAAAAGGATTTTTTGACGG + Intronic
1125732839 15:41903714-41903736 TTTGGAAGGGGATTCCTGGGTGG + Intronic
1126674959 15:51153089-51153111 TTTGGCAAATGATTCTGGTAGGG + Intergenic
1126693557 15:51307043-51307065 TTTGGAAAAGCAATCAGTGGTGG + Intronic
1126853933 15:52819015-52819037 TTTGGAAAATGATTCAGAAGTGG + Intergenic
1126861914 15:52893303-52893325 ATAGGAAAAGGATGCTGAGGGGG - Intergenic
1127558640 15:60113570-60113592 TTTGAAAAAGAAATCTTGGGAGG + Intergenic
1128317602 15:66671074-66671096 TCAGGAAAAGGACTCAGGGGAGG - Intronic
1128609866 15:69064962-69064984 TTTGGAGAAGGATGCAGGGAGGG - Intergenic
1129465787 15:75723528-75723550 CCTGGGATAGGATTCTGGGGAGG + Intergenic
1130268824 15:82432770-82432792 GTTGGAGAAAGATTGTGGGGAGG - Intronic
1130509169 15:84574153-84574175 CTTGGCAATGGAGTCTGGGGTGG - Intergenic
1130959307 15:88649193-88649215 TTGGGACAAAGATTCTGGGAAGG - Intronic
1132329620 15:101003199-101003221 CTTGGAAATGGTTTCTGGGCTGG - Intronic
1133431073 16:5737185-5737207 TTTAAAAAAAGATTCTGGGCTGG + Intergenic
1133682709 16:8135343-8135365 TTTGGGAGAGGGTTCTGGGCTGG - Intergenic
1135823481 16:25705367-25705389 TTTTGAAAAGGAAGCTGGGCTGG + Intronic
1137917950 16:52453478-52453500 TTTTAAAAAGCATTCTGGGCCGG - Intronic
1141550674 16:84804675-84804697 TTTGGAAAAAGAATCTGGCTGGG + Intergenic
1142470136 17:158585-158607 TGTTGAAAAGGATTCTGAGGTGG - Intronic
1142880844 17:2881627-2881649 TTTGGAAATGTTTTCTGGAGTGG + Intronic
1145943372 17:28755826-28755848 TTTGGAGACGGCTTCTGGGTGGG + Intergenic
1145995350 17:29101940-29101962 TTTCAATAAGGACTCTGGGGGGG - Intronic
1147138971 17:38451104-38451126 TCTGGGAAAGGAATGTGGGGTGG - Intronic
1147503721 17:40992579-40992601 TTTGGAAAGTTATTCTGGAGAGG - Intergenic
1147570502 17:41567670-41567692 TATGGAAGAGGATCCAGGGGAGG - Exonic
1150191374 17:63244088-63244110 GGTGGAAAAGGATTCTCTGGTGG + Intronic
1150486054 17:65544542-65544564 TTTGGAAGAAGATTCTTGGCTGG - Intronic
1150659926 17:67066323-67066345 TTGGCAAAAGGATTGTGGGGAGG - Intergenic
1150768728 17:68023584-68023606 GTTGGAAAGGGTTTCAGGGGAGG - Intergenic
1151200627 17:72465273-72465295 TTTGGAGCAGGATTTTGTGGAGG + Intergenic
1152222441 17:79075973-79075995 TTTGGAAAAGGAAGGTGGAGAGG + Intronic
1154966506 18:21362946-21362968 TTTACAAGAGGATTCTGGGAAGG - Intronic
1157660200 18:49434561-49434583 TGTGGAAAAGGACTCTGGAGTGG + Intronic
1158260828 18:55604278-55604300 TTTCTCCAAGGATTCTGGGGTGG - Intronic
1161115744 19:2495586-2495608 TTTGGTCCAGGATTTTGGGGAGG + Intergenic
1162361546 19:10223594-10223616 TTTAGAACTGGATCCTGGGGAGG - Intronic
1164930334 19:32170412-32170434 GTGGGAAAAGGCTTCTGGGGAGG - Intergenic
1165095812 19:33409370-33409392 TTTAGAAAAGGTTTCAGGGCTGG + Intronic
1165329170 19:35131811-35131833 CTCGGAACAGGAATCTGGGGAGG + Exonic
1166089357 19:40498064-40498086 TTTGGAAATGGATTAGGGTGGGG - Intronic
1167906793 19:52667519-52667541 TTGGTAAAAGGATTATAGGGAGG + Intronic
926097339 2:10090587-10090609 TTTGGATAAGTATTCTTGAGTGG - Intergenic
926371754 2:12185818-12185840 TTTGGAAAAGGATTTGATGGTGG + Intergenic
927392082 2:22607105-22607127 TCTGTAGAAGGAATCTGGGGTGG - Intergenic
927790057 2:26002723-26002745 TGAGGAAAAGGAGTCTGGAGGGG + Intergenic
928166884 2:28978239-28978261 TATGGGAAAGGCTTTTGGGGTGG + Intronic
928727129 2:34187349-34187371 TTTGGAAGTTGATTGTGGGGTGG + Intergenic
930749474 2:54919246-54919268 TTTTGAAAAGGATTGGGGGGGGG - Intronic
930867409 2:56135495-56135517 TGGGGAAAAGGAGTCTGAGGTGG - Intergenic
931913364 2:66926322-66926344 TGTGGATAAGGAATCTGGGCTGG - Intergenic
934154360 2:89182104-89182126 TAAGGAAAAGGATTATGAGGAGG - Intergenic
934212871 2:89999836-89999858 TGAGGAAAAGGATTATGAGGAGG + Intergenic
935006978 2:99088855-99088877 TTTAAAAAAGGATTGTGGTGGGG + Intronic
935881352 2:107569143-107569165 GTTGGAAAAGGAAACTGGGATGG - Intergenic
936256943 2:110924397-110924419 TTTGGAAAAAAATTCTGCTGTGG - Intronic
937585292 2:123539989-123540011 TTTAAAAAAAGATACTGGGGAGG - Intergenic
938586459 2:132695388-132695410 ATGGGAAAAGCAATCTGGGGAGG + Intronic
939558689 2:143708430-143708452 TTTGGAAAAAGATCCTGAGATGG - Intronic
940575491 2:155498323-155498345 TCTGGAAATGGAGTCTGTGGTGG + Intergenic
942719099 2:178929282-178929304 TTTGGTGAAGGAATTTGGGGAGG + Intronic
943097467 2:183447705-183447727 TTGGGAAAAGTATTCTGAGGAGG + Intergenic
943181763 2:184553141-184553163 TTTGAGAAAGGATTTGGGGGGGG - Intergenic
943600677 2:189916990-189917012 ATTGGAACAGGATTTGGGGGTGG + Intronic
944673411 2:202015303-202015325 TTTGGAATAGGCTTCTGTTGGGG - Intergenic
945634417 2:212330001-212330023 TTTGGAAAAGGTTACTGGGGTGG - Intronic
945775000 2:214095308-214095330 TGGAGAAAAGGTTTCTGGGGGGG - Intronic
947991108 2:234488134-234488156 GTTGGAGAAGGATTTTGAGGGGG + Intergenic
1169099987 20:2939276-2939298 ATTGGGAAAGGATTATGGTGAGG - Intronic
1169577093 20:6976010-6976032 TTTGGCAAAGGATTCTGTTGGGG + Intergenic
1170124573 20:12949205-12949227 TTTAGAAAAGTTTTATGGGGTGG - Intergenic
1172935952 20:38620409-38620431 TTTGGAAGAACATTCTGAGGAGG - Intronic
1174000288 20:47369649-47369671 TTTGGGAAATGAGTCTGGGAAGG - Intergenic
1174122839 20:48279764-48279786 TGTGGAAAAGGGTTCTGAGTGGG - Intergenic
1175162064 20:57015892-57015914 TTTGGGACAGGATGTTGGGGAGG + Intergenic
1175599103 20:60258239-60258261 TTTTGCAAAGGATTCTGAGTTGG - Intergenic
1176239117 20:64067795-64067817 TACGGGAAAGGGTTCTGGGGAGG + Intronic
1177021288 21:15861498-15861520 TCTAGAACAGGATTCTGAGGAGG + Intronic
1177656211 21:24020404-24020426 TGTGGAAGAGGAATGTGGGGGGG + Intergenic
1177820626 21:26027469-26027491 TTAGGAAAATGTTTCCGGGGAGG + Intronic
1181287404 22:21763908-21763930 TGTAGAAAAGGATTCAGGAGAGG + Exonic
1182044350 22:27262633-27262655 TCTGGAAAATGATCCTGGGATGG + Intergenic
1182273240 22:29169109-29169131 ATTGGAAAAGGTTTATGGGGTGG - Intergenic
1183200836 22:36385120-36385142 TTTGGAACATGATGCTTGGGAGG + Intronic
1184910371 22:47528377-47528399 TTTTGAAAAGGAATCTCGGCTGG + Intergenic
950009951 3:9715922-9715944 TTTGGAAAAGGCAGTTGGGGTGG - Intronic
950152290 3:10697119-10697141 TTTGTAATAGGATTCAGGGTGGG - Intronic
951507411 3:23463347-23463369 TTAGGAAGAGGAATCTGGGCCGG + Intronic
951613726 3:24520403-24520425 GTTGGAAAAGGCTTCTGTGAAGG - Intergenic
951690360 3:25389129-25389151 TGTGGAAGAGGTTTCTGGGGAGG + Intronic
952669181 3:35945695-35945717 TTTTGAAAAGGAGGGTGGGGAGG + Intergenic
953432924 3:42854474-42854496 TTTTGAAAGGGAGTGTGGGGGGG + Intronic
953518405 3:43619181-43619203 TTTGGATATGAATTCAGGGGAGG + Intronic
953834030 3:46327790-46327812 TTTGCAAATTGATTTTGGGGGGG + Intergenic
954140988 3:48605346-48605368 CATGGAGAAGGATTATGGGGTGG - Intronic
954578214 3:51688513-51688535 TTTTGAAAAAGATTCTGGACGGG - Intronic
955411207 3:58656696-58656718 TTAGGATAAAGACTCTGGGGTGG - Intronic
955560477 3:60183695-60183717 GTTTTAAAGGGATTCTGGGGAGG - Intronic
955609409 3:60741164-60741186 TTTGCAAGAGCATTCTGGGGTGG + Intronic
955923004 3:63977663-63977685 TCTGGAAATGGATTAGGGGGTGG + Intronic
955933040 3:64077129-64077151 TTTGGGAAGTGATTCCGGGGAGG + Intergenic
956263358 3:67369822-67369844 TATGGAAATGGCTTCTGGGTAGG - Intronic
957604582 3:82380910-82380932 TTTGGAAATGCAATCTGGGCAGG - Intergenic
957739699 3:84248667-84248689 TTTCAAACATGATTCTGGGGCGG - Intergenic
958716442 3:97788459-97788481 TTTGGAAAATGATTCAAAGGAGG - Intronic
959655225 3:108796405-108796427 TTTGGAAGTGGAGACTGGGGAGG + Intergenic
960289015 3:115861459-115861481 TGTTGAGAAGGATTCTGAGGCGG + Intronic
960311705 3:116124604-116124626 TTGGGAAAACGTTTCTGGGCAGG + Intronic
961778209 3:129305307-129305329 TTTGGAAAGTGATGCTGGTGGGG + Exonic
962217272 3:133533439-133533461 TTTGGTAGGGGGTTCTGGGGAGG + Intergenic
963727754 3:148940850-148940872 ATGGAAAAAGGACTCTGGGGAGG + Intergenic
964134647 3:153330830-153330852 TGGGGAAAAGTATTCTGAGGTGG - Intergenic
968881145 4:3300856-3300878 TTTGGAAAAGGATTATGTTAAGG - Intronic
969006812 4:4026852-4026874 TTTGGAAAAATATTCAAGGGAGG + Intergenic
969038641 4:4276419-4276441 TTAGAAAATGGATACTGGGGAGG + Intronic
971684199 4:29743731-29743753 TATGGAAAAGGGGTGTGGGGCGG - Intergenic
973869738 4:55154196-55154218 TTTGAAAAAGGATTAGGGAGAGG - Intergenic
975039582 4:69728775-69728797 TGTGGCAAAAGTTTCTGGGGAGG - Intronic
975327193 4:73072000-73072022 TTTCAAAAAAGAATCTGGGGAGG - Intergenic
975660992 4:76689238-76689260 TTTGAAAACGGATTCTGGGGTGG - Intronic
977741897 4:100494590-100494612 TTTGAGAAGGGATTCTGGAGTGG - Intronic
978078800 4:104567479-104567501 TTTGGAAAAGGTTTTTGTGTTGG + Intergenic
978267767 4:106846991-106847013 TTTGGCAAAGTATTGTGGGAAGG - Intergenic
978294007 4:107181798-107181820 TTTGGAAACGGGTCCTTGGGAGG + Intronic
979072009 4:116219927-116219949 TTTGGAAAACGTTTGTGTGGAGG - Intergenic
979483330 4:121243094-121243116 TTTGGTAAATGCTTCTGTGGGGG + Intergenic
979502975 4:121461100-121461122 CTAGGAAAAGAATTCTAGGGTGG + Intergenic
980695888 4:136354849-136354871 ATTGGAACAGGATTTGGGGGTGG + Intergenic
980734342 4:136865812-136865834 TTTGATTAAGGATTCAGGGGTGG - Intergenic
982512766 4:156304750-156304772 TTTGGAAAAAGATGTAGGGGTGG + Intergenic
983847984 4:172542764-172542786 TGTGGAAAAGTTTTCTGGGTTGG - Intronic
984739699 4:183149188-183149210 ACTGTAAAAGGCTTCTGGGGTGG - Intronic
985142546 4:186857091-186857113 TATGGTAATGGATGCTGGGGAGG + Intergenic
985171813 4:187158075-187158097 TTTGGATAAGGATTGAGGGATGG + Intergenic
985580276 5:692498-692520 TTTTGATAAGGGTTTTGGGGGGG - Intronic
986166749 5:5279282-5279304 TAGAGAACAGGATTCTGGGGTGG + Intronic
987088703 5:14491789-14491811 TTTGGGAACGGATTCTGGTGTGG - Intronic
988337812 5:29928799-29928821 TTTGGAGAAGATTTCTGGGTCGG - Intergenic
988692894 5:33590451-33590473 CTTGGAAAAGGATTTGGGAGTGG + Intronic
990238880 5:53797419-53797441 TTTTGAAAAGGGTTGGGGGGAGG - Intergenic
991599562 5:68339036-68339058 TTTGGAAATGAATTCTAGAGTGG + Intergenic
992013964 5:72557341-72557363 GTTAGAAAAGGCTTCAGGGGAGG - Intergenic
992667171 5:79021818-79021840 TGTGGAAAAGGACTTTGTGGGGG + Intronic
992823163 5:80518874-80518896 TTTGGAGATGGATACTGGAGGGG - Intronic
993532745 5:89044186-89044208 TTTAAAAAAGGGTGCTGGGGTGG - Intergenic
995474792 5:112536932-112536954 GTTGGCACAGCATTCTGGGGTGG + Intergenic
996407008 5:123115325-123115347 CTTGGAGAAGGATTCTGGTATGG - Intronic
996642555 5:125774234-125774256 TTTGTAAAAGTGATCTGGGGAGG + Intergenic
996672795 5:126137974-126137996 TTTGGCTAAGGATTCTGTGTTGG - Intergenic
997424116 5:133791638-133791660 TTTGGTAAGAGGTTCTGGGGAGG - Intergenic
997908548 5:137844957-137844979 TGTAGGAAAGGGTTCTGGGGAGG + Intergenic
998905694 5:146902191-146902213 TTTGGAAAAGGAATGGGGAGAGG - Intronic
1001263974 5:170258351-170258373 TTTGTAAATGGATTCTATGGTGG - Intronic
1002564569 5:180102840-180102862 TCTTGAAAAGGATTCGTGGGAGG - Intronic
1004417498 6:15438077-15438099 TTTGGAAATGGGTTGTGGGGTGG + Intronic
1007373981 6:41443925-41443947 TGTGGAGAGGGATTCTGGGCAGG - Intergenic
1007436747 6:41818574-41818596 TTGGGGACAGGATCCTGGGGTGG - Intronic
1007822341 6:44569978-44570000 TTTGGAATCTGATGCTGGGGAGG + Intergenic
1008063768 6:47026256-47026278 TTGGGAGAGTGATTCTGGGGAGG - Intronic
1008362397 6:50636204-50636226 TATGGAAAAGAAGTCTGGGGTGG - Intergenic
1008642851 6:53482667-53482689 TTTGGAAATGCATCCTGGGGGGG + Intergenic
1009518316 6:64648744-64648766 TTTAGGAATGGATTCTGGAGGGG + Intronic
1009635665 6:66261473-66261495 TTTGTAAAAGGATTATAAGGAGG + Intergenic
1011053249 6:83177426-83177448 TTTGGAGAGGTTTTCTGGGGTGG - Intronic
1012476856 6:99623082-99623104 TTTGGCAAAGGATCCTTGGGAGG + Intergenic
1012714569 6:102651713-102651735 ATTGGAACAGGATTTGGGGGTGG + Intergenic
1015331499 6:131984893-131984915 TTTGGAGAAAGTTTTTGGGGTGG - Intergenic
1015671440 6:135694500-135694522 TTTCAAAAAGGAGGCTGGGGTGG + Intergenic
1015718712 6:136218193-136218215 TTTGGAAGAGGATACTGATGGGG - Intergenic
1016754832 6:147673551-147673573 TTTGGAAAATGATACTTGTGCGG + Intronic
1017493377 6:154963530-154963552 TTTGGATAATGCTTCTGTGGAGG - Intronic
1018688360 6:166321701-166321723 TTTAGAAAAAGATTCTGGTGAGG - Intronic
1020111740 7:5451582-5451604 CTGGAAAAAGCATTCTGGGGAGG - Intronic
1021273103 7:18616450-18616472 TCTAGAAAAGGATTCAGGGGAGG + Intronic
1022198155 7:28089582-28089604 TTTGGAAGGTGATTCTGGTGAGG + Intronic
1022387768 7:29917519-29917541 TTGGGAACAGGGTTCAGGGGAGG + Intergenic
1022537728 7:31108200-31108222 TTGGGAAAATGTTTCTGGAGAGG + Exonic
1023334732 7:39156815-39156837 TCAGGAAAAGGAAGCTGGGGAGG + Intronic
1024122494 7:46259026-46259048 TTTAGATAATTATTCTGGGGAGG + Intergenic
1024410384 7:49034010-49034032 CTTGGAAAAGGAGGTTGGGGAGG + Intergenic
1027844956 7:83361141-83361163 TTTGGAGATGGAGTTTGGGGAGG - Intergenic
1028356899 7:89921452-89921474 TTAGGTATAGGATTCTGGGTTGG - Intergenic
1028559594 7:92159549-92159571 GTTGGAAAAGACTTCTGGGAGGG - Intronic
1029116113 7:98238128-98238150 CATGGAAAAGGTTTCTGGGTAGG + Intronic
1030335938 7:108325938-108325960 TTGGGGAAAGGAATCTGAGGGGG + Intronic
1030901977 7:115135977-115135999 TTTTGAAAAGGATCCTGTGAAGG - Intergenic
1031927196 7:127650265-127650287 TGTGGGTAAGGAATCTGGGGTGG - Intergenic
1033600293 7:142884278-142884300 TTTGCTGAAGGATTCTGGGTTGG - Intronic
1033723034 7:144082193-144082215 CTTGGAAAATGACTCTTGGGAGG + Intergenic
1034070135 7:148176513-148176535 TTTGAAAAAGGGCTCTGGGCTGG - Intronic
1035602567 8:905452-905474 TTTGAAAAAGGGCTGTGGGGGGG - Intergenic
1035866260 8:3085771-3085793 TCTGGAAACGGATTATGAGGTGG - Intronic
1036559400 8:9888842-9888864 TTTGGAATAGGAGCCTGTGGAGG + Intergenic
1037575155 8:20196022-20196044 TTTTGAAAAGAATTCAGTGGAGG - Intergenic
1038334484 8:26635234-26635256 TGTGACCAAGGATTCTGGGGCGG - Intronic
1040673502 8:49721006-49721028 TTTGGAAATGGGTTCTGTAGAGG + Intergenic
1042440311 8:68818429-68818451 CCTGGCAAAGGATTGTGGGGTGG + Exonic
1042832424 8:73046378-73046400 ATTGGAACAGGATTTGGGGGTGG - Exonic
1042903455 8:73749738-73749760 TTTTGGAAAGAACTCTGGGGTGG + Intronic
1049833705 8:144719153-144719175 TTTGAAAAAAGATTCTTGGCCGG + Intergenic
1050694983 9:8268762-8268784 TTTTGAGAAGGATTCTGAGAAGG + Intergenic
1052066282 9:24024875-24024897 TTTTGAAATGGATTCTAGTGAGG + Intergenic
1052673495 9:31588382-31588404 TTTGGATAAGGATTTTGCAGAGG + Intergenic
1052986565 9:34492191-34492213 TGTGGAATAGGAGACTGGGGGGG + Intronic
1058523087 9:105831443-105831465 TCTGGCACAGGCTTCTGGGGAGG + Intergenic
1058568633 9:106315063-106315085 TATAGAAAAGGAATTTGGGGAGG - Intergenic
1059209128 9:112495332-112495354 TTTGGAGAAGGTTTCTGTGATGG + Intronic
1059650688 9:116313295-116313317 TTTGGAAAAGGATTCTGGGGTGG - Intronic
1060438487 9:123616750-123616772 TTTTCAAAAGGCTCCTGGGGAGG + Intronic
1060679832 9:125552382-125552404 ATTGGAAAATTATTCTGTGGAGG - Intronic
1060924652 9:127447777-127447799 TTTGGAAATGGTTACTGGTGGGG - Intronic
1061648040 9:132022257-132022279 AATGGATAAGGATTCTGGGGTGG - Intronic
1062721635 9:138047257-138047279 TGTGGAAAACGGTTCTGGGAAGG - Intronic
1187034012 X:15518671-15518693 TTTGGGGAGGGATTTTGGGGGGG + Intronic
1189283451 X:39835420-39835442 TGTGGGAAAGGACTCTGGGCAGG - Intergenic
1189295030 X:39911952-39911974 TTTGGGAATGGCTTCTGAGGAGG + Intergenic
1190114492 X:47617718-47617740 TTAAGAAAACAATTCTGGGGAGG + Intronic
1192368685 X:70496087-70496109 TCTGGAAAAGAATCCTGGAGTGG + Intronic
1192418789 X:71009876-71009898 TTTTGAAAAGCATACTGAGGAGG - Intergenic
1192594621 X:72393670-72393692 TTGGGAAAAGGAGGATGGGGAGG + Intronic
1193154741 X:78159968-78159990 CTTGGAAAAACATTTTGGGGGGG + Intergenic
1193368742 X:80666795-80666817 TTTGCAGAAGGATTCTTGGTGGG - Intergenic
1193620581 X:83748554-83748576 ATTGGAACAGGATTTGGGGGTGG + Intergenic
1194777592 X:97984023-97984045 TTTGGAGCTGGATTGTGGGGTGG - Intergenic
1195069374 X:101264335-101264357 TTGGGGAAAGGATTTGGGGGAGG + Exonic
1197334013 X:125189299-125189321 TTTGGAAATGAATTCTTGAGTGG - Intergenic
1198035442 X:132797061-132797083 TTAGCAAGAGGATTCTGGGAAGG + Intronic
1198859136 X:141050628-141050650 TTTGAAAATGTATTCTGGGCTGG - Intergenic
1198903560 X:141536761-141536783 TTTGAAAATGTATTCTGGGCTGG + Intergenic
1198916462 X:141678138-141678160 TTTGAAAATGTATTCTGGGCTGG + Intronic
1200826703 Y:7652141-7652163 TTGGAAAAAGGATTCTGGAAAGG - Intergenic
1200883687 Y:8246643-8246665 TTGGGAAAAGGATTCTGGAAGGG - Intergenic
1200909928 Y:8522934-8522956 TTGGGAAAAGGATTCATGAGGGG + Intergenic
1200955055 Y:8936485-8936507 TTGGGAAAAGGATGCTGGAAGGG + Intergenic
1201039121 Y:9811417-9811439 TTGGGAAGAGGATTCTGGAAGGG - Intergenic
1202046902 Y:20744579-20744601 CTTGGAAAAGACTTCTGGGCTGG - Intergenic
1202125131 Y:21562845-21562867 TTGGGAAAACGATTCTGGAAGGG + Intergenic
1202153877 Y:21866547-21866569 TTGGGAAAACGATTCTGGAAGGG - Intergenic
1202183715 Y:22161086-22161108 TTGGGAAAAGGCTTCTGGAAGGG - Intergenic
1202199876 Y:22335239-22335261 TTGGGAAAAGGATTCTGTAAGGG + Intronic
1202207644 Y:22425315-22425337 TTGGGAAAAGGCTTCTGGAAGGG + Intergenic