ID: 1059659965

View in Genome Browser
Species Human (GRCh38)
Location 9:116390959-116390981
Sequence CCTACCACACAGAAGTATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059659965_1059659970 28 Left 1059659965 9:116390959-116390981 CCAACATACTTCTGTGTGGTAGG 0: 1
1: 0
2: 1
3: 12
4: 158
Right 1059659970 9:116391010-116391032 AGAAACTGAAGCCCAGAAAAGGG No data
1059659965_1059659969 27 Left 1059659965 9:116390959-116390981 CCAACATACTTCTGTGTGGTAGG 0: 1
1: 0
2: 1
3: 12
4: 158
Right 1059659969 9:116391009-116391031 GAGAAACTGAAGCCCAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059659965 Original CRISPR CCTACCACACAGAAGTATGT TGG (reversed) Intronic
907802794 1:57788535-57788557 CTAACCACAAAGAAGTATGAGGG + Intronic
909759368 1:79269881-79269903 CCTACCAATCAGCAGGATGTGGG + Intergenic
910261437 1:85297181-85297203 CCGACCACAGAGAAACATGTAGG + Intergenic
912977148 1:114341175-114341197 CCTTCCACACAGTAGGATGGAGG - Intergenic
914704657 1:150160793-150160815 CCTACCACAGACAAGAATGTTGG - Intronic
914897141 1:151686532-151686554 GCTAGTACACAGAAATATGTTGG - Intronic
915081019 1:153352724-153352746 CGTGCCACACAGAAGCATGAAGG - Intergenic
916611483 1:166396319-166396341 CCTACCTCACAGAATTATTGAGG + Intergenic
919530212 1:198708244-198708266 CTTACCACACTGAAATCTGTAGG - Exonic
921630821 1:217431650-217431672 CCTATCTCACAGAACTTTGTAGG + Intronic
923003251 1:230024893-230024915 CCTTCTACCCAGCAGTATGTGGG + Intergenic
924009372 1:239647928-239647950 CCTACCTCACAGTAGTATTGTGG + Intronic
1063353325 10:5375360-5375382 CTTACCACGCAGAAGTGAGTGGG - Intergenic
1065820573 10:29521344-29521366 CCCACCACACGGAAGTCTGCAGG - Intronic
1065937868 10:30536835-30536857 CCTAACAAACAAAAGGATGTGGG + Intergenic
1068429464 10:56913004-56913026 CCAACCCCACAGCAGTATATAGG + Intergenic
1068510649 10:57961608-57961630 CTTACCACATAGAATTATGTAGG + Intergenic
1068863324 10:61868642-61868664 CCTACCAATCAGCAGGATGTGGG + Intergenic
1069855230 10:71436606-71436628 CCTACTTCACAGAAGTGTTTTGG + Intronic
1075298203 10:121296689-121296711 CCAACCACACACATTTATGTAGG + Intergenic
1078301064 11:10132782-10132804 CCTACCAATCAGCAGGATGTGGG - Intronic
1078771260 11:14354493-14354515 AATACCACACAGAAGTAAGGAGG + Intronic
1081194975 11:40150339-40150361 CCTAGCTCTCTGAAGTATGTTGG - Intronic
1085834634 11:79939539-79939561 CCCACCATACAAGAGTATGTAGG - Intergenic
1087991301 11:104747349-104747371 CCGACCCCACAGCAGTATCTAGG - Intergenic
1094666621 12:32526554-32526576 CCTACCAATCAGCAGGATGTGGG + Intronic
1096062680 12:48715418-48715440 CCTAACAAACAAAAATATGTGGG + Intronic
1097552586 12:61094074-61094096 GCTACCAAACAGAAATATGTAGG - Intergenic
1097589553 12:61557443-61557465 TCTACCCCACAGAATTATTTAGG + Intergenic
1099265204 12:80437744-80437766 TCAACCAGAGAGAAGTATGTTGG - Intronic
1100502440 12:95186905-95186927 CCTACCTGACAGAATTTTGTGGG + Intronic
1100503891 12:95200836-95200858 CATACCACCCAGAAGAAAGTAGG + Intronic
1101853467 12:108423072-108423094 CCTACCACACACCAGTATACAGG + Intergenic
1103127720 12:118438658-118438680 CCCACCACAAAGAATTATGGTGG - Intergenic
1104629610 12:130388415-130388437 CCTACCAGACATCAGGATGTAGG - Intergenic
1105484311 13:20811794-20811816 CCTACAATACAGAAGGATGGGGG + Intronic
1107514526 13:41116113-41116135 CCCCCCACACCAAAGTATGTAGG - Intergenic
1113550032 13:111185633-111185655 CATACCACAAAGAAGGATCTGGG - Intronic
1118677656 14:68205824-68205846 AATACCACACCGAAGTATTTGGG - Intronic
1119135780 14:72217924-72217946 CCTGACACACATATGTATGTGGG - Intronic
1121282509 14:92709561-92709583 CCTGCCACACAGGAGTATGGGGG - Intronic
1122499989 14:102191083-102191105 CAGAGCACACAGAAGTATTTGGG - Intronic
1123809034 15:23905006-23905028 CCTACCCCACAGCAGTGTCTAGG + Intergenic
1123972993 15:25526531-25526553 CCTACCACACAGCAATACCTGGG + Intergenic
1124075848 15:26443570-26443592 CCTGCCACACAGATGTGTGAGGG + Intergenic
1125160229 15:36634710-36634732 CCTACCACACAAAAGAAAATAGG - Intronic
1129373890 15:75115584-75115606 TCTACCACTCAGCAGGATGTGGG - Intronic
1130847512 15:87761173-87761195 CCTAGCTCACAAAGGTATGTGGG + Intergenic
1131759672 15:95608010-95608032 CTAACCACACAGAAATATGTAGG + Intergenic
1131967859 15:97864434-97864456 CTTAACACCAAGAAGTATGTAGG + Intergenic
1134881575 16:17748972-17748994 CCTAGAAGACAGAAGTATTTAGG - Intergenic
1136163424 16:28436131-28436153 CCTACCAATCAGCAGGATGTGGG + Intergenic
1136199539 16:28678856-28678878 CCTACCAATCAGCAGGATGTGGG - Intergenic
1136215885 16:28793029-28793051 CCTACCAATCAGCAGGATGTGGG - Intergenic
1138413880 16:56860221-56860243 CCCACCCCACAGCACTATGTGGG + Intergenic
1138769529 16:59647593-59647615 CCTACCACATAGGATTTTGTAGG + Intergenic
1139522743 16:67494116-67494138 CCCACCAGAAAGAATTATGTGGG - Intergenic
1141145039 16:81523409-81523431 CCTGTCACACAGAAGGACGTGGG + Intronic
1141790686 16:86232272-86232294 CCTCCCACACAAAAGTTTATGGG - Intergenic
1145282546 17:21478361-21478383 CTTCCCACACAGCAGCATGTTGG - Intergenic
1147608521 17:41787421-41787443 TCTACCTCACTGGAGTATGTGGG + Intergenic
1147997677 17:44369725-44369747 TCTACCACTCAGCAGGATGTGGG + Intergenic
1151085550 17:71376315-71376337 CCCACCGCAAAGAAGTATCTGGG + Intergenic
1155994356 18:32314001-32314023 TATACCACATAGAAATATGTAGG + Intronic
1156122093 18:33857625-33857647 CCTACCACACAGCAGTTGGATGG - Intronic
1156295135 18:35782498-35782520 TCTAGCATACAGAAGTATGATGG + Intergenic
1158823354 18:61186704-61186726 CCTTCCAGATAGAGGTATGTAGG - Intergenic
1164676475 19:30104836-30104858 CCCACCACACAGAGCTCTGTGGG - Intergenic
1165357082 19:35310929-35310951 CCCACCACACTGGAGTGTGTAGG - Intronic
1166663500 19:44662754-44662776 CAGACCACACAGAAGGGTGTGGG + Exonic
926003256 2:9351508-9351530 CCTGCCACACAGAACTACCTAGG - Intronic
931252340 2:60544381-60544403 CCTACCCCCCAGCAGGATGTGGG - Intronic
931342496 2:61415012-61415034 CCTGCCACACAAAAATGTGTGGG + Intronic
932597586 2:73103698-73103720 CAAACCACACAGAAAGATGTGGG + Intronic
935132538 2:100271334-100271356 CCCACCACAGAGAAATATGTTGG + Intergenic
935133928 2:100282002-100282024 ACTCCCACACTGCAGTATGTGGG + Exonic
936145121 2:109975735-109975757 CTCCCCACACAGCAGTATGTTGG + Intergenic
936199564 2:110395743-110395765 CTCCCCACACAGCAGTATGTTGG - Intergenic
936329768 2:111537548-111537570 CCTACCCCACAAAAGTCTGGTGG - Intergenic
937416919 2:121722608-121722630 CCTACCACACAGCAGTTTGAAGG - Intergenic
939289822 2:140179831-140179853 CTTACCAGACAGAAGTACCTTGG - Intergenic
939802826 2:146733611-146733633 CCTACTAGACAAAAGAATGTTGG - Intergenic
1169951886 20:11053852-11053874 CTCACCACAAAAAAGTATGTTGG + Intergenic
1172417279 20:34780131-34780153 CTTCCCACTCTGAAGTATGTTGG + Intronic
1172760212 20:37316157-37316179 CCTACCACCCACACGGATGTGGG - Intronic
1173671891 20:44804771-44804793 CCCACCAAACAGAACTAGGTGGG + Intronic
1175435012 20:58940036-58940058 TCTACCACACAGAAATTTGAAGG - Intergenic
1178268053 21:31163316-31163338 CCGACCCCACAAAAGTAAGTGGG + Intronic
1179032332 21:37731528-37731550 CCTACCACACAGATTTATTAAGG - Intronic
1181299926 22:21872505-21872527 CCTACCTCACATAAGTCTGTTGG + Intergenic
1181461414 22:23088334-23088356 CCTTCCTCACACAAGGATGTGGG - Intronic
1183617748 22:38955476-38955498 CCTAGTGCACAGAAGGATGTGGG + Intronic
1184282365 22:43445183-43445205 CCTTCCACACAGAAATAAGGAGG - Intronic
1185196638 22:49474895-49474917 CCCACTACACAGAGGGATGTCGG + Intronic
954936126 3:54328735-54328757 CCTCCCACAGAGAGGAATGTGGG + Intronic
954961373 3:54568049-54568071 ATTGCCACACAGAATTATGTTGG + Intronic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
957007209 3:74963592-74963614 CCTAAAGCACAGAAGTAAGTAGG + Intergenic
959029036 3:101276175-101276197 TCTAACACAGAGAAGTTTGTGGG + Intronic
960112930 3:113863304-113863326 CCTATCACTCAGCATTATGTAGG - Intronic
960759913 3:121062320-121062342 CCTACCAGCCAGAAGAAAGTGGG - Intronic
961800594 3:129445775-129445797 CCTACCTCACAGAATTATTGTGG + Intronic
962158464 3:132974210-132974232 CCTTCCAGGCAGAAGTCTGTTGG + Intergenic
962440765 3:135413835-135413857 CCTAACACACACAAGGATGAAGG + Intergenic
962947868 3:140188398-140188420 CCTACCACTAAGAAGCATGGTGG + Intronic
964024981 3:152061747-152061769 CCTACCAAAGTGAAGTTTGTTGG + Intergenic
964775949 3:160277395-160277417 CCCACTAAACAGTAGTATGTGGG + Exonic
965622123 3:170652314-170652336 CCTACAACAAAGAATTATCTGGG - Intronic
965716174 3:171605727-171605749 CCTACCACACAGGATTAAGGTGG - Intronic
966794809 3:183702935-183702957 ACTAGCACACAGAAGACTGTAGG - Intronic
969967048 4:11007696-11007718 CAGACCACACAAAAGTATTTAGG + Intergenic
972104437 4:35463792-35463814 CCAACCCCACAGCAGTGTGTAGG - Intergenic
974302252 4:60083101-60083123 CCTACCAGCCAGAAGAACGTGGG + Intergenic
974420133 4:61662646-61662668 CTTTCCACCCAGAAGTCTGTCGG - Intronic
976094632 4:81495199-81495221 CCTACCACAGTGAAATATATGGG + Intronic
976406163 4:84662416-84662438 CCTATCACACTGAAGTGTTTTGG - Intergenic
976944096 4:90742983-90743005 CATACCACACATAAGTAATTTGG + Intronic
977079367 4:92504318-92504340 CCTACCACACAGAGGCCTCTAGG - Intronic
978108474 4:104932375-104932397 CCTACAAGCCAGAAGTAAGTAGG + Intergenic
978593759 4:110354910-110354932 CCCACCACACAGAAGAATGTAGG - Intergenic
979087573 4:116432518-116432540 CCTATCACACAGAAATTTTTTGG - Intergenic
979688751 4:123538960-123538982 CCTACCAATCAGCAGGATGTGGG + Intergenic
979899589 4:126200931-126200953 TCTACCAATCAGCAGTATGTGGG - Intergenic
981360417 4:143839672-143839694 CCTTCAACCCAGAAGCATGTTGG + Intergenic
981371189 4:143960737-143960759 CCTTCAACCCAGAAGCATGTTGG + Intergenic
981917365 4:150049632-150049654 CCTCCCACACAGACCTATATGGG - Intergenic
982608952 4:157550134-157550156 CCTACCACACATAAGGATTACGG - Intergenic
983197636 4:164825275-164825297 ACTACTACATAGAAATATGTGGG + Intergenic
983529246 4:168792687-168792709 CCTCCCACACAGATGTGTTTTGG - Intronic
986383031 5:7205766-7205788 CCTCCCATCCAGATGTATGTGGG + Intergenic
986848740 5:11785693-11785715 CCTTGCAGAAAGAAGTATGTTGG + Intronic
991946490 5:71902835-71902857 CCTACCAGACAGCAGGATGGAGG + Intergenic
992059037 5:73023738-73023760 TTTAACACACAGAAATATGTTGG + Intronic
993068225 5:83127372-83127394 ACTACCACAAAACAGTATGTGGG - Intronic
993615060 5:90100915-90100937 CCTAACACACTGAAGCATGCAGG - Intergenic
993622725 5:90187577-90187599 CCCAAGACACAGAAATATGTGGG + Intergenic
998182607 5:139955961-139955983 CCTACCACACATGAGAATGTAGG + Intronic
1000754901 5:165146297-165146319 CCAACCAACCAGAATTATGTTGG - Intergenic
1004295192 6:14403629-14403651 CGTACAACACAGAAGTCTGCTGG - Intergenic
1008386725 6:50900248-50900270 TCTGCCACACACAAGAATGTGGG + Intergenic
1009504253 6:64454772-64454794 CCCACCACAAAGAGATATGTAGG + Intronic
1014242657 6:119034944-119034966 CTTGCCACACAGGAGTACGTTGG - Intronic
1014718014 6:124888053-124888075 CCGACCCCACAGCAGTGTGTAGG - Intergenic
1014787747 6:125637793-125637815 CCTAACAATCAGAAGTAGGTAGG - Intergenic
1020357476 7:7293014-7293036 CATCCCACAGAGAAGTATGCTGG - Intergenic
1022415040 7:30170234-30170256 CTTCCCACACAGAAGTACTTTGG + Intergenic
1022427632 7:30284461-30284483 CCTACCACACCGCAGTACCTTGG + Exonic
1024735684 7:52302370-52302392 TCTACCAAACAGCAGGATGTGGG - Intergenic
1028365203 7:90021119-90021141 TCTACCTCACAGAATTATGAGGG + Intergenic
1030334545 7:108310470-108310492 CTTCCCAAACAGAAGGATGTGGG + Intronic
1034967002 7:155397950-155397972 TCTACCAATCAGCAGTATGTGGG - Intergenic
1039742088 8:40392239-40392261 CCTCCAACTCAGAAGTATTTAGG + Intergenic
1041591460 8:59590182-59590204 CCAACCACTAAGAAGTATTTTGG + Intergenic
1043286725 8:78541346-78541368 CCCACCTCAAAGAAGTATGAGGG + Intronic
1043781609 8:84343160-84343182 CCTTCCACAGAGAGGTATGGAGG + Intronic
1045777955 8:105828556-105828578 CCTACCTCACAGTAGGAGGTTGG - Intergenic
1049316912 8:141974270-141974292 CCTACCCCACAGAAGCATGATGG + Intergenic
1050202110 9:3156769-3156791 CCAACCCCACAGCAGCATGTAGG + Intergenic
1050218674 9:3360434-3360456 CCTAGTACACATCAGTATGTTGG + Intronic
1050736488 9:8769033-8769055 GCTAACACACAGAATTAGGTGGG - Intronic
1050782434 9:9354517-9354539 CCTACCACAAAAAAAAATGTAGG - Intronic
1050872162 9:10585737-10585759 CATAACACACACAAGTGTGTGGG + Intronic
1056429737 9:86515248-86515270 TCTACCAGTGAGAAGTATGTGGG + Intergenic
1059659965 9:116390959-116390981 CCTACCACACAGAAGTATGTTGG - Intronic
1061705556 9:132450502-132450524 CCTATCTCACAGAAGTTTGGTGG - Intronic
1187243399 X:17533116-17533138 CCCACCACACAGGAGTGTGGGGG + Intronic
1187998658 X:24957076-24957098 CATGCCACACAGAAGGCTGTTGG + Intronic
1188359881 X:29240160-29240182 CCTACCACATAGTAGTATATAGG + Intronic
1193250710 X:79288363-79288385 GCTACCACACAGAACTCTCTGGG - Intergenic
1195412824 X:104587206-104587228 CCTACCTCAAAGAATTGTGTGGG + Intronic
1196055672 X:111352202-111352224 CCTACAACAAAGAATTATCTGGG + Intronic
1197340168 X:125256398-125256420 CCTACCAATCAGCAGGATGTGGG + Intergenic