ID: 1059650691

View in Genome Browser
Species Human (GRCh38)
Location 9:116313300-116313322
Sequence TCATGTTTGGAAAAGGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 250}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059650691_1059650698 3 Left 1059650691 9:116313300-116313322 CCAGAATCCTTTTCCAAACATGA 0: 1
1: 0
2: 3
3: 21
4: 250
Right 1059650698 9:116313326-116313348 ATATGTGCAGGTGGTGAAAGGGG No data
1059650691_1059650697 2 Left 1059650691 9:116313300-116313322 CCAGAATCCTTTTCCAAACATGA 0: 1
1: 0
2: 3
3: 21
4: 250
Right 1059650697 9:116313325-116313347 CATATGTGCAGGTGGTGAAAGGG No data
1059650691_1059650694 -9 Left 1059650691 9:116313300-116313322 CCAGAATCCTTTTCCAAACATGA 0: 1
1: 0
2: 3
3: 21
4: 250
Right 1059650694 9:116313314-116313336 CAAACATGACTCATATGTGCAGG No data
1059650691_1059650696 1 Left 1059650691 9:116313300-116313322 CCAGAATCCTTTTCCAAACATGA 0: 1
1: 0
2: 3
3: 21
4: 250
Right 1059650696 9:116313324-116313346 TCATATGTGCAGGTGGTGAAAGG No data
1059650691_1059650699 12 Left 1059650691 9:116313300-116313322 CCAGAATCCTTTTCCAAACATGA 0: 1
1: 0
2: 3
3: 21
4: 250
Right 1059650699 9:116313335-116313357 GGTGGTGAAAGGGGACACTTCGG No data
1059650691_1059650695 -6 Left 1059650691 9:116313300-116313322 CCAGAATCCTTTTCCAAACATGA 0: 1
1: 0
2: 3
3: 21
4: 250
Right 1059650695 9:116313317-116313339 ACATGACTCATATGTGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059650691 Original CRISPR TCATGTTTGGAAAAGGATTC TGG (reversed) Intronic
900769845 1:4531973-4531995 TCATCTCTGGGCAAGGATTCAGG + Intergenic
902057758 1:13616611-13616633 TCATGGCTGGAGAAGGATTTGGG - Exonic
902867866 1:19292367-19292389 TTATGTTTGGAAAATGAGTAAGG + Intergenic
903736452 1:25532739-25532761 TCAGGTCTGGAAAAGAATGCTGG + Intergenic
907083173 1:51643711-51643733 TCATGTTTTGAAAAGACTCCTGG + Intronic
908413538 1:63890102-63890124 TCATTTTAGGGAAAGAATTCAGG + Intronic
910149385 1:84124419-84124441 TAATGTGTGTAAAAGCATTCTGG - Intronic
910561693 1:88598472-88598494 TCAAGTCTGGAAATGGATTAAGG - Intergenic
912130123 1:106589572-106589594 TCATGTCTGGAAATTGATTGAGG + Intergenic
914254279 1:145948507-145948529 TCTGGGTTGGAAAAGGAATCTGG - Intronic
916061802 1:161103970-161103992 TCATGTTTTTAAAATGATTCAGG - Intronic
916097389 1:161363338-161363360 TCATCATTGGAAAAGTTTTCAGG + Exonic
917191824 1:172426202-172426224 CCACCTTTGGAAAAGGATGCAGG - Intronic
917776751 1:178345440-178345462 TAATCTTTGGAATTGGATTCAGG - Intronic
918368105 1:183830660-183830682 TCTTGTTGGGAAAAGAATTCTGG + Intronic
919437719 1:197583715-197583737 TCATGATTGCAAAACAATTCAGG + Intronic
919641738 1:200052051-200052073 TCATGTTTTTAAAAAAATTCTGG + Intronic
919739615 1:200973896-200973918 TCATGCTTGGAAAAGGACGGTGG + Exonic
919973265 1:202594355-202594377 TCATGAATGGAAAAGAATCCAGG + Exonic
920692637 1:208158685-208158707 TCCTGTTTGGAGAGGGATTTTGG + Intronic
923218573 1:231872782-231872804 TCATGTATGGAAAATGAGTTGGG - Intronic
923664418 1:235986983-235987005 TAATGTGTGGAAAAGGACTCTGG - Intronic
1062972830 10:1661712-1661734 GCAGGTTTGGAAGAGGATCCTGG - Intronic
1064638194 10:17389756-17389778 TCATGTTCTCAAAAGGATTGGGG + Intronic
1064991135 10:21258035-21258057 TTTTGTTTGGAAGATGATTCCGG + Intergenic
1065634812 10:27720670-27720692 TAATGTTTGCAGAAGGTTTCTGG - Intronic
1067450208 10:46377407-46377429 TCATCTGTGGATAAGGATACTGG - Intronic
1067587034 10:47482356-47482378 TCATCTGTGGATAAGGATACTGG + Intronic
1067634094 10:47990123-47990145 TCATCTGTGGATAAGGATACTGG + Intergenic
1072125272 10:92440117-92440139 TCAGGTATGGAACAGGATCCTGG - Intergenic
1072518329 10:96208514-96208536 TCTAGTTTGCAAAATGATTCAGG + Intronic
1073065032 10:100753257-100753279 TCATATTTTGGAAAGAATTCTGG + Intronic
1073195823 10:101690782-101690804 TCATGTTTCCAAAAACATTCAGG + Intronic
1073518869 10:104106314-104106336 TCATGTTTGGAGAAAGGTACAGG - Intergenic
1075189951 10:120297870-120297892 TTATGTTTGGAAAAGGTGGCCGG + Intergenic
1075499616 10:122960996-122961018 ACATGTTTGGAACAGGAATCTGG + Intronic
1075970234 10:126645699-126645721 TCAGTTTTGGAAAGGAATTCAGG + Intronic
1079984686 11:27188025-27188047 ACATGTTTGGAGAAATATTCAGG - Intergenic
1080771055 11:35342025-35342047 TAATGTTTGGAAAGAAATTCTGG + Intronic
1081598989 11:44479253-44479275 TCATTTAGGGAAAAGGAATCTGG + Intergenic
1083267553 11:61553786-61553808 TAATGTTTGGAAATGGGATCTGG + Intronic
1084665482 11:70574002-70574024 CCATGTTTGGAGAAGGACCCGGG - Intronic
1085132853 11:74056676-74056698 TCATCCTTGGAAAAGACTTCTGG - Intronic
1086095818 11:83049113-83049135 TAATGTTTGCAAAAAGATGCTGG + Intronic
1087918839 11:103842913-103842935 TGATGTTTCGCAAAAGATTCAGG + Intergenic
1089903397 11:122012073-122012095 TCAAGTTTGGAAATTGATTGAGG - Intergenic
1091177868 11:133578111-133578133 TCAAGTGTTGACAAGGATTCGGG + Intergenic
1093871896 12:24302764-24302786 TCATATTTGGAGACTGATTCTGG - Intergenic
1094662372 12:32482186-32482208 TCATGTTTGAAATAGGAATAAGG + Intronic
1098444115 12:70548676-70548698 TCATTTTTGGAAAAGTTTTAAGG - Intronic
1099759596 12:86900530-86900552 TGAAGTTTGTAAAAGCATTCAGG - Intergenic
1101135729 12:101741007-101741029 TAATATTTGGCAAAGGCTTCAGG + Intronic
1101296934 12:103434007-103434029 CCATGTTTGGTAGAGCATTCAGG - Intronic
1103307321 12:119975534-119975556 CCATGTTTGGAAAACCATTGGGG - Intergenic
1108450493 13:50557919-50557941 TCATGTTTCGAAAAGGCTGCTGG - Intronic
1108670837 13:52686537-52686559 TCATGTTTGGAAGATGACTAAGG + Intronic
1109704906 13:66077675-66077697 TCATGTCTGGAAATTGATTGAGG - Intergenic
1110690984 13:78429569-78429591 TCAATTTTGGATAAGGATTTAGG + Intergenic
1112725317 13:102297172-102297194 TCATGTTTAGAAGAGTATTATGG - Intronic
1114150685 14:20035296-20035318 CCATGTTTTGAAATGGACTCTGG + Intergenic
1115425568 14:33255006-33255028 TCATTTCTGGAAAAGTATTAAGG + Intronic
1118606819 14:67510353-67510375 TGATGGTTGGCAAAGGCTTCAGG - Intronic
1118902281 14:69996580-69996602 TCATGTTGAGAAATGGATTCTGG + Intronic
1118980639 14:70713498-70713520 TCAGCTCTGGAAAAGAATTCTGG + Intergenic
1119012777 14:71013294-71013316 TCATGTTGGGAAATGTTTTCTGG + Intronic
1120183154 14:81366395-81366417 TCTTGTTTGGAGAGGGATTACGG - Intronic
1120764336 14:88314946-88314968 TCATGCTTGGATTAGGACTCAGG + Intronic
1120995680 14:90417065-90417087 TCATTTTTGAGAAAGGATTCTGG + Intergenic
1121346643 14:93141053-93141075 GCATGTCTGGGAAAGGCTTCTGG + Intergenic
1122475450 14:102005308-102005330 TCATGCTTGAAAAAGGTTTCAGG + Intronic
1124244382 15:28057118-28057140 ACATGTTTCAGAAAGGATTCTGG + Intronic
1125642666 15:41244347-41244369 CAATGTTTGGGAAAGGATTATGG - Intronic
1127762266 15:62150888-62150910 CCATCTTTGGAAAAAAATTCTGG + Intergenic
1128259351 15:66221676-66221698 TCAAGTTTGGAAAAAGATAAGGG - Intronic
1129331098 15:74827701-74827723 TCATGTGGGGAAAAGTATTCAGG - Intronic
1130709296 15:86264052-86264074 TCATGTTTGGAAGGGGCTTTTGG - Intronic
1131451815 15:92547646-92547668 TCATGTTTGGAGTAGGAGTAGGG + Intergenic
1132329622 15:101003204-101003226 ACATGCTTGGAAATGGTTTCTGG - Intronic
1135061888 16:19278020-19278042 TCAAGTCTGGAAAATGATTGAGG + Intergenic
1136402812 16:30027859-30027881 TCATGTTTGGTGATGGCTTCTGG - Intronic
1136581849 16:31157071-31157093 TCATGTTTTTTAAAGGATTTTGG + Intergenic
1137469078 16:48738484-48738506 GCATGCTGGGAAAAGGACTCTGG + Intergenic
1137726680 16:50661359-50661381 TCATGTTTAAAAAAGAAATCAGG + Intergenic
1137856473 16:51799275-51799297 TCATGTTTGGAAAAGTTCTGGGG + Intergenic
1144286665 17:13782054-13782076 TCAACTTTGGAAAAGTATTTTGG + Intergenic
1146090175 17:29869111-29869133 CCATCTTAGGAAAAGGATTTTGG + Intronic
1149344565 17:55721448-55721470 CCATCTTTGGATTAGGATTCAGG - Intronic
1150139054 17:62713326-62713348 TCAGGTTTGTCAAAGCATTCAGG + Intronic
1151236545 17:72724221-72724243 CCAGGTTTGGACAAGGACTCTGG + Intronic
1153404618 18:4722747-4722769 TCTTGTTGGAAAATGGATTCTGG - Intergenic
1157137565 18:45071672-45071694 TTAAGTTTGGAAATGGATTCTGG - Intergenic
1157203002 18:45675270-45675292 TAATATTTGGAAAAGTATTTTGG - Intronic
1158065424 18:53401490-53401512 TCATATTTGGAACACTATTCAGG + Intronic
1160014324 18:75128866-75128888 TCTTGATGGGAAAAGGATTGAGG - Intergenic
1160892777 19:1387957-1387979 TCATGTTAGGGACAGGATGCAGG + Intronic
1161802827 19:6425339-6425361 TCAGGGATAGAAAAGGATTCTGG - Intergenic
1164695798 19:30242533-30242555 TCATGGATGGAAAAGGATGGAGG - Intronic
1164927072 19:32139143-32139165 TGATTTATGGAAAAGGAGTCTGG - Intergenic
1165362888 19:35347494-35347516 TCTTGTTAGGAAAAGCATACTGG + Intergenic
1166500737 19:43339281-43339303 TCATGTTGAGAAAAGGAATATGG + Intergenic
925016422 2:528509-528531 TCATGTTTAGAAAAATATTTAGG - Intergenic
925428979 2:3774700-3774722 TCGTGTCTGGAAAGGGATTCAGG + Intronic
925693493 2:6549442-6549464 TCATGTCTGGATAAGGAGTATGG - Intergenic
926326467 2:11788438-11788460 TCACCTTTGGCAAAGGTTTCTGG - Exonic
927348970 2:22083924-22083946 TTTTTTTTGGAGAAGGATTCTGG + Intergenic
929610253 2:43265726-43265748 TTGTGTTTGGAAAAGGATTCGGG - Intronic
932922511 2:75933249-75933271 TCAAGTTTGGAAAATGTTCCAGG - Intergenic
939288010 2:140157374-140157396 GCAGATTTGGAAAGGGATTCAGG - Intergenic
941324384 2:164095093-164095115 TCATGAATGGACAAGGATTATGG + Intergenic
942889829 2:180976633-180976655 ACATGTTTCGAAAAGGAATTTGG - Intronic
943077607 2:183215099-183215121 TCAAGTTCAGAACAGGATTCAGG + Intergenic
943856222 2:192795858-192795880 TCAAGGCTGGAAGAGGATTCAGG - Intergenic
944982874 2:205142303-205142325 TCATGTTTAGTAAAGGAAACTGG - Intronic
945566259 2:211403907-211403929 TCATGTTAGGCAAAGGAAACTGG - Intronic
946389256 2:219405522-219405544 TCAAGTTTCCAAAAAGATTCCGG - Intergenic
946854164 2:223936363-223936385 TCATGTCTGTAAAAGGACTTTGG - Intronic
946930807 2:224668681-224668703 TCAGTTTTGGAAAACGATGCAGG - Intergenic
946971151 2:225093216-225093238 CCATTTCTGGAAAAGGAATCGGG - Intergenic
947097706 2:226585024-226585046 TCATGGTGGAAAAGGGATTCTGG + Intergenic
948646395 2:239407737-239407759 GCCTGTTTGGAAATGGCTTCGGG + Intergenic
1169743028 20:8915850-8915872 ATATGTTTGGAAAAGGATTGTGG - Intronic
1171981195 20:31630502-31630524 ACATGTCTGGAAATGGATGCTGG + Intergenic
1176955678 21:15100438-15100460 CCATGTTTGGATAAGGAATCAGG + Intergenic
1177233422 21:18352963-18352985 TAATGAATGGGAAAGGATTCAGG - Exonic
1177578925 21:22994323-22994345 TCACGTTTGGATAAGTATTCAGG - Intergenic
1177814024 21:25956606-25956628 TCATGTTGGGAATAGAATTTTGG + Intronic
1177911768 21:27041608-27041630 TCATTTTTGGAGAAGGAATTTGG + Intergenic
1179124777 21:38581109-38581131 TCAAGTTTGGAAAGGCACTCTGG + Intronic
1179343929 21:40538472-40538494 TCATCTTTTGAAAACAATTCTGG + Intronic
1184696960 22:46145225-46145247 TCATGTTTGACAAAGTTTTCTGG - Intergenic
1184814321 22:46859107-46859129 ACCTCTATGGAAAAGGATTCTGG - Intronic
1184814346 22:46859210-46859232 ACCTCTATGGAAAAGGATTCTGG - Intronic
1184814371 22:46859313-46859335 ACCTCTATGGAAAAGGATTCTGG - Intronic
1184814384 22:46859364-46859386 ACCTCTATGGAAAAGGATTCTGG - Intronic
1184814409 22:46859467-46859489 ACCTCTATGGAAAAGGATTCTGG - Intronic
1184814422 22:46859518-46859540 ACCTCTATGGAAAAGGATTCTGG - Intronic
1184814446 22:46859621-46859643 ACCTCTATGGAAAAGGATTCTGG - Intronic
1184814459 22:46859672-46859694 ACCTCTATGGAAAAGGATTCTGG - Intronic
1184814483 22:46859775-46859797 ACCTCTATGGAAAAGGATTCTGG - Intronic
1184814495 22:46859826-46859848 ACTTTTATGGAAAAGGATTCTGG - Intronic
1184814518 22:46859929-46859951 ACCTCTATGGAAAAGGATTCTGG - Intronic
1184814530 22:46859980-46860002 ACCTCTATGGAAAAGGATTCTGG - Intronic
1184814542 22:46860031-46860053 ACCTCTATGGAAAAGGATTCTGG - Intronic
1184814566 22:46860134-46860156 ACCTCTATGGAAAAGGATTCTGG - Intronic
1184814579 22:46860185-46860207 ACCTCTATGGAAAAGGATTCTGG - Intronic
1184814602 22:46860288-46860310 ACCTCTATGGAAAAGGATTCTGG - Intronic
1184814626 22:46860391-46860413 ACCTCTATGGAAAAGGATTCTGG - Intronic
1184814639 22:46860442-46860464 ACCTCTATGGAAAAGGATTCTGG - Intronic
1184814651 22:46860493-46860515 ACCTCTATGGAAAAGGATTCTGG - Intronic
1185021553 22:48379655-48379677 TCATGTATGGAAGAGGACGCAGG - Intergenic
949497768 3:4649336-4649358 TCATTTTTTAAAATGGATTCTGG + Intronic
951403626 3:22266194-22266216 TCTTGTTTGGAAGAGGAGCCAGG + Intronic
951826092 3:26870677-26870699 TGTTGTTTGTAAATGGATTCTGG + Intergenic
953464663 3:43109118-43109140 TCATGTTTTGAAAACTATTCTGG + Intergenic
954136903 3:48586055-48586077 TCAGGTTTGGAAGAGGCCTCTGG - Exonic
954511746 3:51131518-51131540 TCAAGTCTGGAAATTGATTCGGG + Intronic
955625918 3:60919147-60919169 TCATGTCAGGCTAAGGATTCTGG + Intronic
957754400 3:84467845-84467867 TCATGTCTGGAAAATTATTGTGG - Intergenic
958968834 3:100588587-100588609 GCATATTTGGAAAAAAATTCAGG - Intergenic
961248400 3:125477584-125477606 TCATGTTTGAGTAAGGAATCAGG - Intronic
961613795 3:128162979-128163001 TCCAGGTTGGAATAGGATTCGGG + Intronic
964894912 3:161583944-161583966 ACATCTTTGGAAAAGTAGTCTGG - Intergenic
967778092 3:193405357-193405379 TCATGAGTAGAAAAAGATTCTGG - Intronic
967798516 3:193626950-193626972 TCATGTTTGGAAGAGACTTTTGG + Intronic
969942998 4:10753655-10753677 CCATTTTTGGAAAAAGATGCTGG - Intergenic
971230295 4:24795894-24795916 TAGTGTTAGGAAAAGGAATCTGG + Intronic
971480276 4:27108794-27108816 TGATGTTTTGTAAAGGATGCAGG + Intergenic
972011377 4:34187130-34187152 TCATGTTGAGAATAGGATACAGG - Intergenic
972041279 4:34603393-34603415 TCATGGTTGAGAAAGAATTCAGG + Intergenic
972408626 4:38769251-38769273 TCATGTTTTAAAAATGACTCTGG - Intergenic
972805669 4:42527801-42527823 TCAAGTTTGGAAATTGATTGAGG - Intronic
974791416 4:66695181-66695203 TGAGGTCTGGAAAAAGATTCTGG + Intergenic
975660995 4:76689243-76689265 TAAGGTTTGAAAACGGATTCTGG - Intronic
977635252 4:99291037-99291059 TCATGTGTGGAACTGGAATCGGG - Intergenic
977856637 4:101903243-101903265 TCATTTTAGGAAAATGATTATGG + Intronic
977971200 4:103216240-103216262 TCATGTATGGAAAATTATACGGG + Intergenic
981811886 4:148784743-148784765 TCAAGTTGGGAATAGGTTTCTGG - Intergenic
982725886 4:158905611-158905633 AGATGTTTTGAAAAGGATGCAGG - Exonic
982861427 4:160455062-160455084 TCATGTTTGGAAAAAAAATTGGG + Intergenic
984925469 4:184802693-184802715 TCATGTTAGGAAAATGAAACTGG - Intronic
986902740 5:12457202-12457224 TCATGTTTGTAAAATGTTTTTGG + Intergenic
987226841 5:15850844-15850866 GGATGTTTGAAAAAGGATTCAGG - Intronic
988178928 5:27764617-27764639 TCATGTTTGAAGAAGTATTACGG - Intergenic
989391923 5:40909592-40909614 TCATGTTTGGGAAAACATTCAGG - Exonic
989602948 5:43216867-43216889 TCAAGGTAGGAAAAGGATTTTGG + Intronic
990676418 5:58191230-58191252 TTATGATTGGTAAAGAATTCTGG - Intergenic
991025097 5:62020526-62020548 TCATATTGAGAAAAGGATGCAGG + Intergenic
992240365 5:74763126-74763148 TAGTGTTTTGAAGAGGATTCAGG + Intronic
992975667 5:82116699-82116721 TCCTGATTGAAATAGGATTCGGG - Intronic
992975738 5:82117664-82117686 TCCTGATTGAAATAGGATTCTGG - Intronic
993078833 5:83270477-83270499 TCATGCATGCAAAAGGATTATGG - Intronic
993783569 5:92100077-92100099 TGATGTTTGGAAAGTAATTCAGG - Intergenic
994015921 5:94965379-94965401 TCTGGTTTGGAAAATGATTCAGG + Intronic
995908849 5:117161135-117161157 TCAGGTTGGAAAAATGATTCAGG - Intergenic
996554339 5:124762628-124762650 TCATTTTTAGAAAAAGAGTCTGG + Intergenic
1000168681 5:158679942-158679964 AAATGTTTGGGAAAGGAATCAGG - Intergenic
1007568709 6:42873585-42873607 ACGTGTTAGGAAAGGGATTCTGG + Intergenic
1008201575 6:48597659-48597681 TCAGTTTTGGAAGAGGATCCTGG + Intergenic
1009717521 6:67418478-67418500 TCATCTTTGCAAAATCATTCTGG - Intergenic
1010582524 6:77617339-77617361 TAAAGTTTGGAAAAGGAGTCTGG - Intergenic
1012001714 6:93662915-93662937 TCAAGTTTGGAAATTGATTGAGG - Intergenic
1012122191 6:95383355-95383377 GCAAGTTTGGAAAAGCGTTCAGG + Intergenic
1012595562 6:101034327-101034349 TCAATTTTGGAAAATGCTTCTGG + Intergenic
1012649371 6:101734555-101734577 TCATGTTTGTCAAAGTATTTGGG + Intronic
1012716913 6:102686086-102686108 TCATATTTGGAAAAATATTTAGG + Intergenic
1013482428 6:110563964-110563986 TCATGTTTGGATAAGGATTATGG - Intergenic
1013578558 6:111509525-111509547 TCTTGCTTAGAAAAGGATTTTGG - Intergenic
1015292155 6:131549500-131549522 TCATGTCTGGAAAATGAGTGGGG + Intergenic
1015430424 6:133124321-133124343 TCATGTCTGTAAAAGGCTTATGG + Intergenic
1016740109 6:147518003-147518025 TCGTGTTTTGAAAAGCATTTTGG - Intronic
1017204905 6:151794515-151794537 TCATGTTGAGAAAAGGACTTTGG - Intronic
1018453602 6:163931958-163931980 TCTTGCTTGTAAGAGGATTCAGG - Intergenic
1020857083 7:13442019-13442041 TGATGTTTGGAAAACTATTACGG - Intergenic
1021089834 7:16470687-16470709 TCAGGTTTGGAACTGGTTTCAGG - Intronic
1022016251 7:26350998-26351020 ACATTTTTGGAAAAGTATACAGG + Intronic
1022204341 7:28149091-28149113 TCATTTTTGGTGAAGGAATCAGG + Intronic
1024508189 7:50181191-50181213 TCACGTTTAGGAAAGGATTGAGG - Intergenic
1025223035 7:57132509-57132531 TCCTGATTGGATAAGGTTTCAGG + Intronic
1025633831 7:63304173-63304195 TCCTGATTGGATAAGGTTTCAGG + Intergenic
1025648865 7:63443995-63444017 TCCTGATTGGATAAGGTTTCAGG - Intergenic
1025974218 7:66356848-66356870 TCATGTATGGAAGAGGCTCCTGG - Exonic
1027780948 7:82519605-82519627 TCATAATGGGAAAAAGATTCAGG + Intergenic
1028469066 7:91185041-91185063 GTATTTTAGGAAAAGGATTCTGG + Intronic
1028703470 7:93811261-93811283 ACTTCTTTGGAAAAGGTTTCTGG + Intronic
1028918737 7:96288108-96288130 TCTAAGTTGGAAAAGGATTCTGG - Intronic
1032340969 7:131072711-131072733 TCATGTATAGAAAAGGATTCTGG - Intergenic
1032936832 7:136742360-136742382 TCATGTTGGGAAAAATATTTTGG + Intergenic
1034059707 7:148075660-148075682 ACATGGTTTGAAAAGGAATCTGG + Intronic
1036067522 8:5398774-5398796 TCATGATTAGACAAGGATTGTGG - Intergenic
1036985424 8:13523501-13523523 TCAAGTTTGGAAAAGAGATCTGG + Intergenic
1038238566 8:25785841-25785863 TCATGTTTGGAAATGGTCTTGGG + Intergenic
1038324632 8:26563427-26563449 TCATGTCTGGAAAAAGATATTGG - Intronic
1039145041 8:34437966-34437988 TCACCTTTGGATAAGTATTCAGG - Intergenic
1039404747 8:37302922-37302944 ACATGTTGGGAATAGGATTATGG + Intergenic
1041284574 8:56246712-56246734 TCATGTTCGACATAGGATTCTGG - Intergenic
1042545245 8:69945593-69945615 TTTTGTTTGCAAAAGGAGTCAGG - Intergenic
1043246354 8:78007335-78007357 TCATGTTATGAACAGGATTTTGG + Intergenic
1043704819 8:83335170-83335192 ATTTGTTGGGAAAAGGATTCTGG - Intergenic
1044089985 8:87988634-87988656 TGCTGGGTGGAAAAGGATTCTGG - Intergenic
1044216819 8:89621784-89621806 TCATATTTTGAAAAACATTCTGG - Intergenic
1044235516 8:89825722-89825744 ACATGTTTGGAAGAAGATTTAGG + Intergenic
1044634567 8:94309712-94309734 TCAAGTTTGGGAAATGATTCAGG + Intergenic
1046097939 8:109582520-109582542 TCAGGTTTGTAGAAGGGTTCAGG - Intronic
1047109759 8:121776458-121776480 TCATGTTTGCTCAATGATTCAGG + Intergenic
1048491682 8:134900012-134900034 TCAAGTTTTCAAAAGGATTCGGG + Intergenic
1051148680 9:14057918-14057940 TTATGTATGAAAAAGCATTCAGG + Intergenic
1051522284 9:18002565-18002587 TCATGTTTATGAAAAGATTCTGG + Intergenic
1052188905 9:25633287-25633309 GCATGTTTGGAAAGTGTTTCCGG + Intergenic
1052701686 9:31945199-31945221 TCTTCTTTGGAAAATGAATCTGG + Intergenic
1053800825 9:41763432-41763454 TCCTGTTTGCAAAAGGAAGCAGG - Intergenic
1054144370 9:61551408-61551430 TCCTGTTTGCAAAAGGAAGCAGG + Intergenic
1054189256 9:61975582-61975604 TCCTGTTTGCAAAAGGAAGCAGG - Intergenic
1054464059 9:65482365-65482387 TCCTGTTTGCAAAAGGAAGCAGG + Intergenic
1054649261 9:67613030-67613052 TCCTGTTTGCAAAAGGAAGCAGG + Intergenic
1055418551 9:76110775-76110797 TTATGTTTGGAAAAGATATCTGG - Intronic
1059507901 9:114816623-114816645 TCCTGTTTGGGAAATGACTCAGG + Intergenic
1059650691 9:116313300-116313322 TCATGTTTGGAAAAGGATTCTGG - Intronic
1059935418 9:119305634-119305656 GCATGTTTGGAAAGGCATGCTGG - Intronic
1060031539 9:120218670-120218692 ACATGTTAGGAAAAGCACTCTGG - Intergenic
1060208261 9:121695197-121695219 ACATGCTTGCAAAATGATTCTGG - Intronic
1203632085 Un_KI270750v1:80010-80032 TCAAGTTGGGAAAAGGACCCAGG - Intergenic
1187082384 X:16004972-16004994 TCATGTTTGTAAAGGCAATCTGG - Intergenic
1187583767 X:20637695-20637717 TCATTTGAGGTAAAGGATTCGGG - Intergenic
1188634314 X:32409484-32409506 TCTTATTTAGAAATGGATTCAGG - Intronic
1188940110 X:36227486-36227508 TCTTGTTTGATAAAGGATTTAGG + Intergenic
1189577912 X:42375176-42375198 ACATGCTTGCAAAATGATTCTGG + Intergenic
1191659027 X:63631531-63631553 TCAAGTATGGAAAATGATTGAGG + Intergenic
1192480631 X:71482127-71482149 TCATGTTTGGGGAAGGAAACTGG + Intronic
1194104097 X:89746949-89746971 TGATGTTTGCAAAATGATTAGGG + Intergenic
1195477240 X:105300990-105301012 ACATGCTTAGAAAAGAATTCAGG + Intronic
1195707852 X:107751016-107751038 TCACATGTGGAAAAGGAATCAGG - Intronic
1195962872 X:110403493-110403515 ACGTGTTTGGAGAAGGATCCGGG - Intronic
1196130155 X:112146773-112146795 TGATGTATGGAAAAGAATGCTGG + Intergenic
1198412427 X:136384677-136384699 TTTTGTTTGTAATAGGATTCAGG + Intronic
1201938533 Y:19433772-19433794 TCATGGTTGAAAAAGACTTCAGG + Intergenic