ID: 1059650692

View in Genome Browser
Species Human (GRCh38)
Location 9:116313307-116313329
Sequence ATATGAGTCATGTTTGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 253}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059650692_1059650697 -5 Left 1059650692 9:116313307-116313329 CCTTTTCCAAACATGACTCATAT 0: 1
1: 0
2: 2
3: 16
4: 253
Right 1059650697 9:116313325-116313347 CATATGTGCAGGTGGTGAAAGGG No data
1059650692_1059650696 -6 Left 1059650692 9:116313307-116313329 CCTTTTCCAAACATGACTCATAT 0: 1
1: 0
2: 2
3: 16
4: 253
Right 1059650696 9:116313324-116313346 TCATATGTGCAGGTGGTGAAAGG No data
1059650692_1059650698 -4 Left 1059650692 9:116313307-116313329 CCTTTTCCAAACATGACTCATAT 0: 1
1: 0
2: 2
3: 16
4: 253
Right 1059650698 9:116313326-116313348 ATATGTGCAGGTGGTGAAAGGGG No data
1059650692_1059650699 5 Left 1059650692 9:116313307-116313329 CCTTTTCCAAACATGACTCATAT 0: 1
1: 0
2: 2
3: 16
4: 253
Right 1059650699 9:116313335-116313357 GGTGGTGAAAGGGGACACTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059650692 Original CRISPR ATATGAGTCATGTTTGGAAA AGG (reversed) Intronic
900384545 1:2404055-2404077 ATATGGGTCACCTTTCGAAAAGG - Exonic
901169669 1:7247412-7247434 TTATTAGTCATATTTAGAAAGGG + Intronic
905467307 1:38165005-38165027 ATATGGGTCATGTATGGGGAGGG - Intergenic
905797748 1:40825036-40825058 ATTTCAGGCATGTTTGGATAAGG + Intronic
907233491 1:53023270-53023292 AGATGTGGCAAGTTTGGAAAAGG + Intronic
907799855 1:57753795-57753817 TTAAGAGGCATGTTTGTAAATGG + Intronic
908122238 1:60997159-60997181 ATATGAGCTATATCTGGAAATGG + Intronic
908608829 1:65832701-65832723 ATAGAAGTCAACTTTGGAAATGG + Intronic
908670039 1:66535657-66535679 AGCTGAGTCTTGTTTGCAAAAGG + Intronic
908776650 1:67647255-67647277 AAATGATCCAGGTTTGGAAATGG - Intergenic
909073644 1:71026908-71026930 ATTTGAGTCATGGTAGGAACAGG - Intronic
909433011 1:75611821-75611843 AGAAGAGTGATGTTTGGAAGGGG - Intergenic
909572848 1:77137498-77137520 TGATGAGGCATATTTGGAAAAGG - Intronic
910072976 1:83242248-83242270 ATATGAATCAGGGTTGGAAGGGG - Intergenic
910131062 1:83906831-83906853 ATATGGATCATGTTTCCAAAGGG - Intronic
911565210 1:99456067-99456089 ATATTTTCCATGTTTGGAAAAGG - Intergenic
911631643 1:100190324-100190346 TTATGGGCCATGTCTGGAAATGG + Exonic
912094679 1:106123736-106123758 ACATCAGTCATGTTGGAAAATGG - Intergenic
912227363 1:107750022-107750044 AATTGAGTCATGTTTGTGAAAGG - Intronic
917078112 1:171227176-171227198 ATCTGAGTGATGTCTGTAAAAGG - Intergenic
917897775 1:179508658-179508680 ATTTGAGACACTTTTGGAAAAGG - Intronic
918797645 1:188924144-188924166 ATGTCAGTGGTGTTTGGAAAAGG - Intergenic
918821218 1:189256947-189256969 CTATTAGTCATGTATAGAAAAGG - Intergenic
920217085 1:204368579-204368601 CTATGAGTGATCTTTGGAGATGG - Intronic
920516623 1:206589260-206589282 ACATGAGTCATTTTTGCAACAGG - Intronic
921636903 1:217506254-217506276 ATATGAATTAACTTTGGAAATGG + Intronic
1062972831 10:1661719-1661741 ATCTGAGGCAGGTTTGGAAGAGG - Intronic
1063269106 10:4486999-4487021 AAATGAGTCAGGTCTGGAAATGG - Intergenic
1063930110 10:11019172-11019194 ATTTCAGGCATGTTAGGAAAAGG + Intronic
1069295611 10:66840456-66840478 ATATGATACAGGTTTGCAAAGGG - Intronic
1070977495 10:80616903-80616925 ATATGAGAAATGTTTAGAAGAGG - Intronic
1072212067 10:93255316-93255338 ATATGTGTTATGTTCAGAAAAGG + Intergenic
1072730081 10:97840363-97840385 CTATGACACATGTTTGGAAGTGG - Intergenic
1074266531 10:111909848-111909870 ATATGAGTTAGGCTTGTAAATGG - Intergenic
1074748051 10:116555093-116555115 ATATGAGTTATGCATGGAAAGGG - Intronic
1074751832 10:116594414-116594436 AAAAGAGTCCTGTTTTGAAAAGG - Intronic
1076449878 10:130549600-130549622 ATAGGAATGATGTTTAGAAATGG + Intergenic
1076876626 10:133219463-133219485 GTCTGAGTCATGTTTGGGGATGG - Intronic
1077775805 11:5270235-5270257 ATATGAGGCTTTCTTGGAAAAGG - Intronic
1078408383 11:11091355-11091377 ATATGAGTCATGGGTCCAAATGG - Intergenic
1078562240 11:12383088-12383110 AAATGTGTCATCTTGGGAAAAGG - Intronic
1079907773 11:26269919-26269941 ATATCAGTCATGTTTGATTAGGG - Intergenic
1080129384 11:28776139-28776161 ATATGAGTAATCTTGGGAAGGGG - Intergenic
1083770773 11:64865711-64865733 GTGTGTGTCATCTTTGGAAAAGG - Intronic
1084129445 11:67121545-67121567 ATATTTATCTTGTTTGGAAATGG + Intronic
1086755166 11:90552030-90552052 ATATGAGTCATGAGAGAAAAAGG - Intergenic
1086784623 11:90952447-90952469 TTAGTAGACATGTTTGGAAAAGG - Intergenic
1087812030 11:102618858-102618880 GTATCACTCATGTTTGGAGAGGG + Intronic
1088993005 11:114970836-114970858 ATTGAAGTAATGTTTGGAAATGG - Intergenic
1089008950 11:115117223-115117245 AGAAAAGTCATGCTTGGAAATGG - Intergenic
1090413073 11:126522304-126522326 AAAAGAGAAATGTTTGGAAAAGG + Intronic
1090992686 11:131833967-131833989 AGATGAGTCCTGAGTGGAAATGG - Intronic
1093078310 12:14780119-14780141 ATCTTAATCAGGTTTGGAAATGG + Intergenic
1093405052 12:18794560-18794582 AAATGAGTCATATTTGCAGATGG + Intergenic
1093451802 12:19324734-19324756 ATAGGAGACATGTTTGGAAAAGG + Intronic
1094091794 12:26658327-26658349 ATATAAGTCTTGTTTCAAAAAGG + Intronic
1095372122 12:41481110-41481132 ATATGAGGCATTATGGGAAATGG - Intronic
1095872388 12:47043961-47043983 ATTTGGGTCATGTCTGGAGAGGG - Intergenic
1099557342 12:84126932-84126954 ATATAAGTAATATATGGAAAAGG + Intergenic
1101392242 12:104312032-104312054 ATATGGGTATTGTGTGGAAATGG + Intronic
1104091857 12:125524250-125524272 ATAAAAGTCATGTATGTAAAGGG + Intronic
1104876589 12:132039157-132039179 AACTGAGTAATGTTTAGAAATGG - Intronic
1104964676 12:132503516-132503538 AGATGGGTCATGGTGGGAAAGGG + Intronic
1107798473 13:44079859-44079881 ATCTGATTCATGTTTAGGAAGGG + Intergenic
1107799179 13:44088129-44088151 ATCTGATTCATGTTTAGGAAGGG - Intergenic
1108146813 13:47485984-47486006 CTATGGGTCATGTTTGAAAGTGG - Intergenic
1108496085 13:51026701-51026723 AGCATAGTCATGTTTGGAAAAGG - Intergenic
1109701494 13:66030892-66030914 ATGTGAGTTAGGTTGGGAAATGG - Intergenic
1109727788 13:66367247-66367269 CTATTAGTTATTTTTGGAAATGG - Intronic
1110959958 13:81608976-81608998 ACATGAGTCTTGATTAGAAAAGG + Intergenic
1113015581 13:105824589-105824611 ACATGACTCATGCTTGGGAATGG + Intergenic
1114283501 14:21217556-21217578 ATATCAGTGATCTTTGGACAAGG - Intronic
1116245101 14:42400949-42400971 ATATGAATAATGTTTTGACAAGG - Intergenic
1116609648 14:47051458-47051480 ATATCAGTGAGGTTTGGAAAAGG - Intronic
1116777788 14:49201625-49201647 ATACGAGTCATGTTAGGTTAGGG - Intergenic
1116969529 14:51050183-51050205 ATATCAGGCACATTTGGAAAGGG - Intronic
1119231949 14:72986997-72987019 ATTTGAGGCAAGTCTGGAAAAGG + Intronic
1119675525 14:76550759-76550781 ATCTGAGTCAGGCTGGGAAAAGG - Intergenic
1120114965 14:80604627-80604649 ATATGAGTGGTGTTTGGGCACGG - Intronic
1120304067 14:82745995-82746017 ACATGAGTCATGTTGGACAAAGG - Intergenic
1120456974 14:84743808-84743830 ATATTAGACATTTCTGGAAAAGG + Intergenic
1126930972 15:53650935-53650957 ATTTGATTTATGTTTTGAAAAGG - Intronic
1127338354 15:58013460-58013482 AAATGAGACATGTTTGGATTTGG - Intronic
1127393661 15:58526735-58526757 ATCTTAGGCAAGTTTGGAAAGGG + Intronic
1127440164 15:58998846-58998868 AAATGTGTCATGTTTGAAAGAGG + Intronic
1130324905 15:82872081-82872103 ATATGAGGCAGGTGTGGGAAGGG + Intronic
1130414903 15:83683783-83683805 GTATGAGACAAGTGTGGAAAGGG - Intronic
1131090774 15:89623453-89623475 ATCTGAGTCATGTTTTGGAGAGG + Intronic
1132956412 16:2596603-2596625 ATATGATTTATATTTGAAAAAGG - Intronic
1133367229 16:5219854-5219876 AGATGGGTCATGTTTGCATAGGG + Intergenic
1135094680 16:19555396-19555418 CTATGAGTCATGATTGTAAAGGG - Exonic
1135897008 16:26415562-26415584 ATTTTTGTCATGTTTGGTAATGG - Intergenic
1139201065 16:64977362-64977384 ATTTGGGTCATGTTTTCAAATGG - Intronic
1140142323 16:72270307-72270329 GTAAGTGTCATGCTTGGAAAAGG - Intergenic
1142421731 16:89974826-89974848 GTATTAGGCATGTTAGGAAAAGG + Intergenic
1143070627 17:4289501-4289523 GTATGTGTCATGTTTGATAAAGG - Intronic
1144646330 17:16976509-16976531 ATCTGAGTCATCTATGTAAATGG - Intergenic
1146645390 17:34573784-34573806 AGAGGAGTCATGTTGGGGAATGG + Intergenic
1148916711 17:50987225-50987247 ATCTGAGTCATTGCTGGAAAGGG + Exonic
1149944883 17:60913635-60913657 ATCTGAGTTGTATTTGGAAAAGG - Intronic
1150413483 17:64967026-64967048 ATTTAAGTCATTTTAGGAAATGG - Intergenic
1151240769 17:72755972-72755994 ATATGGGTAACGTTTGAAAATGG + Intronic
1153305497 18:3627016-3627038 ATATGAGTCATATTTCAATAAGG + Intronic
1155294296 18:24371263-24371285 ATATGAGAGATGCTTGGACAGGG - Intronic
1156128919 18:33944271-33944293 AAATGAGTCATGTATAAAAAAGG - Intronic
1158169875 18:54585770-54585792 ACCTGAGTCAGGTTTGGATATGG - Intergenic
1159401794 18:67947037-67947059 ACATGAGGCATGTTTTGATAAGG + Intergenic
1159425545 18:68280447-68280469 ATATGATCCATGTTTTTAAATGG + Intergenic
1164520960 19:28979372-28979394 TGATGAGACATTTTTGGAAAAGG + Intergenic
1164866479 19:31608496-31608518 ATCTGAGACATATTTGCAAATGG + Intergenic
926273114 2:11382566-11382588 ATTAGAGTGATGTGTGGAAAGGG - Intergenic
926676029 2:15620986-15621008 ATATATGTCATGTTTTAAAAGGG - Intronic
927016816 2:18972287-18972309 ATAACATTCATCTTTGGAAATGG - Intergenic
927048401 2:19303146-19303168 TCATGAGTCCTGTTTGGGAAAGG + Intergenic
931769250 2:65483580-65483602 ATATGTGTCATGCATGGTAAAGG - Intergenic
931807929 2:65826028-65826050 ATGTAAGGCATGTTTGGAGAAGG + Intergenic
933096193 2:78184939-78184961 TTTTGAGTCATTTTTGTAAATGG + Intergenic
938091766 2:128439105-128439127 TAATGTGTCATGTTTGGTAAAGG + Intergenic
938585701 2:132688533-132688555 TTCTGAGACATGTTTGAAAATGG - Intronic
938607161 2:132907096-132907118 ATATAAATAATGTTAGGAAAAGG - Intronic
939538442 2:143462577-143462599 ATGTGAGACATTTTTGGAGAAGG - Intronic
939836974 2:147141666-147141688 ATATTATTCATGCTTGAAAAAGG - Intergenic
940595307 2:155783915-155783937 ATATGTGTCTTCTTTGGAAAAGG - Intergenic
941157191 2:161993698-161993720 CTTTGAGTCAAATTTGGAAATGG - Intronic
941566648 2:167117151-167117173 ATGTTAGTGATCTTTGGAAATGG + Intronic
942166872 2:173249926-173249948 ATTTGAGTTATGTATGAAAAAGG - Intronic
943370311 2:187007948-187007970 ATATTAATCATGTCTGGAAACGG + Intergenic
943498477 2:188654780-188654802 GTATTAGTAATATTTGGAAATGG + Intergenic
943655366 2:190503056-190503078 ATATCAGGCATGTATGGTAATGG - Intronic
944526428 2:200624462-200624484 ATCTGAGCCCTGTTTGGAAAGGG + Intronic
945621184 2:212139852-212139874 AAATGAGTCATGTTCGGAAAAGG - Intronic
945646222 2:212498338-212498360 AAATTAGTCAAGTTGGGAAATGG - Intronic
948674985 2:239591894-239591916 ATCTGTCTGATGTTTGGAAAGGG + Intergenic
948851940 2:240712648-240712670 AAATGAGTTAGCTTTGGAAAAGG - Intergenic
1169849808 20:10036352-10036374 ATATGTGTCATCTATGGAATAGG - Intronic
1171165182 20:22963897-22963919 ATATTTGACATGTTTTGAAATGG - Intergenic
1172986874 20:38998598-38998620 ATTTGAGTCAGGTTTGAAAGAGG - Intronic
1173299742 20:41791540-41791562 ATAAGAGTGATGTTGGGATAAGG - Intergenic
1173618615 20:44419459-44419481 TTGTGAGTCATGTTGGTAAATGG + Intronic
1174706443 20:52661089-52661111 ATAGGAGTCATCTTTGGAGCAGG + Intergenic
1175080865 20:56419285-56419307 ATAGGCGTTATGTTTGGAAATGG - Intronic
1177500466 21:21948187-21948209 ATCTGAGGCCTGTCTGGAAAAGG - Intergenic
1177538575 21:22462108-22462130 ATATAAGACAAGTTTGTAAATGG - Intergenic
1177947119 21:27484472-27484494 ATATTAGCTATTTTTGGAAAGGG + Intergenic
1178780872 21:35602716-35602738 AAAAGAGTCTAGTTTGGAAATGG + Intronic
1182141473 22:27963080-27963102 AAATGAGTCAAGTATTGAAAGGG - Intergenic
1182313152 22:29423789-29423811 GTATGATTCATCTGTGGAAAGGG + Intergenic
1184016760 22:41791911-41791933 TTATGAGAAATGTCTGGAAAAGG + Intronic
1184299527 22:43548178-43548200 ATATCAGTAATGTATGTAAATGG + Intronic
1184614153 22:45626504-45626526 ACCTGAGTCATCTTTGGCAAAGG + Intergenic
952473280 3:33679093-33679115 ATAAAAGTGATCTTTGGAAAAGG + Intronic
952907374 3:38150695-38150717 GTATGAGTCAGGTTTGGAGTAGG - Intergenic
955732481 3:62001184-62001206 ATATGAGACATTTTTGGAAGGGG + Intronic
955795023 3:62626942-62626964 ATATGTGTCAGATTTGAAAAAGG + Intronic
956016563 3:64889994-64890016 ATATTAGTAATGGCTGGAAAGGG - Intergenic
956633270 3:71337140-71337162 ACATGAGTTGTTTTTGGAAAGGG + Intronic
956725128 3:72150693-72150715 ACATGTGTCATTGTTGGAAATGG + Intergenic
957564922 3:81872218-81872240 ATATGAATAATGTTTCCAAATGG + Intergenic
959461330 3:106629509-106629531 CTATGAGACAAGCTTGGAAAGGG + Intergenic
959619041 3:108380328-108380350 ATATGAGTCAGGGTTGGATCAGG + Intergenic
959807539 3:110574927-110574949 ACATGAGAGATGTTTGGAATAGG + Intergenic
960083200 3:113563309-113563331 ATATGAGTATTGATTGCAAACGG + Intronic
960901849 3:122561778-122561800 ATAAGAGTCATATTTGCAATTGG - Intronic
966274566 3:178149961-178149983 AGATGATTCATGTATTGAAATGG - Intergenic
967640528 3:191857369-191857391 ATGTGAGAAATGTTTGGATATGG - Intergenic
969548760 4:7850089-7850111 ATCTGACTTATGTTTGAAAATGG + Intronic
969954192 4:10871440-10871462 ATATGACTTATTTTTGAAAAGGG - Intergenic
970449311 4:16151176-16151198 ATATGAGTCATTTTTCGATGGGG - Intergenic
971996452 4:33971842-33971864 ATATGAGTCATATTAGATAAGGG - Intergenic
973814590 4:54607462-54607484 ATGGGAGTCATTTTTGAAAAAGG - Intergenic
974237056 4:59195216-59195238 ATATGAGTCACAGTTTGAAATGG + Intergenic
976730666 4:88257881-88257903 AAATGAGTCATTCTTGGAAGTGG + Exonic
977078582 4:92491821-92491843 ATATGAGAAATGTTTAGAAATGG - Intronic
977128630 4:93203883-93203905 TTATGAGTCAGGTTTGAAAGTGG + Intronic
977385042 4:96328094-96328116 ATAAGAGAAATGTCTGGAAAAGG - Intergenic
978181089 4:105796803-105796825 ACATCAGTAATTTTTGGAAATGG + Intronic
979422051 4:120516444-120516466 ATATGAGTTAAGTTTTCAAAGGG - Intergenic
980557450 4:134428079-134428101 TTAAGAGGCATGTTTTGAAAAGG + Intergenic
981965905 4:150603022-150603044 ATATGAGTGAAGTTTGTGAAAGG - Intronic
983977069 4:173948093-173948115 ATATAAATTATTTTTGGAAAAGG + Intergenic
984360403 4:178722896-178722918 ATATCTGTCATTTTTGGAATAGG + Intergenic
984909591 4:184660500-184660522 ACTTGAGTAATGTGTGGAAAAGG + Intronic
984938349 4:184909476-184909498 AAATGGGGCATGTTGGGAAAAGG - Intergenic
985432347 4:189893571-189893593 ATATTAGTGATCTTTGAAAAGGG - Intergenic
986663950 5:10083736-10083758 ATATGGGTCATATTTGTAATGGG + Intergenic
986764659 5:10914001-10914023 GGCTGAGTCATGATTGGAAATGG - Intergenic
987329625 5:16844987-16845009 AGATCAGTCATATTTGAAAAGGG - Intronic
988051304 5:26034979-26035001 ATATGAGTCAGGGATGGATAGGG + Intergenic
993654396 5:90559164-90559186 AGATCAGACATCTTTGGAAAGGG - Intronic
995510666 5:112906001-112906023 ATATGATTCATATTTGTACAAGG - Intronic
996449552 5:123604127-123604149 ATATGGGATATGTTTGGAGAAGG + Intronic
996662780 5:126024420-126024442 ATATGATTCATATTTTGAAAAGG + Intergenic
996988175 5:129593910-129593932 TTATTAGTAATATTTGGAAAAGG - Intronic
1001178942 5:169500395-169500417 ATTTGTGACATATTTGGAAATGG - Intergenic
1001475629 5:172048735-172048757 GTCTGACTCATGTTTTGAAAAGG - Intronic
1202771376 5_GL000208v1_random:1865-1887 ATTTGAGTCATATGAGGAAAAGG - Intergenic
1002876864 6:1218422-1218444 ACATGTGTCATGTTCAGAAATGG - Intergenic
1003179062 6:3776669-3776691 AAATGTGTCATCTTTGGAGAGGG + Intergenic
1004445818 6:15696715-15696737 AAATGAGTGATGTTTGTAAAGGG + Intergenic
1004952845 6:20693829-20693851 ATAGGAGTCATGCTTGGCATGGG + Intronic
1005429836 6:25743959-25743981 ATTTGAGTCAGATCTGGAAAAGG + Intergenic
1005438498 6:25839866-25839888 ATTTGAGAAATGTGTGGAAATGG - Intronic
1009341834 6:62564926-62564948 GTATGAATCGTTTTTGGAAAAGG + Intergenic
1011053674 6:83182728-83182750 ATATGCAGCATCTTTGGAAAAGG + Intronic
1011771282 6:90676212-90676234 ATATGACACATGTTTGGGGAGGG + Intergenic
1013417455 6:109937787-109937809 TTATATGTCATGTTTGAAAATGG - Intergenic
1013818794 6:114131149-114131171 GCATGAGTAATTTTTGGAAATGG + Intronic
1013918551 6:115371042-115371064 ATATGAGTTAGGATTGTAAAAGG + Intergenic
1014830262 6:126095159-126095181 ATACCAGGAATGTTTGGAAATGG + Intergenic
1014916633 6:127158450-127158472 AGATAACTCATATTTGGAAAAGG + Intronic
1015065175 6:129016661-129016683 ATACTAGTTATCTTTGGAAAGGG + Intronic
1015430423 6:133124314-133124336 GTATGATTCATGTCTGTAAAAGG + Intergenic
1015486034 6:133771040-133771062 ATTTGAGCCATGTCTTGAAAAGG + Intergenic
1016587002 6:145699607-145699629 GTATGATTCAAGTTAGGAAATGG + Intronic
1016588830 6:145720362-145720384 ATATGAGTATTGCTTGTAAATGG - Intronic
1016669422 6:146684820-146684842 AAATGAGTAATGTAGGGAAAAGG + Intronic
1016952268 6:149591948-149591970 ATATGAGTGATGGTTAAAAAAGG - Intergenic
1017302471 6:152878722-152878744 ACATGTATCATGTTTGGAATTGG - Intergenic
1018293306 6:162315702-162315724 ACATAAGTCTTTTTTGGAAATGG + Intronic
1018420617 6:163637725-163637747 AGATGACTCAGGTTTTGAAATGG + Intergenic
1020430129 7:8110125-8110147 ATAGTAGTCATGGTGGGAAATGG - Intergenic
1020617702 7:10479667-10479689 ATTTGGTTCATGGTTGGAAAAGG - Intergenic
1021372493 7:19866441-19866463 ATTTGAGTCAAGTTTAAAAAGGG + Intergenic
1022336640 7:29427970-29427992 TTATGTGACATGTTTGGAATAGG + Intronic
1022707960 7:32823581-32823603 ATTTTATTCATGTGTGGAAAGGG + Intergenic
1022915000 7:34939765-34939787 ATTTTATTCATGTGTGGAAAGGG - Intronic
1027290708 7:76707442-76707464 ATATGAATCAGGGTTGGAAGGGG - Intergenic
1027997451 7:85442838-85442860 ATATGTTTAATGTTAGGAAAAGG + Intergenic
1031440753 7:121792005-121792027 ATATCAGTCATGTTTGTAATTGG - Intergenic
1037077300 8:14736175-14736197 ATATGAGCCATGTTTTGTAGAGG + Intronic
1037193607 8:16158548-16158570 ATATGAGACAAGATTGAAAACGG - Intronic
1038909392 8:31945771-31945793 ATGAGAGTCAGGTTGGGAAAGGG - Intronic
1040755688 8:50771568-50771590 AGAAAAGGCATGTTTGGAAAGGG + Intronic
1040975009 8:53180954-53180976 ATATGATTCATGTAGAGAAATGG - Intergenic
1041328709 8:56698827-56698849 ATAAGACTGATGTTGGGAAAAGG - Intergenic
1041969234 8:63718186-63718208 TTATGAGCCAGGCTTGGAAATGG - Intergenic
1042047847 8:64673884-64673906 AGATGAGTGATGACTGGAAAAGG + Intronic
1042353510 8:67801556-67801578 ATAAGAGAGATGTTAGGAAAGGG + Intergenic
1042374654 8:68036479-68036501 ATATGGGTCATGATAAGAAATGG + Intronic
1042682666 8:71403798-71403820 ATAATAGCTATGTTTGGAAAAGG + Exonic
1043320662 8:78981717-78981739 ATATGAATAATGTTTATAAATGG - Intergenic
1043862299 8:85334055-85334077 ATTTGAGAGATGTTTGGAAAGGG - Intronic
1044180889 8:89192600-89192622 ATAAAACTCATGTCTGGAAATGG + Intergenic
1046072522 8:109275203-109275225 ATCTGAGTGATGTTTGAATATGG - Intronic
1046088284 8:109466320-109466342 ATAAGAGTCAAACTTGGAAATGG - Intronic
1046578200 8:116058316-116058338 ATATGAGTAATATGTGGAATTGG - Intergenic
1047872527 8:129100660-129100682 GTAGGAGTCATGTATGGAACAGG + Intergenic
1048011210 8:130457805-130457827 ATTTGAGTCATGCCTGTAAATGG - Intergenic
1049506046 8:142999226-142999248 TTTTGGGTCCTGTTTGGAAAGGG - Intergenic
1049908248 9:239360-239382 ATAGAAGTTATTTTTGGAAAAGG - Intronic
1052002561 9:23304068-23304090 ATATGAAACATGTTTTAAAAGGG - Intergenic
1052559944 9:30072124-30072146 ATATGACTCAACTTTAGAAAAGG + Intergenic
1053721521 9:40951635-40951657 ATATTAGTGATCTTTGAAAAGGG - Intergenic
1054344475 9:63900534-63900556 ATATTAGTGATCTTTGAAAAGGG + Intergenic
1055753764 9:79535078-79535100 TTATGAGCCAGGTTTGGAAGTGG - Intergenic
1056260760 9:84846009-84846031 ATAAGAGCCATTTTTGGGAAGGG - Intronic
1056838579 9:89978986-89979008 ATATGAGTTATGTGTGTAAAGGG - Intergenic
1057447336 9:95126461-95126483 TTCTGATTCATGCTTGGAAATGG + Intronic
1059227021 9:112681657-112681679 ATCTGAGTAATGTTAGGAAGTGG + Intergenic
1059650692 9:116313307-116313329 ATATGAGTCATGTTTGGAAAAGG - Intronic
1060814297 9:126626667-126626689 AAATAAGCCTTGTTTGGAAAGGG + Intronic
1061022173 9:128023029-128023051 TTATGAGTCAAGTCTGGAAATGG - Intergenic
1187696485 X:21927432-21927454 ATTTGATTCATGTTAGAAAAAGG - Intergenic
1189654827 X:43233569-43233591 ATATGTTTTATGTTTGGACATGG - Intergenic
1193956054 X:87864284-87864306 ATATGAGTCATGGGTGTATAAGG - Intergenic
1194943166 X:100037139-100037161 ATAATAGTGATGTTTGGAACTGG - Intergenic
1195383741 X:104294422-104294444 ACATGATTCATGTTTTGAGAAGG - Intergenic
1196050258 X:111297100-111297122 ATATGAGTAAGGCCTGGAAATGG + Exonic
1198449118 X:136748719-136748741 ATATGGGACATGATTGGTAATGG + Intronic
1198937737 X:141916558-141916580 ATTTGGGGCATGTTTGGAGATGG + Intergenic
1198961318 X:142186305-142186327 ATCTGGGGCATGTTTGGAGAAGG - Intergenic
1199916923 X:152352898-152352920 ACATGAGGAATATTTGGAAATGG - Intronic