ID: 1059650696

View in Genome Browser
Species Human (GRCh38)
Location 9:116313324-116313346
Sequence TCATATGTGCAGGTGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059650692_1059650696 -6 Left 1059650692 9:116313307-116313329 CCTTTTCCAAACATGACTCATAT 0: 1
1: 0
2: 2
3: 16
4: 253
Right 1059650696 9:116313324-116313346 TCATATGTGCAGGTGGTGAAAGG No data
1059650688_1059650696 6 Left 1059650688 9:116313295-116313317 CCACCCCAGAATCCTTTTCCAAA 0: 1
1: 0
2: 3
3: 28
4: 287
Right 1059650696 9:116313324-116313346 TCATATGTGCAGGTGGTGAAAGG No data
1059650686_1059650696 11 Left 1059650686 9:116313290-116313312 CCTGCCCACCCCAGAATCCTTTT 0: 1
1: 0
2: 2
3: 39
4: 320
Right 1059650696 9:116313324-116313346 TCATATGTGCAGGTGGTGAAAGG No data
1059650687_1059650696 7 Left 1059650687 9:116313294-116313316 CCCACCCCAGAATCCTTTTCCAA 0: 1
1: 0
2: 1
3: 31
4: 306
Right 1059650696 9:116313324-116313346 TCATATGTGCAGGTGGTGAAAGG No data
1059650691_1059650696 1 Left 1059650691 9:116313300-116313322 CCAGAATCCTTTTCCAAACATGA 0: 1
1: 0
2: 3
3: 21
4: 250
Right 1059650696 9:116313324-116313346 TCATATGTGCAGGTGGTGAAAGG No data
1059650689_1059650696 3 Left 1059650689 9:116313298-116313320 CCCCAGAATCCTTTTCCAAACAT 0: 1
1: 0
2: 2
3: 33
4: 391
Right 1059650696 9:116313324-116313346 TCATATGTGCAGGTGGTGAAAGG No data
1059650690_1059650696 2 Left 1059650690 9:116313299-116313321 CCCAGAATCCTTTTCCAAACATG 0: 1
1: 0
2: 3
3: 18
4: 249
Right 1059650696 9:116313324-116313346 TCATATGTGCAGGTGGTGAAAGG No data
1059650684_1059650696 21 Left 1059650684 9:116313280-116313302 CCCTGGGGCTCCTGCCCACCCCA 0: 1
1: 0
2: 2
3: 72
4: 525
Right 1059650696 9:116313324-116313346 TCATATGTGCAGGTGGTGAAAGG No data
1059650685_1059650696 20 Left 1059650685 9:116313281-116313303 CCTGGGGCTCCTGCCCACCCCAG 0: 1
1: 0
2: 13
3: 99
4: 851
Right 1059650696 9:116313324-116313346 TCATATGTGCAGGTGGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059650696 Original CRISPR TCATATGTGCAGGTGGTGAA AGG Intronic
No off target data available for this crispr