ID: 1059656386

View in Genome Browser
Species Human (GRCh38)
Location 9:116361408-116361430
Sequence CTGGTAACACAGATAAAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059656386_1059656392 29 Left 1059656386 9:116361408-116361430 CCACGCTTTATCTGTGTTACCAG 0: 1
1: 0
2: 0
3: 3
4: 100
Right 1059656392 9:116361460-116361482 CATAGAATTAGAACCACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059656386 Original CRISPR CTGGTAACACAGATAAAGCG TGG (reversed) Intronic
903400630 1:23043785-23043807 GTGGTAACACAGAGAAAGGCAGG - Intronic
908818025 1:68053741-68053763 CTGGTAAAACAGATTATGGGAGG + Intergenic
915785361 1:158605793-158605815 CAGGTAACAAAGATCAAGAGAGG - Intergenic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
1073664434 10:105514330-105514352 CTGGTAAAACAGATGCAACGTGG + Intergenic
1077006369 11:359446-359468 CTGATGACACAGATCAAGTGAGG - Intergenic
1083569752 11:63752669-63752691 GTGGTAAAACAGAAAAAGCAGGG + Intronic
1083840018 11:65299086-65299108 CTGGTGACACAGCTGAAGTGGGG - Intronic
1087657975 11:100949250-100949272 CTGGTAACACAGTTTGAGGGAGG - Intronic
1087860259 11:103144787-103144809 CTGGAAACACAGATATACGGTGG + Intronic
1088528546 11:110784038-110784060 ATGGTAAAACAAATAAAGCTGGG - Intergenic
1090594116 11:128302601-128302623 CTGGTAACAAACATTAAGCCTGG - Intergenic
1093914368 12:24784601-24784623 CTAGTAACAAAGATAAAAGGAGG + Intergenic
1094483072 12:30900387-30900409 CTGGGGACACAGAAAAAGCAAGG - Intergenic
1096519612 12:52177238-52177260 TTGGTAACAGTGATAAAGCTGGG + Intronic
1096869066 12:54582132-54582154 CTGGGGACACAGAGAAAGGGAGG + Intronic
1098132836 12:67368360-67368382 CTGGAAACACAGAGAAAGGATGG + Intergenic
1109999446 13:70175918-70175940 CTAGGAACACATATAAAGCTAGG + Intergenic
1110507428 13:76303887-76303909 CTGGTCACAAAGAGAAAGAGTGG + Intergenic
1113230712 13:108211991-108212013 ATGGTAAAATAGATAAAGTGAGG - Intronic
1117238609 14:53804789-53804811 CTGCTATCACAGATAAAGCAAGG - Intergenic
1118076850 14:62308774-62308796 CAGGTGACACAGAGAAAGCATGG + Intergenic
1121375617 14:93407589-93407611 CTCCTAACACAGATAAGGCCTGG - Intronic
1124463177 15:29911868-29911890 CTCCTAACATAGATAAAGCCTGG - Intronic
1125991247 15:44110605-44110627 CTCTTAACACAGAAAAAGTGTGG + Intronic
1131224867 15:90616210-90616232 CTGGGAACACTGACAAAGCATGG + Intronic
1137925457 16:52536456-52536478 CCGTTAAAACACATAAAGCGAGG + Intronic
1138903053 16:61297341-61297363 CTGGTAAAACAGATTATGGGAGG + Intergenic
1145865848 17:28241040-28241062 CTGGAAACAGGGATAAAGCCAGG + Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1148570001 17:48660651-48660673 CTGTTCACACAGATAAAACTAGG - Intergenic
1151600653 17:75104203-75104225 CTGGTCACACAGATGAACCCTGG - Intronic
1153439408 18:5100297-5100319 CTGGCAAAACAGATTAAGGGAGG + Intergenic
1154983405 18:21523533-21523555 CTGGAAACACATTTAAAGAGTGG - Exonic
1158581158 18:58684222-58684244 GTGGTAACACAGAAACAGGGCGG - Intronic
1159847712 18:73485666-73485688 TTCGTAACACAGATAAAATGAGG + Intergenic
932285574 2:70529034-70529056 CTGGCAACAAAGATAAAGCCAGG - Intronic
938724027 2:134091134-134091156 CTGGTAACACTGGTAAAGGCAGG - Intergenic
939660842 2:144887615-144887637 CAGGCAACACAGGTAAAGCATGG + Intergenic
948652140 2:239454638-239454660 CTGGTAGCACAGAAAAATCTTGG - Intergenic
1170223629 20:13966848-13966870 CTGGTAACAGAGAAAGAGAGAGG - Intronic
1170834711 20:19874280-19874302 CTAGAAACACACATAAAGCAAGG + Intergenic
1174168328 20:48600254-48600276 ATGGTAACATAGATTAAGGGAGG + Intergenic
1174565107 20:51458854-51458876 ATGGTACCACAGATAAAACCTGG - Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1177433490 21:21020664-21020686 CTGGTAACACAGGTTATGGGAGG - Intronic
1178061493 21:28858144-28858166 CTGTTAACACTGCTTAAGCGGGG + Intergenic
1181915005 22:26273149-26273171 CTTGTGACACAGAGAAAGGGAGG - Intronic
1182401851 22:30084287-30084309 CTGGTAAGACAGAGAGAGCAAGG + Intronic
1182660863 22:31924236-31924258 CGGGTCACACAGATAAAAAGTGG - Intergenic
950339229 3:12227842-12227864 CTGATACCACAGATGAAGCCCGG + Intergenic
951294858 3:20921463-20921485 CTGGGAACAAAGAGAAAGCCCGG - Intergenic
953649962 3:44793447-44793469 AGGTTAACACAAATAAAGCGTGG + Intronic
955057698 3:55471268-55471290 CAGGTCACACAGCTAAAGTGTGG + Intronic
955575525 3:60358653-60358675 CTGATAACACAGATACAACATGG + Intronic
955641956 3:61095491-61095513 CAGGTAACCCAAATAAAGCAGGG + Intronic
960374447 3:116881207-116881229 CTGGTAATAAAGATACAGCCAGG + Intronic
960589884 3:119355120-119355142 GTGGTATCACAGAAAAAGCATGG + Intronic
967292225 3:187932410-187932432 TTGGTGACACAGGTAAAGCAGGG + Intergenic
967757742 3:193189156-193189178 CTGGTAACATAGATTTAGCAAGG + Intergenic
969202753 4:5618706-5618728 CTCTTAACACAGAGAAAGCCTGG + Intronic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
979392513 4:120143277-120143299 TTGGAAGCACAGATAAAGCTTGG - Intergenic
981276612 4:142906041-142906063 TTGGTAACACAGATATACCAAGG - Intergenic
991898262 5:71428601-71428623 CTGGTAACACTGTTAACGCTGGG + Intergenic
997847295 5:137298743-137298765 ATATTAACACAGATAAAGAGAGG - Intronic
998487087 5:142512265-142512287 CTGGTAGCACACATAGAGCTGGG - Intergenic
1000989743 5:167899570-167899592 AAGGTTACACAGATAAAACGTGG + Intronic
1001368543 5:171170736-171170758 TCTGTTACACAGATAAAGCGGGG - Intronic
1002352724 5:178594446-178594468 CTGGTAACTCAGAGAACGCTGGG + Intergenic
1003735373 6:8872290-8872312 CTGGAAACAAAGATAAAACATGG - Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1012515339 6:100052994-100053016 CTGGGAACCCAGAGAAAGAGTGG + Intergenic
1013362962 6:109411519-109411541 CTGGTTACACAGATATAACCAGG + Intronic
1016496318 6:144666778-144666800 CTGGTAGCACAGTTAAAGAAAGG + Intronic
1020684856 7:11281772-11281794 CTGGAAACAGGGATAAAGTGAGG - Intergenic
1022184328 7:27952384-27952406 TTGGTGACACAGATGAAGCATGG - Intronic
1028363909 7:90005006-90005028 CTGTAGAGACAGATAAAGCGTGG + Intergenic
1028392577 7:90334224-90334246 CTGGTAACTCAGATACTGAGAGG + Intergenic
1031365543 7:120896020-120896042 CTTTTAACACAGATAATACGTGG - Intergenic
1031365706 7:120898187-120898209 CTTTTAACACAGATAATACGTGG - Intergenic
1032785139 7:135194627-135194649 CTGGAAACACAGACAAATGGAGG + Intronic
1034066804 7:148144794-148144816 CTGGAGACACACATTAAGCGAGG + Intronic
1035959678 8:4123545-4123567 CTTGTAACACATTTAAAGTGAGG + Intronic
1037329022 8:17725446-17725468 CTGGTGTCAGAGAGAAAGCGAGG - Intronic
1038431553 8:27504396-27504418 CTGGTTAGGCAGATAAAGCCAGG + Intronic
1046928474 8:119819207-119819229 GTGGTAAAACAGATAAAGATTGG + Intronic
1048219172 8:132525811-132525833 CTGGCGACACAGATAAAGCCAGG + Intergenic
1051967664 9:22848270-22848292 CTGGTAAAACAGATTATGAGAGG + Intergenic
1053552068 9:39092405-39092427 ATAGTAACACAGCTAAAGCAGGG - Intronic
1053816201 9:41912543-41912565 ATAGTAACACAGCTAAAGCAGGG - Intronic
1054106461 9:61056227-61056249 ATAGTAACACAGCTAAAGCAGGG - Intergenic
1054614396 9:67274898-67274920 ATAGTAACACAGCTAAAGCAGGG + Intergenic
1059656386 9:116361408-116361430 CTGGTAACACAGATAAAGCGTGG - Intronic
1059725947 9:117008177-117008199 CTGGTAATACAGGGAAAGCTTGG + Exonic
1059989298 9:119849747-119849769 TTGGTAACTCAGAAAAAGCAAGG + Intergenic
1186556386 X:10564113-10564135 GTGAGAACACAGATAAAGCATGG - Intronic
1192876823 X:75238367-75238389 CAGTTAAAACAGATAAAGAGGGG + Intergenic
1193428124 X:81365899-81365921 TTGATGACACAGATAAAGAGGGG - Intergenic
1196296016 X:113998342-113998364 CTGGTGACACAGATCAAACATGG - Intergenic
1197496829 X:127194263-127194285 CTGGTTACATATATAAAGGGGGG - Intergenic
1198831208 X:140752481-140752503 CTGTTCACACAGAGAAAGCCAGG - Intergenic