ID: 1059650689

View in Genome Browser
Species Human (GRCh38)
Location 9:116313298-116313320
Sequence ATGTTTGGAAAAGGATTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 391}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059650689_1059650696 3 Left 1059650689 9:116313298-116313320 CCCCAGAATCCTTTTCCAAACAT 0: 1
1: 0
2: 2
3: 33
4: 391
Right 1059650696 9:116313324-116313346 TCATATGTGCAGGTGGTGAAAGG No data
1059650689_1059650694 -7 Left 1059650689 9:116313298-116313320 CCCCAGAATCCTTTTCCAAACAT 0: 1
1: 0
2: 2
3: 33
4: 391
Right 1059650694 9:116313314-116313336 CAAACATGACTCATATGTGCAGG No data
1059650689_1059650697 4 Left 1059650689 9:116313298-116313320 CCCCAGAATCCTTTTCCAAACAT 0: 1
1: 0
2: 2
3: 33
4: 391
Right 1059650697 9:116313325-116313347 CATATGTGCAGGTGGTGAAAGGG No data
1059650689_1059650699 14 Left 1059650689 9:116313298-116313320 CCCCAGAATCCTTTTCCAAACAT 0: 1
1: 0
2: 2
3: 33
4: 391
Right 1059650699 9:116313335-116313357 GGTGGTGAAAGGGGACACTTCGG No data
1059650689_1059650698 5 Left 1059650689 9:116313298-116313320 CCCCAGAATCCTTTTCCAAACAT 0: 1
1: 0
2: 2
3: 33
4: 391
Right 1059650698 9:116313326-116313348 ATATGTGCAGGTGGTGAAAGGGG No data
1059650689_1059650695 -4 Left 1059650689 9:116313298-116313320 CCCCAGAATCCTTTTCCAAACAT 0: 1
1: 0
2: 2
3: 33
4: 391
Right 1059650695 9:116313317-116313339 ACATGACTCATATGTGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059650689 Original CRISPR ATGTTTGGAAAAGGATTCTG GGG (reversed) Intronic
900138722 1:1129831-1129853 ATGTTTTAAAAATGATTCCGAGG + Intergenic
901568646 1:10141085-10141107 ATGTATGGGAATGGATTCTGAGG - Intronic
902858854 1:19229989-19230011 CTGTTTGGAGAAGTACTCTGTGG - Intronic
903271550 1:22191713-22191735 TTGTCTGGAGAAGGAGTCTGGGG + Intergenic
904091841 1:27950313-27950335 ATGTATAGAAAAGGAACCTGTGG + Intronic
904803310 1:33112824-33112846 ATGTTTAGAAAAACATCCTGGGG + Intronic
905533097 1:38697607-38697629 CTGTATGGAGAAAGATTCTGAGG - Intergenic
905792547 1:40797921-40797943 CTGTCTGGAAAGGGAGTCTGGGG + Intronic
906038020 1:42765098-42765120 AGATTTGGAAGAGAATTCTGCGG - Intronic
907012947 1:50980385-50980407 ATGTTTTGAAAAAGATACTCTGG - Intergenic
907740292 1:57159015-57159037 AAGTTTGGCCAATGATTCTGAGG + Intronic
907906563 1:58787468-58787490 ATGTCTGGAAAAGAACTTTGTGG - Intergenic
908066985 1:60416692-60416714 ATCCTTGGAAAGAGATTCTGAGG + Intergenic
908248315 1:62245235-62245257 ATGTTTGGAAAAGGAGGCTCTGG + Intronic
908532887 1:65050360-65050382 ATGTCAGGAAAAGGTCTCTGAGG + Intergenic
908675378 1:66597628-66597650 GTGTGTTGAGAAGGATTCTGAGG - Intronic
908680816 1:66659172-66659194 ATTTTTGGAAAATGATTCCGAGG + Intronic
909125715 1:71666545-71666567 ATGTTTGTGAAAGGCTTCAGTGG - Intronic
909416517 1:75412436-75412458 CTGTATTGAGAAGGATTCTGAGG - Intronic
909795444 1:79729484-79729506 ATGTTTGTAAAATGATACAGAGG - Intergenic
910586871 1:88890372-88890394 ATGATTAGAAAAGGAATTTGGGG - Intronic
911426782 1:97725660-97725682 ATTTTTGAAAAAGGTTTCTAAGG + Intronic
911990434 1:104689494-104689516 ATGTTTGGAAATGGGGTCTTTGG + Intergenic
912014881 1:105020473-105020495 AGGCTTGGAAAATGAATCTGGGG + Intergenic
912110788 1:106339922-106339944 TTGTTTGGGTAAGGAATCTGGGG - Intergenic
912484341 1:110013029-110013051 ATGTTTGGATAACTATTTTGGGG - Intronic
912951271 1:114122309-114122331 CTGTTTGGAAAAGAATTTCGAGG - Intronic
913209948 1:116573953-116573975 ATAGTTGGAAAAGGATGGTGTGG + Intergenic
913411813 1:118560679-118560701 ATGTCTGTATAAGAATTCTGTGG + Intergenic
914447768 1:147764377-147764399 ATGTTTGGAAAACAAGTCTAAGG - Intronic
914718495 1:150270117-150270139 ATGTTAGGCAAAGGAATCTGAGG + Intronic
914737070 1:150427808-150427830 CTCTTTAGTAAAGGATTCTGGGG + Intronic
914905582 1:151740918-151740940 ATGTATGGGACTGGATTCTGAGG + Intergenic
917191822 1:172426200-172426222 ACCTTTGGAAAAGGATGCAGGGG - Intronic
917240942 1:172948132-172948154 ATGTTTTTAATAGGATCCTGGGG - Intergenic
918280571 1:183000853-183000875 ATGTGTGGCAATGGATTCTAAGG - Intergenic
918508653 1:185285591-185285613 AGGTTTGGCAATGGATTCTTAGG - Intronic
919469611 1:197961984-197962006 ATTTTTGGAAAAGATTTCTTGGG + Intergenic
919660063 1:200235692-200235714 GTGTTTGAAAAAAGATTCTTGGG - Intergenic
920747209 1:208640210-208640232 GTGATGGGAAAAGGATTCTTTGG + Intergenic
920817940 1:209352900-209352922 ATATTTGGAAATTGATTCTATGG - Intergenic
921413036 1:214856771-214856793 ATGTTTGGTACAGGAATCTCTGG + Intergenic
921566241 1:216723870-216723892 TAATTTGGGAAAGGATTCTGCGG + Intronic
921684785 1:218077328-218077350 GAGTTTGGTAAAGGATGCTGAGG - Intergenic
921872398 1:220155023-220155045 GTGTTTTTAAAAGGATTCAGAGG - Intronic
923923833 1:238600935-238600957 ATTTTTGGAAAATTATTTTGGGG + Intergenic
924013356 1:239691931-239691953 GTGTTTTGATAAGGATCCTGGGG + Intronic
1063822472 10:9853778-9853800 AGATATGGAAAAGGTTTCTGAGG - Intergenic
1065795964 10:29308563-29308585 TTGTGTTGAGAAGGATTCTGAGG + Intronic
1067302736 10:45027388-45027410 ATGTTAGGAGAAGGATATTGGGG + Intergenic
1067844331 10:49707818-49707840 CTGTTTTGAAAATGCTTCTGAGG + Intronic
1067917389 10:50415385-50415407 ATTTTTGAAAATGGACTCTGTGG + Intronic
1068262960 10:54607337-54607359 ATTCTTGGTAGAGGATTCTGGGG + Intronic
1068553595 10:58433205-58433227 ATTTGTTGAAAAGGATTCTGAGG - Intergenic
1070016446 10:72537260-72537282 ATGTTTGGAAGTGGAGTGTGGGG + Intronic
1070480563 10:76878523-76878545 ATGTTTTAAAGAGGATTTTGAGG + Intronic
1071313405 10:84366242-84366264 ATATGTTGAAAAGGATTCCGAGG - Intronic
1071328420 10:84538916-84538938 CTCTTTTGAAAAGGATTCTTTGG + Intergenic
1071854568 10:89610382-89610404 TTGGTGAGAAAAGGATTCTGTGG + Intronic
1071955322 10:90751405-90751427 ATGTCTGGGAAAGGCTGCTGGGG - Intronic
1072126514 10:92450409-92450431 AAGTTTGGAAGAGGAGTGTGAGG - Intergenic
1072273023 10:93795689-93795711 CTGTGTTGAGAAGGATTCTGTGG - Intronic
1072576283 10:96703531-96703553 CTGTGTGGGAAAGGACTCTGTGG - Intronic
1073065034 10:100753259-100753281 ATATTTTGGAAAGAATTCTGGGG + Intronic
1073831101 10:107384530-107384552 ATGTGTGGAAGATGTTTCTGTGG - Intergenic
1074908687 10:117887581-117887603 ATGTTTTGAAGAGCATTATGGGG - Intergenic
1076258873 10:129050256-129050278 ACATTTGCAAAAGGTTTCTGTGG + Intergenic
1076283397 10:129270768-129270790 ATATTAGAAAAAGGATTCTTTGG + Intergenic
1076644288 10:131941695-131941717 GTGTTAGGGAAAGGCTTCTGCGG - Intronic
1077440038 11:2563997-2564019 AGGTCTCCAAAAGGATTCTGTGG - Intronic
1077980186 11:7292281-7292303 AAGTGTGGAAAAGGGTCCTGTGG + Intronic
1078385953 11:10892874-10892896 CTGTATTCAAAAGGATTCTGAGG - Intergenic
1079080769 11:17412234-17412256 CTGTGTTGAGAAGGATTCTGAGG + Intronic
1079102589 11:17551137-17551159 ATGCTTGGCACAGGGTTCTGGGG + Intronic
1079700805 11:23543948-23543970 CTGGGTGGAAAAGGATTCTGAGG + Intergenic
1080294681 11:30713130-30713152 ATGTTTGGTGGAGGATTCTAAGG + Intergenic
1081016164 11:37883738-37883760 ATTTTTATAAAAGGATTCTAAGG - Intergenic
1081435534 11:43023603-43023625 ATTTTTGGATGAGGATACTGAGG - Intergenic
1081439775 11:43067216-43067238 ATGTGTTGAGAAGGATTCTGAGG - Intergenic
1081833028 11:46130461-46130483 CTGTGTTGAGAAGGATTCTGAGG - Intergenic
1082687965 11:56262630-56262652 ATGTTTGGAAATGGATATTAAGG - Intergenic
1084850394 11:71934828-71934850 CTGTGTCGAGAAGGATTCTGAGG + Intronic
1084942494 11:72620422-72620444 ATTTTTGGAAAGGGAGACTGAGG + Intronic
1085979730 11:81709619-81709641 ATGTTTGGGGATGGATTCTAAGG + Intergenic
1086143907 11:83529603-83529625 TGTTTTGAAAAAGGATTCTGAGG - Intronic
1086545049 11:87957935-87957957 ATATTTGGAAAGTGATTCTAGGG - Intergenic
1086977272 11:93148571-93148593 AAATTTAGAAAAGGACTCTGTGG + Exonic
1087107911 11:94430137-94430159 CTGTAAGGAAAAGGACTCTGGGG + Intronic
1088675190 11:112186072-112186094 ATGTTTAAAAAAAGATTATGAGG + Intronic
1089098101 11:115936582-115936604 ATGTCTGGAGAAGGACTCAGAGG + Intergenic
1089116429 11:116098847-116098869 CTGTGTAGAAAAGGATTTTGAGG - Intergenic
1089335085 11:117717495-117717517 CTGTGTGGATAAGGATTGTGAGG + Intronic
1093041170 12:14380999-14381021 GTGTTTGGTAAAGGCTTCTAAGG + Intronic
1093198164 12:16153808-16153830 ATTTTTTGAAAAAAATTCTGGGG + Intergenic
1093306031 12:17520766-17520788 ATTTTTCTAAAAGGATTCTGTGG + Intergenic
1093774855 12:23061731-23061753 AAGTTAGGAAAATAATTCTGTGG + Intergenic
1094091612 12:26656272-26656294 ATGTTTGGAAAAAGGTCTTGAGG - Intronic
1094116438 12:26919654-26919676 ATGTCTCAAAAACGATTCTGAGG + Intronic
1095164769 12:38959004-38959026 ACATTTTGAAAAGGATACTGAGG + Intergenic
1095703258 12:45212661-45212683 ATTTTTTAAAAAAGATTCTGTGG - Intergenic
1095769836 12:45941533-45941555 ATGTTTGTCAAGGGATTCAGAGG - Intronic
1100697106 12:97106909-97106931 AAGTTTGGAAAACGTATCTGGGG - Intergenic
1102507590 12:113393389-113393411 CTGTGTTGAGAAGGATTCTGAGG + Intronic
1102754078 12:115322749-115322771 CTGTGTTGAGAAGGATTCTGAGG + Intergenic
1102995927 12:117350760-117350782 AAGTTTGGAGAATGAATCTGGGG - Intronic
1103134149 12:118493064-118493086 CAGTTTGGATAAGGGTTCTGGGG + Intergenic
1103963587 12:124624218-124624240 ATGTATGGTAAGGGCTTCTGTGG + Intergenic
1104112839 12:125719755-125719777 ATGTTTGGAACAAGAATCTATGG + Intergenic
1104398517 12:128456050-128456072 ATGTGTTGAGGAGGATTCTGAGG + Intronic
1105896274 13:24719243-24719265 ATGTTTGATGAAGGATCCTGGGG + Intergenic
1106130153 13:26933108-26933130 ATTTATGGAAGAGGAATCTGAGG - Intergenic
1106508668 13:30393795-30393817 CTGCTTAGAAAAGGTTTCTGGGG + Intergenic
1107636678 13:42399211-42399233 ATTGTTGGGAAAGGAGTCTGAGG - Intergenic
1108287461 13:48922708-48922730 CAGTTTGGGAAAGTATTCTGAGG + Intergenic
1110590803 13:77256310-77256332 ATGTTTGGAAAAGACTTTTCTGG + Intronic
1111455949 13:88484607-88484629 ACATTTAAAAAAGGATTCTGAGG + Intergenic
1111482121 13:88843502-88843524 ATTGTTGGAAAATGATGCTGTGG + Intergenic
1112090389 13:96077210-96077232 ATGTTTTGAAAAGTATTTAGAGG + Intergenic
1113330762 13:109325001-109325023 ATGCGAGGAAAGGGATTCTGAGG - Intergenic
1114776695 14:25491796-25491818 ATTTTTGGAAAATAATTCTGTGG + Intergenic
1116763293 14:49040728-49040750 ATGTATGGAATTGAATTCTGAGG + Intergenic
1117823535 14:59676538-59676560 ATGATTGGAAAAGACTTTTGAGG + Intronic
1117975266 14:61290632-61290654 GGGTTTGAACAAGGATTCTGTGG + Intronic
1118121747 14:62853423-62853445 TTGTTTGGGAAATGATTTTGTGG - Intronic
1118265331 14:64289210-64289232 ATGTCTGTGAAAGGATTCTGAGG + Intronic
1119307349 14:73618319-73618341 CTGTTTGGCAGAGAATTCTGGGG - Intronic
1119486582 14:74992594-74992616 ATGTTTAGAAATGCATTCTAAGG - Intergenic
1119625142 14:76167580-76167602 ATTTTTGGAGAAGGACTGTGGGG + Intronic
1119942772 14:78658781-78658803 ATGTACGGAAAAGCACTCTGTGG + Intronic
1120431765 14:84427058-84427080 TTGTTTTGAAAAAGATCCTGAGG + Intergenic
1120617361 14:86723837-86723859 AATTGTGGAAAAGTATTCTGAGG + Intergenic
1121120814 14:91374850-91374872 CTGTGTTGAGAAGGATTCTGAGG + Intronic
1122452655 14:101823158-101823180 ATGTTTGGTAAAGAGTTCTTTGG + Intronic
1123799846 15:23808471-23808493 ATGTGTGGTAAAGGCTTCAGAGG + Intergenic
1125783326 15:42291176-42291198 ATGAATGGAAATGGTTTCTGAGG + Intronic
1126277134 15:46896638-46896660 ATATTTGGCAAGGGATTCTATGG - Intergenic
1126693556 15:51307040-51307062 ATGTTTGGAAAAGCAATCAGTGG + Intronic
1128033209 15:64499950-64499972 TTGTTCAGAAAAGGATCCTGGGG + Exonic
1128164438 15:65450640-65450662 ATGGTTGTAAAAGGATTTTTAGG - Intronic
1128916586 15:71568228-71568250 ATGTATGGGCAAGAATTCTGTGG - Intronic
1129998729 15:80028941-80028963 CTGTGTTGAGAAGGATTCTGAGG + Intergenic
1130023234 15:80248535-80248557 AGTTGTAGAAAAGGATTCTGAGG + Intergenic
1130079502 15:80720114-80720136 TTGTTTAGAAAAGGATCGTGGGG + Intronic
1130288594 15:82576490-82576512 ATGTATGGTGAAGGATTTTGGGG + Intronic
1130916926 15:88312484-88312506 AGATTTGGAAAAGGAGTATGAGG + Intergenic
1130970292 15:88727010-88727032 AAGTTTAGAAAAGGATGCTTTGG + Intergenic
1133206823 16:4239049-4239071 CTGTGGGGAAAAGGCTTCTGGGG + Intronic
1133995121 16:10742187-10742209 ATTTTTGGATAAGGAAACTGAGG - Intergenic
1135957173 16:26965645-26965667 ATCCCTGGGAAAGGATTCTGGGG + Intergenic
1136090854 16:27918981-27919003 CTGTGTGGAGAAGGATTGTGAGG - Intronic
1137403327 16:48171051-48171073 ATGTTTAGAACTGGATTATGGGG + Intronic
1137672802 16:50289334-50289356 CTGTGTTAAAAAGGATTCTGAGG - Intronic
1138564870 16:57825623-57825645 TTCTTTGGAAAACAATTCTGAGG + Intronic
1138835088 16:60424772-60424794 ATGTTTTGTAAAAGATACTGTGG + Intergenic
1138993949 16:62425386-62425408 ATTCTTGGACTAGGATTCTGAGG + Intergenic
1139931525 16:70530896-70530918 TTGTCTGGAAATGGATTATGAGG + Exonic
1141112968 16:81285433-81285455 TGGTGTGGAAACGGATTCTGAGG + Intronic
1141271661 16:82546471-82546493 CTGTGTTGAGAAGGATTCTGAGG - Intergenic
1142470137 17:158588-158610 CTGTGTTGAAAAGGATTCTGAGG - Intronic
1142532174 17:587623-587645 ATGTTTGGAAAGGAATTAAGTGG - Intronic
1143051248 17:4127818-4127840 ATGACTGGAAAAGTATTCTCTGG + Intronic
1145884053 17:28370655-28370677 ATGTTTGGAGAAGGAATTTGTGG - Exonic
1147020565 17:37529126-37529148 ATGCTTGGAATGGGAGTCTGAGG + Intronic
1149026849 17:52036685-52036707 ATGTTTGGAAGAAGACACTGAGG - Intronic
1149555749 17:57572197-57572219 AGGTTTGAATAAGGATTCAGAGG + Intronic
1149650965 17:58276249-58276271 CTGTGTTGAGAAGGATTCTGAGG - Intronic
1150630429 17:66876764-66876786 CTGTGTTGAAAAGGATTCTGAGG - Intronic
1151471238 17:74319196-74319218 AAATTTGGAAGAGGATGCTGGGG + Intergenic
1152674293 17:81629715-81629737 ATTTTTGAAAAAGGTATCTGTGG - Exonic
1153003258 18:475269-475291 ATGTTTGGAAAAGGTGCCTCTGG + Intronic
1153537847 18:6121766-6121788 ATGGTTTGAAAAGAATTCTGAGG + Intronic
1153632625 18:7086596-7086618 TTTTTTGGAAAAGGATAGTGGGG - Intronic
1154340677 18:13499690-13499712 ATGTGTGGAGATGGATTCTCCGG - Intronic
1155378414 18:25188432-25188454 ATGTGTGTGAACGGATTCTGTGG + Intronic
1155417590 18:25616525-25616547 AAGTTTGGAAGAGCTTTCTGGGG - Intergenic
1156345100 18:36249782-36249804 ATGATTGGATAAGGAAGCTGAGG + Intronic
1157200550 18:45655531-45655553 TTGTGTTGACAAGGATTCTGAGG + Intronic
1158039437 18:53074948-53074970 ATGTTTGTAAAAGGGATTTGTGG + Intronic
1158190141 18:54818407-54818429 ATGTATGGGAATGAATTCTGAGG - Intronic
1159798677 18:72870210-72870232 ATGCTTGGAAAACGCTTTTGGGG + Intergenic
1159917425 18:74199391-74199413 ATCCTTGAAAAAGGATTTTGAGG - Intergenic
1163488176 19:17601873-17601895 ATTCTTAGGAAAGGATTCTGGGG + Exonic
1164951877 19:32344267-32344289 CTAATTGGCAAAGGATTCTGTGG + Intergenic
1165086614 19:33352855-33352877 ATGTTTAGAAAAGAATGATGAGG - Intergenic
1167239908 19:48337590-48337612 ATGTTTGGTAAGTGTTTCTGAGG - Intronic
1167266708 19:48486409-48486431 ATGGTTGGGGAAGGACTCTGTGG - Intronic
925238857 2:2304033-2304055 ATATTTGAATAAGGATTATGTGG + Intronic
926831673 2:16969525-16969547 CTGTTTGGAAAAGGATGCATTGG + Intergenic
927203516 2:20592867-20592889 TTATTTGGAAAAGGAATCTGTGG - Intronic
928624585 2:33126688-33126710 ATTTTGGGAAAAGGATATTGAGG + Intronic
929179362 2:39018243-39018265 ATGTTTGAGAAAGAATTTTGTGG - Intronic
929248192 2:39725208-39725230 GTGTTTGGGATAGGGTTCTGAGG - Intergenic
930238662 2:48912412-48912434 TTCTTAGGAAAAGGATTCTTAGG - Intergenic
930728325 2:54704251-54704273 ATGTTTTGAAGAGGCTTCTTAGG + Intergenic
932688423 2:73892807-73892829 ATGTATGCAAAAGGACTCAGTGG - Intronic
932979104 2:76641843-76641865 ATGTTTCCAAAAGAATTCTGAGG + Intergenic
933229965 2:79795966-79795988 ATGTCTGGAAACGGTTTCTCTGG + Intronic
933771140 2:85744875-85744897 CTGTGTTGAAAAGGATCCTGAGG - Intergenic
933907472 2:86909431-86909453 ATGTTTGGAAAGGGGTTCCCAGG + Intronic
933908718 2:86919123-86919145 ATGTTTGGAAAGGGGTTCCCAGG + Intronic
934024006 2:87984262-87984284 ATGTTTGGAAAGGGGTTCGCCGG - Intergenic
934232031 2:90192746-90192768 GTGTTTGGAAAAGGACTGTTAGG + Intergenic
935679980 2:105627603-105627625 AAGTTTGGAATAGGACTCTTTGG - Intergenic
935926733 2:108077829-108077851 ATGTGAGGAAAAGTATTCTTAGG + Intergenic
936364656 2:111841976-111841998 ATGTTTGGAAAGGGGTTCCCAGG - Intronic
937392712 2:121504814-121504836 TAGTTTTGAGAAGGATTCTGAGG - Intronic
937661414 2:124433999-124434021 CTGTGTTGAGAAGGATTCTGAGG - Intronic
939466950 2:142569429-142569451 ATGTTGGGAAAGGGACCCTGTGG + Intergenic
939789361 2:146552564-146552586 ATGTTGGGAAAATAATTTTGGGG - Intergenic
940736189 2:157455421-157455443 ATGTTTGGAAAATGATGATATGG - Intronic
941931115 2:170940057-170940079 ATGTGTGGAAAAGGAATATATGG + Intronic
942249720 2:174037549-174037571 GCGTTGGGTAAAGGATTCTGGGG - Intergenic
943048167 2:182883354-182883376 ATCTTGGGAAAATTATTCTGCGG - Intergenic
943097466 2:183447702-183447724 TTCTTGGGAAAAGTATTCTGAGG + Intergenic
943171385 2:184405440-184405462 TTGTTTGGCAATGGATTCTTAGG + Intergenic
943199762 2:184805508-184805530 ATATTTAGAAAATGATTATGAGG - Intronic
943775203 2:191758045-191758067 AGTTTTGGAAACGGATTTTGAGG + Intergenic
943938153 2:193952531-193952553 ATATTTAGAAAAAGATTCTCTGG + Intergenic
944611796 2:201417144-201417166 GTGTTTGGAAAAAGTTTGTGTGG - Intronic
944939935 2:204613138-204613160 ATTTCTGGGAAAGGATTCTCAGG + Intronic
945036976 2:205712457-205712479 GTGTTTGGTAAAGGAATCCGGGG - Intronic
945504985 2:210628913-210628935 ATGTTTGGAAAACTGCTCTGTGG + Intronic
945634418 2:212330004-212330026 CTTTTTGGAAAAGGTTACTGGGG - Intronic
946620755 2:221560129-221560151 ATGTTTGACAAAGGATCCTTGGG - Intronic
946854162 2:223936361-223936383 ATGTCTGTAAAAGGACTTTGGGG - Intronic
948051336 2:234981640-234981662 TTGTTTGCACAAGGATTCTTTGG + Intronic
948908748 2:240992570-240992592 CTGTGTTGAGAAGGATTCTGAGG + Intronic
1169436370 20:5595716-5595738 CTCTGTTGAAAAGGATTCTGAGG - Intronic
1169724212 20:8711830-8711852 CTGTGTTGAGAAGGATTCTGAGG - Intronic
1170590663 20:17768950-17768972 CTGTGTTGAGAAGGATTCTGAGG - Intergenic
1171148398 20:22805493-22805515 ATGTGTTAAGAAGGATTCTGAGG + Intergenic
1171215311 20:23348365-23348387 GTGTTTGCTGAAGGATTCTGGGG - Intergenic
1172192954 20:33073211-33073233 CTGGTTTGAAAAGGATTGTGAGG - Intronic
1172307846 20:33894270-33894292 CTGTGTTGAGAAGGATTCTGAGG + Intergenic
1172821985 20:37744602-37744624 CTGTGTTGAGAAGGATTCTGAGG + Intronic
1173007143 20:39148739-39148761 ATGTGTTGAGAAGGATTCAGAGG - Intergenic
1173069444 20:39747550-39747572 ATGTATTTAAAAGGTTTCTGAGG + Intergenic
1173179068 20:40788376-40788398 ATGTGTTGAAAAAGATTCTGAGG + Intergenic
1174755354 20:53153064-53153086 ATTTTTGAAAAGGCATTCTGAGG - Intronic
1175463489 20:59172823-59172845 GTGTGTGCAAATGGATTCTGTGG - Intergenic
1175556694 20:59866292-59866314 AGATTTGGAAAAGGAATTTGTGG - Exonic
1177109809 21:17011868-17011890 ATGTTTAAAAAAGAATTCTCTGG + Intergenic
1177397534 21:20557070-20557092 ATGGTTAGAAATGGATTTTGAGG + Intergenic
1177682156 21:24385830-24385852 ATGTTTGGGAAAGAACACTGAGG + Intergenic
1177846405 21:26292987-26293009 ATTTTTGAAAAAGAATTATGTGG + Intergenic
1182356199 22:29723242-29723264 AGGTCTGGAAAAGGTCTCTGGGG + Intronic
1184363446 22:44032780-44032802 CTGTGTTGAGAAGGATTCTGTGG + Intronic
949844994 3:8360791-8360813 TTGTTTTGAGAAGGATTCTGAGG - Intergenic
950688403 3:14635790-14635812 CTGTGTTGAGAAGGATTCTGAGG - Intergenic
951116614 3:18870666-18870688 ATATTTTGAAAAGAATTGTGTGG - Intergenic
951746279 3:25981032-25981054 ATGTTTTAAAAAGGAATGTGAGG + Intergenic
952302563 3:32116526-32116548 TTGTGTTGAGAAGGATTCTGGGG + Intronic
952763348 3:36934631-36934653 ATGTTTCACAAAGGATTCCGAGG - Intronic
953404252 3:42652818-42652840 TTGGTTGGATAAGGACTCTGAGG - Intergenic
953738496 3:45516466-45516488 ATGTTTCCCAAATGATTCTGAGG - Intronic
954136901 3:48586053-48586075 AGGTTTGGAAGAGGCCTCTGGGG - Exonic
955239464 3:57166103-57166125 CTGTTTGGAAGAGGAAACTGAGG + Intronic
955333556 3:58067221-58067243 CTGTGTTGAGAAGGATTCTGAGG - Intronic
955519724 3:59763373-59763395 TTGTGTTGAGAAGGATTCTGTGG - Intronic
956194748 3:66641827-66641849 CTGTGTCGAGAAGGATTCTGAGG + Intergenic
956484778 3:69710883-69710905 TTGTGTTGAGAAGGATTCTGAGG - Intergenic
956539932 3:70325211-70325233 ATATTTGGTAAAGGAACCTGGGG + Intergenic
956802879 3:72778834-72778856 AATTTTGGAAAAGGAATCTCAGG - Intronic
957698521 3:83677950-83677972 ATGATTGGAAAAAGAATATGTGG + Intergenic
957754398 3:84467843-84467865 ATGTCTGGAAAATTATTGTGGGG - Intergenic
958590323 3:96149960-96149982 ATGATTGGAAAAATATTCTCAGG + Intergenic
959979145 3:112495583-112495605 ATGTTTAGGAATGCATTCTGTGG - Intronic
960030870 3:113053620-113053642 ATGTTTTGAACAGAAGTCTGGGG - Intergenic
960048153 3:113216776-113216798 ATGTTTGGGACAGGATTATTGGG + Intronic
960473706 3:118097986-118098008 GCGTTTGGAATAGGATTCTATGG + Intergenic
960807799 3:121600719-121600741 ATTTATGAATAAGGATTCTGAGG - Intronic
961019066 3:123488750-123488772 ATGTTAGGGAGAGGAGTCTGTGG - Intergenic
961761423 3:129171842-129171864 ATTTTTGGAAAATTATTCTGGGG + Intronic
962270920 3:133977602-133977624 TTGTGTTGAGAAGGATTCTGAGG + Intronic
962764741 3:138550930-138550952 AAGTTTGGAAAACGTCTCTGGGG + Intronic
963332322 3:143928300-143928322 TTGTATTGAAAAAGATTCTGAGG + Intergenic
964848215 3:161066522-161066544 ATGTTTGGACAAAGACTCGGAGG + Intronic
965698060 3:171429815-171429837 ATGTATGTGAAAGGCTTCTGGGG - Intronic
965703355 3:171481046-171481068 AAAATTGGAAAGGGATTCTGGGG - Intergenic
966012917 3:175103568-175103590 TTGGGTGGAGAAGGATTCTGAGG - Intronic
966240085 3:177746344-177746366 TTGTGTTGAGAAGGATTCTGAGG + Intergenic
971550891 4:27954230-27954252 AAGTTTGAAAAAGGACCCTGTGG + Intergenic
972343706 4:38175314-38175336 CTGTGTTGAGAAGGATTCTGAGG + Intergenic
974500673 4:62697341-62697363 ATTTTAGGAAAAGGTTTCTGGGG + Intergenic
974884563 4:67802745-67802767 ATTTTTGGAAGTGGATTCTAGGG - Intergenic
975050225 4:69854216-69854238 ATTTTGGGAAAAGGATTGTAAGG - Exonic
975061989 4:70014762-70014784 AAGTTTGGAAAATGTTTTTGGGG - Intergenic
975660993 4:76689241-76689263 AGGTTTGAAAACGGATTCTGGGG - Intronic
977170792 4:93759796-93759818 ATGTTTGTAAATGGATACAGTGG + Intronic
978944347 4:114477038-114477060 GTGTTTGGAAAAGAAATCTCAGG - Intergenic
979072010 4:116219930-116219952 ATATTTGGAAAACGTTTGTGTGG - Intergenic
979483327 4:121243091-121243113 CTGTTTGGTAAATGCTTCTGTGG + Intergenic
981255942 4:142660519-142660541 CTGTTTGGAAAATGCATCTGAGG - Intronic
982565072 4:156975713-156975735 ATGTAAGGAAAAGGAAACTGAGG - Intergenic
983500541 4:168494433-168494455 AGGTTGGGAAAGGGAGTCTGTGG - Intronic
983719250 4:170826578-170826600 GTGTTTGGAGATGGAATCTGTGG - Intergenic
984200081 4:176708509-176708531 ATGTTTATAAAAGGATCCTTGGG + Intronic
984549748 4:181146283-181146305 CAGTTTGGAAAAGGCTTGTGTGG + Intergenic
986141613 5:5036192-5036214 ATTTTTGGAAGATAATTCTGTGG - Intergenic
988202621 5:28087080-28087102 ATGTTTTGATCAGGGTTCTGAGG - Intergenic
988297017 5:29378497-29378519 ATGTTTGCAAAAGCACTGTGTGG + Intergenic
988893520 5:35647058-35647080 CTGTGTTGAAAAAGATTCTGTGG + Intronic
992507086 5:77397737-77397759 ATGTTTGGATAAGAATTGTGTGG - Intronic
992723928 5:79587803-79587825 ATGTTTTGAAAAGGACACTCAGG - Intergenic
994670835 5:102759602-102759624 ATGTTTTAAAAACTATTCTGTGG + Intronic
995293616 5:110490456-110490478 GTGTTTTGAAAAGGTTTGTGTGG - Intronic
997241704 5:132312545-132312567 ATGTTTTGTCAAGGAGTCTGTGG - Intronic
997753352 5:136371351-136371373 ATATTTGGAATGGGATTCTGAGG + Intronic
999087696 5:148907709-148907731 ATATTTGGAAAAGTAGGCTGTGG + Intergenic
999128049 5:149261156-149261178 ATGTTTACAAGAGGCTTCTGTGG + Intergenic
999130970 5:149282920-149282942 TTGTTTGCAAAAGGTTTCTGAGG - Intronic
999493576 5:152074881-152074903 GTGTGTTGAGAAGGATTCTGAGG - Intergenic
1000667216 5:164013514-164013536 TTGTGTTGAGAAGGATTCTGAGG + Intergenic
1001164738 5:169353790-169353812 ATTTTTAAAAAAGGATTGTGAGG + Intergenic
1001650050 5:173309802-173309824 GTGGTTGGAAAAGGAATCTCAGG + Intergenic
1001726482 5:173906625-173906647 GTGTTTTGAGAAGGATTCTCAGG - Intronic
1002911319 6:1493242-1493264 ATGTTTTAAAAAAGGTTCTGGGG - Intergenic
1003349763 6:5305103-5305125 TTGTGTGGAGAAGGATTTTGAGG + Intronic
1003530887 6:6936520-6936542 ATCTTTGTAAAGAGATTCTGAGG + Intergenic
1004016215 6:11734338-11734360 CTCTGTTGAAAAGGATTCTGAGG - Intronic
1004982799 6:21045321-21045343 ATTTTTGGCAAAAGAATCTGAGG - Intronic
1004992574 6:21155170-21155192 ATGTTTTCTAAAGGATTTTGAGG - Intronic
1005088402 6:22031196-22031218 GAGCTTGGAAAAGTATTCTGGGG - Intergenic
1005376532 6:25188118-25188140 GTGTTTGGAGAAGGATTAGGAGG - Intergenic
1006422058 6:33941049-33941071 ATGTGTAGAAATGGATTTTGAGG + Intergenic
1007190008 6:40005882-40005904 ATATTTGGAAAAGAATTTGGTGG + Intergenic
1007451855 6:41946147-41946169 ATTTTTAGAAAAGGAAACTGAGG - Intronic
1007865616 6:44966229-44966251 ATCTTTGGAAAAAGATTCAAGGG + Intronic
1008864990 6:56199762-56199784 ATGTAATGGAAAGGATTCTGGGG - Intronic
1009025650 6:57997102-57997124 ATGTTTGGAAAATTAGTCTTTGG - Intergenic
1009201212 6:60748569-60748591 ATGTTTGGAAAATTAGTCTTTGG - Intergenic
1009299709 6:62000345-62000367 CTGTGTTGAGAAGGATTCTGAGG - Intronic
1009343146 6:62584483-62584505 TTGTGTTGAAAAGGATTCTGAGG - Intergenic
1009444866 6:63730334-63730356 ATGTTTTCAAAAGGTTTCTCTGG - Intronic
1009594257 6:65714133-65714155 ATGTTAGAAAAAGAATTATGAGG - Intergenic
1010180617 6:73082822-73082844 ATGTTCAGAACAGAATTCTGTGG - Intronic
1011133418 6:84074698-84074720 CTGTTTTGAAAATGATTCTCAGG - Intronic
1011630586 6:89320149-89320171 ATGTGAGGAAAAGGTTACTGTGG - Intergenic
1012109989 6:95217479-95217501 ATGTTAGGAAACGGATTTTGAGG - Intergenic
1012267518 6:97164029-97164051 ATTTTAGGAAAAGTAATCTGGGG + Intronic
1012272750 6:97235183-97235205 ATGTTTGGAAAAAGATTCAGTGG + Intronic
1012547874 6:100440363-100440385 TTGCTTGGAAAATGATACTGTGG + Intronic
1013482426 6:110563962-110563984 ATGTTTGGATAAGGATTATGGGG - Intergenic
1013662074 6:112308124-112308146 ATGTTGGGAAAAGGACTATCAGG + Intergenic
1014546480 6:122742219-122742241 ATGTTTGGAAAATGGTTCCCAGG - Intergenic
1015340850 6:132098779-132098801 TTGTTTGGAATAAGATTCTAAGG + Intergenic
1015428414 6:133100449-133100471 ATGTTTGAAGAGGTATTCTGGGG + Intergenic
1015671763 6:135698862-135698884 TTGTTGGGAAAAGCATCCTGTGG + Intergenic
1016057912 6:139598035-139598057 ATGTTTGAAAAGGGCTTCTGTGG - Intergenic
1016432539 6:144002636-144002658 ATGTTTGGAAAATAAAACTGGGG + Intronic
1018095002 6:160377677-160377699 ATGTTATGAAAATAATTCTGTGG + Intronic
1018512882 6:164545027-164545049 ATGTTTGGGAAAGGGTCCTCAGG - Intergenic
1020868721 7:13600395-13600417 CTGTGTTGAAAAGGACTCTGAGG + Intergenic
1020947751 7:14635713-14635735 ATGTTTGGGACAGGGATCTGAGG + Intronic
1021273102 7:18616447-18616469 CTGTCTAGAAAAGGATTCAGGGG + Intronic
1024017363 7:45329263-45329285 GTGTTGGGGAAAGGATTCTGAGG + Intergenic
1024528640 7:50371932-50371954 AAGTGTGAAAAAGGTTTCTGGGG - Intronic
1024828761 7:53423099-53423121 ATTTTAGGAAAAGGATTGTCAGG + Intergenic
1027447971 7:78296677-78296699 AATTTTGGAGAAGGATGCTGTGG - Intronic
1028509589 7:91609495-91609517 TTTTTGTGAAAAGGATTCTGGGG - Intergenic
1028710167 7:93898032-93898054 ATGGTTAGAAAAGAATTCTCAGG - Intronic
1030777929 7:113559050-113559072 ATTTTTAGAAAAGCTTTCTGAGG + Intergenic
1032522062 7:132552984-132553006 ATGCTTGGCTCAGGATTCTGGGG + Intronic
1033158015 7:138972678-138972700 ATGTTGGGAGAAGGAATCGGAGG - Intronic
1033843956 7:145409578-145409600 TTATTTGGAAAAGGATTATATGG + Intergenic
1034465135 7:151223582-151223604 CTGTTTGGAACAGGAGTCAGTGG - Intronic
1038324630 8:26563425-26563447 ATGTCTGGAAAAAGATATTGGGG - Intronic
1038426346 8:27466491-27466513 AGGTATGAAAAAGGGTTCTGTGG - Intronic
1038443561 8:27587774-27587796 CTGTGTTGAGAAGGATTCTGGGG + Intergenic
1039309904 8:36306063-36306085 CTGTGTTGAAGAGGATTCTGAGG + Intergenic
1039404749 8:37302924-37302946 ATGTTGGGAATAGGATTATGGGG + Intergenic
1039724595 8:40202483-40202505 ATGTTTGCAAAAGCCTTCAGTGG + Intergenic
1042717785 8:71793696-71793718 ACATTTGGAAAACGTTTCTGGGG + Intergenic
1042841990 8:73133262-73133284 ATGGGTTGAGAAGGATTCTGAGG - Intergenic
1043581799 8:81723135-81723157 ATGTTTGGTAAAGTGTTCTCAGG - Intronic
1044235518 8:89825724-89825746 ATGTTTGGAAGAAGATTTAGGGG + Intergenic
1044726357 8:95197419-95197441 CTGTGTTGAGAAGGATTCTGAGG + Intergenic
1044871200 8:96621613-96621635 CTGTCTGGAGAAGAATTCTGAGG - Intergenic
1046416231 8:113917134-113917156 ATGTTTGGATAGGGTTTTTGTGG + Intergenic
1046854670 8:119017472-119017494 TTGTGTCGAGAAGGATTCTGAGG + Intronic
1046918513 8:119702627-119702649 AGGTGTTGAGAAGGATTCTGAGG + Intergenic
1047146782 8:122209746-122209768 ATGATTGGAAAAGGATCCATGGG + Intergenic
1047327380 8:123852884-123852906 ATTTTTGGAGATGGATTTTGAGG + Intronic
1049996071 9:1035244-1035266 CTGCCTTGAAAAGGATTCTGAGG - Intergenic
1050607826 9:7319439-7319461 ATGCTGGGAAGAGGATGCTGTGG + Intergenic
1050775000 9:9248616-9248638 CTGTGTTGAAAAGGAATCTGAGG + Intronic
1051590342 9:18771058-18771080 GTGTGTGGAAAAGAATCCTGGGG - Intronic
1052343318 9:27384072-27384094 TTATATAGAAAAGGATTCTGTGG - Intronic
1052907709 9:33851096-33851118 ATGTTTGCCTAAGGATTCAGAGG - Intronic
1055575954 9:77660436-77660458 TTGTTTGGGAAAGGAGTCTTGGG + Intergenic
1055801311 9:80039228-80039250 ACATTTGGACAGGGATTCTGGGG + Intergenic
1059375803 9:113880464-113880486 CTGTGTTGAGAAGGATTCTGAGG + Intronic
1059377442 9:113895650-113895672 CTGTGTTGAGAAGGATTCTGAGG + Intronic
1059384842 9:113956357-113956379 ATGTGTTGAGAAAGATTCTGAGG - Intronic
1059390034 9:113993339-113993361 CTGTGTTGAGAAGGATTCTGAGG - Intronic
1059650689 9:116313298-116313320 ATGTTTGGAAAAGGATTCTGGGG - Intronic
1059821074 9:117972829-117972851 ATGTGCTAAAAAGGATTCTGAGG - Intergenic
1185907483 X:3949467-3949489 ATGTCTGGTAAAGTATTCTGAGG - Intergenic
1186168418 X:6851889-6851911 AGACTTGGAAAAGGTTTCTGGGG - Intergenic
1186501941 X:10058317-10058339 ATGTATTAAAAAGGATTCTAAGG + Intronic
1186596938 X:10992199-10992221 CTAACTGGAAAAGGATTCTGAGG + Intergenic
1186667687 X:11735019-11735041 TTGTGTTGAACAGGATTCTGAGG + Intergenic
1186933914 X:14426453-14426475 ATAATTGGCAAAGGATTCGGAGG - Intergenic
1187199211 X:17118579-17118601 AGGGCTGGAAAAGGTTTCTGGGG + Intronic
1187357542 X:18591161-18591183 ATGATAGAAAAAGGATGCTGTGG - Intronic
1187552210 X:20317415-20317437 ATGCATTGAGAAGGATTCTGAGG - Intergenic
1187674035 X:21698043-21698065 ATATGTGGAAGTGGATTCTGAGG - Intergenic
1188701876 X:33274834-33274856 ACGTTTGGAAAAAGTTTCTGAGG - Intronic
1191691956 X:63949254-63949276 AGATTTGGCAAAGGTTTCTGAGG - Intergenic
1191881814 X:65849893-65849915 CTGTATGGAGAAGGATTCTGAGG + Intergenic
1192163511 X:68807785-68807807 ATGATTGGAGAAGGTTCCTGAGG + Intergenic
1193231706 X:79054343-79054365 ATGTGTGGAAATGGATTTTTAGG - Intergenic
1193261774 X:79415742-79415764 ATGTTTAGAAAATGACTCTAAGG - Intergenic
1193369969 X:80683925-80683947 ATGTTTCAAAAAAGATACTGAGG + Intronic
1193616120 X:83689550-83689572 ATGTTTTGAAAACAATTCTTTGG + Intergenic
1194421997 X:93686918-93686940 AAGTTTGGAAAAGTAGGCTGAGG - Intronic
1195918850 X:109962478-109962500 ATGTTGGGGAAGAGATTCTGGGG - Intergenic
1195931568 X:110082474-110082496 AAGTGAGGAAAAGAATTCTGTGG - Intronic
1196753405 X:119137541-119137563 GTGTTAGGACAAGGATTCTCAGG + Intronic
1197320991 X:125030546-125030568 CAGTTTGAAAAAGCATTCTGGGG - Intergenic
1197616147 X:128693954-128693976 ATGATTTGGACAGGATTCTGAGG + Intergenic
1198145615 X:133853944-133853966 ATTTTTGGATAAGGAAACTGAGG - Intronic
1198452581 X:136782186-136782208 CTGTGTTGAAAAGAATTCTGAGG - Intergenic
1199271867 X:145893293-145893315 AGATTTGGAAAATGTTTCTGAGG - Intergenic
1200298791 X:154951099-154951121 ATGTTTGGTAAAGGACTAAGAGG - Intronic
1201612899 Y:15862846-15862868 GTCTTTGGAAAAGAATTTTGGGG + Intergenic
1202092968 Y:21213336-21213358 CAGTTTGGAAAAGGCCTCTGAGG - Intergenic