ID: 1059650690

View in Genome Browser
Species Human (GRCh38)
Location 9:116313299-116313321
Sequence CATGTTTGGAAAAGGATTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 249}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059650690_1059650695 -5 Left 1059650690 9:116313299-116313321 CCCAGAATCCTTTTCCAAACATG 0: 1
1: 0
2: 3
3: 18
4: 249
Right 1059650695 9:116313317-116313339 ACATGACTCATATGTGCAGGTGG No data
1059650690_1059650696 2 Left 1059650690 9:116313299-116313321 CCCAGAATCCTTTTCCAAACATG 0: 1
1: 0
2: 3
3: 18
4: 249
Right 1059650696 9:116313324-116313346 TCATATGTGCAGGTGGTGAAAGG No data
1059650690_1059650699 13 Left 1059650690 9:116313299-116313321 CCCAGAATCCTTTTCCAAACATG 0: 1
1: 0
2: 3
3: 18
4: 249
Right 1059650699 9:116313335-116313357 GGTGGTGAAAGGGGACACTTCGG No data
1059650690_1059650694 -8 Left 1059650690 9:116313299-116313321 CCCAGAATCCTTTTCCAAACATG 0: 1
1: 0
2: 3
3: 18
4: 249
Right 1059650694 9:116313314-116313336 CAAACATGACTCATATGTGCAGG No data
1059650690_1059650697 3 Left 1059650690 9:116313299-116313321 CCCAGAATCCTTTTCCAAACATG 0: 1
1: 0
2: 3
3: 18
4: 249
Right 1059650697 9:116313325-116313347 CATATGTGCAGGTGGTGAAAGGG No data
1059650690_1059650698 4 Left 1059650690 9:116313299-116313321 CCCAGAATCCTTTTCCAAACATG 0: 1
1: 0
2: 3
3: 18
4: 249
Right 1059650698 9:116313326-116313348 ATATGTGCAGGTGGTGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059650690 Original CRISPR CATGTTTGGAAAAGGATTCT GGG (reversed) Intronic
901518400 1:9764769-9764791 CAAGATTGGCAAAGGATACTAGG - Intronic
902520013 1:17010951-17010973 CATCTTTGGATCTGGATTCTAGG + Intronic
909111807 1:71488544-71488566 ACTGTTTGGAAAAGAACTCTGGG - Intronic
909503905 1:76365707-76365729 CATTATTGTAAAAGAATTCTAGG - Intronic
909892216 1:81021821-81021843 CATGTTTAGAAAAGAGTTATCGG + Intergenic
910486644 1:87722183-87722205 CATATAAGGAAAAGAATTCTGGG - Intergenic
910601712 1:89039690-89039712 CATGATTGGAAAAGGCATATCGG + Intergenic
912657684 1:111502511-111502533 AATGTTGAGAAAGGGATTCTTGG - Intronic
916690852 1:167188576-167188598 CATTTTTGGAAAAGCATACTAGG + Intergenic
917191823 1:172426201-172426223 CACCTTTGGAAAAGGATGCAGGG - Intronic
919469610 1:197961983-197962005 TATTTTTGGAAAAGATTTCTTGG + Intergenic
919660064 1:200235693-200235715 GGTGTTTGAAAAAAGATTCTTGG - Intergenic
919739616 1:200973897-200973919 CATGCTTGGAAAAGGACGGTGGG + Exonic
920841411 1:209557993-209558015 AAATTTTGGAAAAGGATTTTTGG + Intergenic
921379825 1:214513028-214513050 GGTGTTTGGACCAGGATTCTTGG - Intronic
923664417 1:235986982-235987004 AATGTGTGGAAAAGGACTCTGGG - Intronic
924673225 1:246149675-246149697 CATGTTTTAAAAATTATTCTGGG + Intronic
1062972829 10:1661711-1661733 CAGGTTTGGAAGAGGATCCTGGG - Intronic
1064381400 10:14844940-14844962 CATCTGAGGAAAAGGAATCTTGG - Intronic
1064455182 10:15480777-15480799 CATTCTTGGAAAAGTCTTCTGGG - Intergenic
1065285410 10:24182796-24182818 CATGTTTGGAGAGGGATTTTAGG + Intronic
1065768307 10:29052845-29052867 CCTGTATGGACAAGGATTGTTGG + Intergenic
1066009921 10:31185307-31185329 CATGTTTTGAAAATGTTTGTTGG + Intergenic
1071153802 10:82666662-82666684 CATGGTGGGAAGAGGATTCAAGG - Intronic
1071955323 10:90751406-90751428 CATGTCTGGGAAAGGCTGCTGGG - Intronic
1072532573 10:96332917-96332939 TTTGTTTGGAAAAGGCTTCTAGG + Intronic
1073065033 10:100753258-100753280 CATATTTTGGAAAGAATTCTGGG + Intronic
1073514808 10:104066748-104066770 CAAGTTTGGATAAGGATTTACGG - Intronic
1073899753 10:108206189-108206211 CATGTTTAAGAATGGATTCTGGG + Intergenic
1074080346 10:110163449-110163471 CAAGTTTGGGAAAGGATACACGG - Intergenic
1074860236 10:117504403-117504425 CATTTTTTGAAAATGAGTCTCGG + Intergenic
1079984685 11:27188024-27188046 CATGTTTGGAGAAATATTCAGGG - Intergenic
1081463759 11:43297436-43297458 CATATTTGGGAATTGATTCTAGG + Intergenic
1083267554 11:61553787-61553809 AATGTTTGGAAATGGGATCTGGG + Intronic
1083339333 11:61948797-61948819 CATGATTAGAAAAGTATTCAAGG + Intergenic
1085757146 11:79211195-79211217 TAAGTTGGGAAAAGCATTCTAGG + Intronic
1086095819 11:83049114-83049136 AATGTTTGCAAAAAGATGCTGGG + Intronic
1086545050 11:87957936-87957958 GATATTTGGAAAGTGATTCTAGG - Intergenic
1088442771 11:109889940-109889962 TGTGTTTGGAGCAGGATTCTAGG - Intergenic
1093020912 12:14203053-14203075 CATGTTTCAAAAAGAATTGTTGG - Intergenic
1093871895 12:24302763-24302785 CATATTTGGAGACTGATTCTGGG - Intergenic
1095277744 12:40308955-40308977 CATGTTTAGAGAACTATTCTGGG - Intronic
1097364230 12:58693301-58693323 TTTTTTTGGAAATGGATTCTTGG - Intronic
1098914737 12:76245647-76245669 CATGTTTGGAAAAGACGTCATGG + Intergenic
1099227623 12:79988747-79988769 TATGTTGGGAAAAGGGTTCTTGG + Intergenic
1099566387 12:84253126-84253148 CTAGTGTGGAAAGGGATTCTAGG + Intergenic
1101133072 12:101709430-101709452 CATTTTTGGAAAGGGATACCTGG + Intronic
1101804721 12:108053388-108053410 CAAGCTTGGAGCAGGATTCTAGG - Intergenic
1101854150 12:108428113-108428135 CTTATTTGGAAAAGGCGTCTTGG + Intergenic
1106263649 13:28090876-28090898 TGTGTTTGGAACTGGATTCTGGG - Intronic
1106934823 13:34706192-34706214 CATGGGTGGGAAAGGATCCTAGG + Intergenic
1106992903 13:35444675-35444697 CATCTTTGGAAAAAGATCTTTGG - Intronic
1107092850 13:36501304-36501326 CATGTTAGGCAAAGATTTCTTGG - Intergenic
1107280094 13:38723517-38723539 CATGTGTGGAAAAGATTTTTAGG + Intronic
1108464740 13:50704124-50704146 CATTTCTAGAAAAGGAATCTGGG - Intronic
1110325479 13:74209653-74209675 TATGATTGTAAAAGGATTGTAGG + Intergenic
1111155597 13:84319299-84319321 CATCTTTGTAAAAGGCTTCTTGG - Intergenic
1112725316 13:102297171-102297193 CATGTTTAGAAGAGTATTATGGG - Intronic
1113571945 13:111364031-111364053 CATGTTTGGAAAGAGATTTAAGG - Intergenic
1117323188 14:54643671-54643693 AATGTGTGGTAAAGTATTCTAGG + Intronic
1118902282 14:69996581-69996603 CATGTTGAGAAATGGATTCTGGG + Intronic
1121364009 14:93290155-93290177 CAAGTGGGTAAAAGGATTCTTGG - Intronic
1123933355 15:25182478-25182500 GAGGTTTGGAAGAGGATGCTGGG + Intergenic
1123936053 15:25194590-25194612 CGTGCTTGGAGAAGGATCCTGGG + Intergenic
1123938273 15:25204450-25204472 GAATTTTGGAAGAGGATTCTCGG + Intergenic
1123941473 15:25218710-25218732 GAATTTTGGAAAAGGATGCTGGG + Intergenic
1125642665 15:41244346-41244368 AATGTTTGGGAAAGGATTATGGG - Intronic
1125993806 15:44136386-44136408 CATCTTTGTGAAAGGGTTCTGGG - Intronic
1126230726 15:46320483-46320505 CATTTTTGGGAAAGAATGCTTGG - Intergenic
1127572366 15:60256565-60256587 TGTGTTTGGAAAAGTATCCTTGG - Intergenic
1128033208 15:64499949-64499971 CTTGTTCAGAAAAGGATCCTGGG + Exonic
1128897344 15:71387444-71387466 CATATTAGGAAAAAGACTCTAGG - Intronic
1129396531 15:75252272-75252294 CATGTTTGGTGAAAGACTCTTGG - Intergenic
1129980377 15:79863839-79863861 GATGCTTGGAAAAGAAGTCTGGG - Intronic
1132329621 15:101003203-101003225 CATGCTTGGAAATGGTTTCTGGG - Intronic
1134385648 16:13770019-13770041 CATGCTTGGGTAAGGATCCTAGG - Intergenic
1135028738 16:19019356-19019378 CATATTTCTAAAAGGCTTCTTGG + Intronic
1135470963 16:22730245-22730267 CAGGGTTGGGAGAGGATTCTTGG - Intergenic
1138471226 16:57238542-57238564 ACTGTTTGGTAAATGATTCTGGG + Intronic
1140292734 16:73677110-73677132 CATCTTTGGAAAAGAATCCATGG - Intergenic
1142106118 16:88303716-88303738 CATGTTCTGAAGAGGATGCTGGG - Intergenic
1144258529 17:13494873-13494895 AATATTTGGAAAAATATTCTAGG - Intergenic
1146532830 17:33624533-33624555 CAGGTATGGGTAAGGATTCTAGG + Intronic
1150928489 17:69559162-69559184 CATATCTGGAAAGGGTTTCTAGG - Intergenic
1151127711 17:71862960-71862982 TTTGCTTGGAAAAGCATTCTCGG - Intergenic
1151299708 17:73215151-73215173 TCTGTGTGAAAAAGGATTCTAGG + Intronic
1151471237 17:74319195-74319217 CAAATTTGGAAGAGGATGCTGGG + Intergenic
1152098400 17:78286499-78286521 AATGTTTGGAACAGGTGTCTGGG + Intergenic
1152972514 18:177254-177276 TGTCTTTGGAAAAAGATTCTTGG + Intronic
1153404617 18:4722746-4722768 CTTGTTGGAAAATGGATTCTGGG - Intergenic
1153766555 18:8380327-8380349 TGTGTTTGGCAAAGGATGCTGGG - Exonic
1155094141 18:22539758-22539780 CTTGTTTGGAAAAACATTTTTGG + Intergenic
1156947605 18:42853853-42853875 CATGTTTAGAAAAAAACTCTGGG + Intronic
1159571391 18:70117587-70117609 CAGTTTTTGAAAAGGATTTTTGG - Intronic
1162317531 19:9948965-9948987 TACATTTGGAAAAGCATTCTGGG + Intergenic
1163630233 19:18414720-18414742 CAGGTTTGGCAGAGGCTTCTTGG + Intergenic
1164927071 19:32139142-32139164 GATTTATGGAAAAGGAGTCTGGG - Intergenic
1165232295 19:34394691-34394713 CAGGTGTGGAAAAGCTTTCTGGG - Intronic
1165337172 19:35179238-35179260 CATCTAGGGAAAAAGATTCTGGG - Intergenic
925693492 2:6549441-6549463 CATGTCTGGATAAGGAGTATGGG - Intergenic
926741598 2:16115915-16115937 CATCTTTGGAAAACATTTCTAGG - Intergenic
931067388 2:58601733-58601755 CATGTTGAGAAAAGTGTTCTAGG - Intergenic
931302528 2:60994681-60994703 AAGGTTAGGGAAAGGATTCTTGG - Intronic
933143858 2:78827107-78827129 AATGTTTGGAAAAGGTTTGGAGG + Intergenic
936854290 2:116937836-116937858 CAAGTTTCCAAATGGATTCTTGG + Intergenic
937716761 2:125040462-125040484 CATGCTTGGAAAATGAGCCTTGG + Intergenic
939288009 2:140157373-140157395 CAGATTTGGAAAGGGATTCAGGG - Intergenic
943627274 2:190214873-190214895 CAAGTTTGGATAAGGATTTAAGG - Intronic
945289963 2:208117142-208117164 CATGTTTGAAAAATGGTTCTCGG + Intergenic
945566258 2:211403906-211403928 CATGTTAGGCAAAGGAAACTGGG - Intronic
946620756 2:221560130-221560152 AATGTTTGACAAAGGATCCTTGG - Intronic
946854163 2:223936362-223936384 CATGTCTGTAAAAGGACTTTGGG - Intronic
946971150 2:225093215-225093237 CATTTCTGGAAAAGGAATCGGGG - Intergenic
947097707 2:226585025-226585047 CATGGTGGAAAAGGGATTCTGGG + Intergenic
947861366 2:233360792-233360814 CATGTTGGGAAAAAGGTTATGGG + Intronic
1168948278 20:1779261-1779283 GATGTTTAGAAAGGGAGTCTGGG + Intergenic
1169743027 20:8915849-8915871 TATGTTTGGAAAAGGATTGTGGG - Intronic
1169906731 20:10612090-10612112 GATGTTGGGAAAAGGACTTTGGG + Intronic
1170539409 20:17373152-17373174 GTTATTTGGAAGAGGATTCTAGG + Intronic
1172488476 20:35315126-35315148 CATGTTTAGAATAGGATTTGAGG - Intronic
1174225997 20:49000641-49000663 CATGTTTGGACAAGAATACAAGG - Intronic
1175218569 20:57404388-57404410 CATGTTTGGAGAAGGTGTGTGGG + Intronic
1177911769 21:27041609-27041631 CATTTTTGGAGAAGGAATTTGGG + Intergenic
1178844196 21:36160824-36160846 CATTGTTTTAAAAGGATTCTTGG + Intronic
1179124778 21:38581110-38581132 CAAGTTTGGAAAGGCACTCTGGG + Intronic
1181863294 22:25835843-25835865 CAAGTTTGGAGATGGCTTCTGGG + Intronic
1183440758 22:37822001-37822023 CATGTTTAGAAAAGGTTCCTAGG - Intergenic
1184696959 22:46145224-46145246 CATGTTTGACAAAGTTTTCTGGG - Intergenic
1184910370 22:47528373-47528395 GATCTTTTGAAAAGGAATCTCGG + Intergenic
1185362286 22:50415552-50415574 CATTTTTGGATAAGGAATTTAGG + Intronic
1203325584 22_KI270738v1_random:12232-12254 CATGTTTGCAACAGCATTATTGG + Intergenic
950018773 3:9771509-9771531 CATGTTTTGAATAGTGTTCTAGG - Intronic
951014696 3:17717746-17717768 CATGTTTTGAAAAGGAGTAAAGG - Intronic
951085774 3:18511027-18511049 CATGTTTGGAATTGCATTTTTGG + Intergenic
952787659 3:37171636-37171658 CTAGTTTGCAAAAGGATTTTTGG + Intronic
954136902 3:48586054-48586076 CAGGTTTGGAAGAGGCCTCTGGG - Exonic
957754399 3:84467844-84467866 CATGTCTGGAAAATTATTGTGGG - Intergenic
960048152 3:113216775-113216797 GATGTTTGGGACAGGATTATTGG + Intronic
960555893 3:119030088-119030110 TATATTTAGAAAAGGATTCCTGG - Intronic
961761422 3:129171841-129171863 TATTTTTGGAAAATTATTCTGGG + Intronic
962207662 3:133448133-133448155 AATGTTTGTTAAAGGATCCTTGG + Intronic
963337180 3:143988519-143988541 CATTTTTGGAAGAGGAAACTGGG - Intronic
964004095 3:151809274-151809296 CTTTTCTGGAATAGGATTCTTGG + Intergenic
967745420 3:193049634-193049656 CAAATTTGGAAATGGAATCTAGG + Intergenic
967778091 3:193405356-193405378 CATGAGTAGAAAAAGATTCTGGG - Intronic
967798517 3:193626951-193626973 CATGTTTGGAAGAGACTTTTGGG + Intronic
969942997 4:10753654-10753676 CATTTTTGGAAAAAGATGCTGGG - Intergenic
970728584 4:19076407-19076429 CATGTTTGTAAGAGGATATTAGG - Intergenic
971628404 4:28955400-28955422 CTTATTGGGAAAAGGAGTCTTGG + Intergenic
974500672 4:62697340-62697362 GATTTTAGGAAAAGGTTTCTGGG + Intergenic
974884564 4:67802746-67802768 AATTTTTGGAAGTGGATTCTAGG - Intergenic
975660994 4:76689242-76689264 AAGGTTTGAAAACGGATTCTGGG - Intronic
977146249 4:93443933-93443955 CATTTTTGGAAAATGACTGTGGG + Intronic
977935538 4:102799098-102799120 CATTTTTGGAAAAACATGCTTGG + Intronic
978124988 4:105124788-105124810 GATGTTTGGAAAATGTTTATAGG - Intergenic
979119599 4:116880696-116880718 GATTGTTGGAAAAGGATTATTGG + Intergenic
979487019 4:121281739-121281761 CATATTTGGAAAAGTATTGAAGG + Intergenic
980152361 4:129062652-129062674 CTTGTTGGGTAAAGCATTCTTGG + Intronic
981811885 4:148784742-148784764 CAAGTTGGGAATAGGTTTCTGGG - Intergenic
981978344 4:150759455-150759477 CATGTATGGAAAAGCATTCCAGG - Intronic
982876300 4:160655076-160655098 TATATGAGGAAAAGGATTCTGGG - Intergenic
983264131 4:165489560-165489582 GGAGTTTGGAAAAGGCTTCTTGG + Intronic
983600962 4:169526991-169527013 CATCTCTGGAAATGGATTTTTGG - Intronic
983857576 4:172664416-172664438 TATGTTTGGAAAAGAAATGTAGG - Intronic
983955071 4:173687866-173687888 CAATTTTGGAAAAAGATTCAAGG + Intergenic
984125288 4:175800880-175800902 CATGTATGGAAAATGATTTTTGG + Intronic
984200080 4:176708508-176708530 AATGTTTATAAAAGGATCCTTGG + Intronic
984960829 4:185096082-185096104 CATGTTTTCAAAATGATTGTAGG + Intergenic
985240099 4:187921390-187921412 AATGTTTGGAAATGAATTATAGG + Intergenic
986470447 5:8068472-8068494 CTTGTAAGGAAAAGGATTTTTGG + Intergenic
987702538 5:21419538-21419560 CAAGTTTGGGAAAGGTTTATGGG + Intergenic
988251539 5:28764621-28764643 GATGTTTGATAAAAGATTCTGGG - Intergenic
988947240 5:36217470-36217492 GATGTTTGAGAAAAGATTCTTGG - Intronic
989000126 5:36751319-36751341 CATATTTGGAAAATCATTATGGG - Intergenic
989391922 5:40909591-40909613 CATGTTTGGGAAAACATTCAGGG - Exonic
989602949 5:43216868-43216890 CAAGGTAGGAAAAGGATTTTGGG + Intronic
991000980 5:61782912-61782934 AATGTTTGGATGAGAATTCTGGG - Intergenic
994767761 5:103941038-103941060 TTTGTTTGGAAAAAGTTTCTGGG - Intergenic
995161135 5:108983803-108983825 CATTTTTGGAAGAAGAATCTGGG - Intronic
996137214 5:119858134-119858156 AATGGTTGGAAAAAGATACTTGG + Intergenic
996456637 5:123691870-123691892 GATGTTTGCAATAGGATTCACGG + Intergenic
996554340 5:124762629-124762651 CATTTTTAGAAAAAGAGTCTGGG + Intergenic
997785171 5:136704029-136704051 CATGTTTTGAAAATAAGTCTGGG + Intergenic
998172627 5:139881440-139881462 CAGGTTTGGACTAGGAGTCTGGG - Intronic
1001610810 5:173000100-173000122 CATGTTTTGAAATGCATTCATGG + Intronic
1003214496 6:4096988-4097010 TATGTTTGGAAATGGCATCTTGG - Intronic
1003971783 6:11307218-11307240 CCTGTTTGGAAAGGAGTTCTAGG - Intronic
1004176346 6:13343580-13343602 CATTTTTGAAAAAGGAAACTAGG - Intergenic
1005869384 6:29962889-29962911 CAAGTTTGGATAAGGATTTAAGG - Intergenic
1006150615 6:31985221-31985243 CATGTTGGGAAAAGGACTTGTGG - Intronic
1006156916 6:32017959-32017981 CATGTTGGGAAAAGGACTTGTGG - Intronic
1007517982 6:42428786-42428808 AATGTTTAGAAAAGAATGCTGGG + Intronic
1007865615 6:44966228-44966250 AATCTTTGGAAAAAGATTCAAGG + Intronic
1008201576 6:48597660-48597682 CAGTTTTGGAAGAGGATCCTGGG + Intergenic
1009246255 6:61242343-61242365 CATAAATGGAAAAGGATGCTTGG + Intergenic
1009434134 6:63598927-63598949 CATATAGGGAAGAGGATTCTGGG + Intergenic
1010098669 6:72077104-72077126 CATGTGGGGAAGAGGATTCCAGG - Intronic
1010302614 6:74279815-74279837 GATGCTTTGAAAAGGATTGTTGG + Intergenic
1010847653 6:80730052-80730074 AAAGTTTGGAAAAGCAGTCTTGG + Intergenic
1012102198 6:95104420-95104442 TATGTTTGGGGAAGGATCCTAGG + Intergenic
1012634482 6:101519230-101519252 AAAGTTTGGAAAAAGATTCATGG + Intronic
1013482427 6:110563963-110563985 CATGTTTGGATAAGGATTATGGG - Intergenic
1013777417 6:113693830-113693852 GATGTTTGGAAATGGAGTATTGG - Intergenic
1013852910 6:114537591-114537613 CAAGCTTGGAAAAGGATCCCTGG - Intergenic
1015430425 6:133124322-133124344 CATGTCTGTAAAAGGCTTATGGG + Intergenic
1017543922 6:155430916-155430938 CAGGCTTGGAAATGGATTTTAGG - Exonic
1018543212 6:164906973-164906995 CAATTTTGTAAAAGGTTTCTTGG - Intergenic
1018628566 6:165803787-165803809 CATGTATGGAAAAGTATACAAGG - Intronic
1020047359 7:5050869-5050891 TATCTTTAGAAAAGTATTCTAGG - Intronic
1020477853 7:8619959-8619981 CATATTTGGGAAAGGACACTTGG - Intronic
1022809864 7:33858280-33858302 CTTAATTGGAAAAAGATTCTTGG + Intergenic
1023017379 7:35981707-35981729 CATGTGGGGAAAAGGAGTATAGG - Intergenic
1024828759 7:53423084-53423106 CATGTTTAGAATAGAATTTTAGG + Intergenic
1026727876 7:72884197-72884219 TATCTTTAGAAAAGTATTCTAGG - Intronic
1027115964 7:75481530-75481552 TATCTTTAGAAAAGTATTCTAGG + Intronic
1027121207 7:75522839-75522861 TATCTTTAGAAAAGTATTCTAGG + Intergenic
1028620042 7:92815296-92815318 CTTGTTTGGCATAGGAATCTTGG - Intronic
1029721572 7:102368720-102368742 TATCTTTAGAAAAGTATTCTAGG - Intronic
1029845569 7:103408745-103408767 GATGTTTGGGAAAGGAACCTAGG + Intronic
1030875635 7:114810008-114810030 CATGGTAGGAAGAGGCTTCTAGG - Intergenic
1032340968 7:131072710-131072732 CATGTATAGAAAAGGATTCTGGG - Intergenic
1032936833 7:136742361-136742383 CATGTTGGGAAAAATATTTTGGG + Intergenic
1033277825 7:139985930-139985952 CATGTTGGGAACAGGCTCCTGGG - Intronic
1033620327 7:143056754-143056776 CATGTGTGAGAATGGATTCTTGG - Intergenic
1033834553 7:145293316-145293338 CAAGTTTGAAATAGGATCCTAGG - Intergenic
1033899215 7:146115887-146115909 CAGGTTTGGAGCAGGGTTCTAGG + Intergenic
1034568042 7:151930944-151930966 CATCACTGGAAAAGGATTCCTGG + Intergenic
1035270105 7:157714776-157714798 CATGCTTCTGAAAGGATTCTAGG + Intronic
1036067521 8:5398773-5398795 CATGATTAGACAAGGATTGTGGG - Intergenic
1036985425 8:13523502-13523524 CAAGTTTGGAAAAGAGATCTGGG + Intergenic
1037711366 8:21358058-21358080 AATATTTGGTAAAGTATTCTTGG - Intergenic
1038324631 8:26563426-26563448 CATGTCTGGAAAAAGATATTGGG - Intronic
1039404748 8:37302923-37302945 CATGTTGGGAATAGGATTATGGG + Intergenic
1040688178 8:49901853-49901875 GTTGTTTGGAAAAGGAATCATGG + Intergenic
1041405578 8:57495698-57495720 CATATTTGCAAAATGTTTCTTGG - Intergenic
1042282721 8:67071771-67071793 TGTGTTTGGAAAAAAATTCTAGG + Intronic
1044089984 8:87988633-87988655 GCTGGGTGGAAAAGGATTCTGGG - Intergenic
1044235517 8:89825723-89825745 CATGTTTGGAAGAAGATTTAGGG + Intergenic
1047146781 8:122209745-122209767 TATGATTGGAAAAGGATCCATGG + Intergenic
1047597012 8:126387808-126387830 CATGTTGGTAATAGAATTCTTGG + Intergenic
1050150782 9:2617661-2617683 TATGTTTGGAAAATGCTTCAAGG + Intergenic
1050159156 9:2699020-2699042 CAGGGTTGGGAATGGATTCTTGG - Intergenic
1051799084 9:20911035-20911057 CTTTTTTGGAAAAGCATTATAGG + Intronic
1051931076 9:22386866-22386888 CATGTTTACCAAAGGATTTTTGG + Intergenic
1055141493 9:72881936-72881958 CTTGTTTGGAGAAGGTTTCAAGG + Intergenic
1055370706 9:75595377-75595399 AATGTTTGGGAAGGGATGCTGGG + Intergenic
1055575953 9:77660435-77660457 CTTGTTTGGGAAAGGAGTCTTGG + Intergenic
1055630693 9:78220490-78220512 CCTGTTTGGACAAGGTATCTTGG - Intergenic
1055801310 9:80039227-80039249 CACATTTGGACAGGGATTCTGGG + Intergenic
1056106189 9:83349073-83349095 CATGTTGTGAGCAGGATTCTAGG - Intronic
1057345367 9:94245910-94245932 CAAGTTGTGAAAAGGATTGTTGG + Intergenic
1058674795 9:107391067-107391089 CATGTTTGGGAAAGAATTTACGG + Intergenic
1059650690 9:116313299-116313321 CATGTTTGGAAAAGGATTCTGGG - Intronic
1060518517 9:124280637-124280659 CATGTTTGGAAAGCTATTCCTGG + Intronic
1186460592 X:9745525-9745547 CATGTCTGGGAAAGACTTCTAGG - Intronic
1189456169 X:41192569-41192591 AATGTTTAGAAAAGGAGTCAAGG + Intronic
1189559132 X:42174767-42174789 CATCTTTGGAAGAGGCTGCTTGG + Intergenic
1189636022 X:43010203-43010225 CATTTTTGGACAACGATTCCTGG + Intergenic
1189849026 X:45160833-45160855 CATTTTAGGAAAGTGATTCTGGG + Intronic
1192265729 X:69536628-69536650 CAGGTCTTGAAAAGGATTCAAGG - Intergenic
1194324543 X:92496832-92496854 AATGGGTGGAAAAGCATTCTAGG - Intronic
1194619596 X:96153585-96153607 GATTTTTTAAAAAGGATTCTTGG - Intergenic
1195063964 X:101222396-101222418 CATGTTTAGAAATGCATTGTTGG - Intronic
1197591649 X:128417793-128417815 CATGTCTGGAAATGGATTGGAGG - Intergenic
1197779046 X:130141369-130141391 CATGTGTGGAAAAGGAGAATCGG + Intronic
1198214000 X:134539907-134539929 TATGTTTGAAAAAGTATTCTAGG + Intergenic
1198739563 X:139826886-139826908 CATGCTTGGACAAGAATTATGGG - Intronic
1200633286 Y:5616041-5616063 AATGGGTGGAAAAGCATTCTAGG - Intronic
1200768942 Y:7105876-7105898 CATGCTTGGAAAAGCCTCCTGGG - Intergenic
1201333865 Y:12858153-12858175 TATATTTGGGAAAAGATTCTGGG + Intronic
1202046904 Y:20744583-20744605 CATCCTTGGAAAAGACTTCTGGG - Intergenic