ID: 1059663554

View in Genome Browser
Species Human (GRCh38)
Location 9:116425025-116425047
Sequence AAGCTGTGCTAGAGGAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 284}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059663554_1059663557 13 Left 1059663554 9:116425025-116425047 CCATTCTTCCTCTAGCACAGCTT 0: 1
1: 0
2: 1
3: 25
4: 284
Right 1059663557 9:116425061-116425083 TCCTTCTCTATAATTTCCACTGG 0: 1
1: 0
2: 0
3: 28
4: 251
1059663554_1059663559 14 Left 1059663554 9:116425025-116425047 CCATTCTTCCTCTAGCACAGCTT 0: 1
1: 0
2: 1
3: 25
4: 284
Right 1059663559 9:116425062-116425084 CCTTCTCTATAATTTCCACTGGG 0: 1
1: 0
2: 0
3: 27
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059663554 Original CRISPR AAGCTGTGCTAGAGGAAGAA TGG (reversed) Intergenic
901287240 1:8090744-8090766 AAGCTGGGGTAGAGGCAGCAGGG + Intergenic
901952131 1:12757807-12757829 AAGCTGTCCTAGGAGAAGGAGGG - Intronic
902310471 1:15578075-15578097 AAGCTTTGCTAAAGCAAGAGTGG + Intronic
903767424 1:25743732-25743754 AGCCTGATCTAGAGGAAGAAGGG + Intronic
904919293 1:33994276-33994298 TAGGTGAGCGAGAGGAAGAAGGG + Intronic
905611763 1:39358677-39358699 ACACTGTGCCAGAGAAAGAAAGG - Exonic
906046782 1:42837143-42837165 AAGATTGTCTAGAGGAAGAAAGG - Exonic
906330734 1:44881952-44881974 AATCTGTACTAGGGGAAGAAGGG + Intronic
907461416 1:54607837-54607859 AATCTGTGCTAGAGGGGGCAGGG + Intronic
907677903 1:56535690-56535712 AAGCTCTGCTTGGGGAAGGAAGG + Intronic
908110609 1:60893813-60893835 AAGCTTTGCTGGTGGAATAAAGG + Intronic
908387070 1:63652930-63652952 GACCTGTGGTTGAGGAAGAAAGG + Intronic
909315965 1:74219687-74219709 ATGCTATGAAAGAGGAAGAAAGG - Intronic
909709765 1:78634485-78634507 AAGCTGTGCTTCAGAAATAAAGG + Intronic
910005154 1:82387455-82387477 AAGCTGTGGGAAAGGAAGAGAGG + Intergenic
913297214 1:117333889-117333911 AAGCTTTGCAATAGGAAGACCGG + Intergenic
914895221 1:151664831-151664853 AAGCCTTGCTAGAGGAACACTGG - Intronic
915042741 1:152982464-152982486 TAGCTCTGCTAAAGTAAGAAGGG - Intergenic
915204159 1:154257092-154257114 AAAAAGTGCTGGAGGAAGAATGG - Exonic
916214223 1:162382197-162382219 AGGCTTGGCTAGAGGATGAAAGG + Exonic
916723547 1:167503325-167503347 AAGCTGGGCTAGAGGATTAAAGG - Intronic
917953351 1:180064398-180064420 TAACTGTTCAAGAGGAAGAAAGG + Intronic
918529442 1:185501992-185502014 AAGATGTGACAGTGGAAGAATGG + Intergenic
919138049 1:193535343-193535365 TAGTAGTGATAGAGGAAGAATGG - Intergenic
919443544 1:197670924-197670946 AAGTTGTGCTAAAGAGAGAATGG + Intronic
919567403 1:199206202-199206224 AAGATGTGCCAGAGGAAGGACGG + Intergenic
920098852 1:203504051-203504073 AAGCTGTGGGAGAGGAAGAGGGG + Intronic
921741614 1:218691716-218691738 TAGCTGAGCCAGAGGAATAAGGG - Intergenic
922022678 1:221720123-221720145 AAGCTATGCTACAGGAACCAGGG - Intronic
924095529 1:240547083-240547105 AGGCTATGCTAGATGGAGAAGGG + Intronic
924618219 1:245633433-245633455 AAGCAATACAAGAGGAAGAAAGG - Intronic
924810604 1:247398258-247398280 AAGCTGAGCAAGAGGAGGAGAGG + Intergenic
1063185951 10:3651787-3651809 AAGCTCTGCTTCAGGGAGAAGGG + Intergenic
1065328453 10:24570392-24570414 AAGCTGTGCTCTGGGCAGAAAGG + Intergenic
1065790243 10:29254020-29254042 AAGCTGTGGAAGTGGATGAATGG - Intergenic
1066279838 10:33905851-33905873 AAGGTGTGCAAGGAGAAGAATGG + Intergenic
1068311324 10:55280233-55280255 AAGCTGTGCTATGGAAAGGATGG + Intronic
1068775061 10:60860102-60860124 AATATGAGCAAGAGGAAGAATGG - Intergenic
1069222291 10:65899864-65899886 AACTTGTGATAGAGGAAGCATGG + Intergenic
1070457841 10:76634477-76634499 AAACTTTGCTTGAGGAGGAAGGG + Intergenic
1071256992 10:83879754-83879776 AAGCCATGCCAGAGGAAGAATGG - Intergenic
1071281356 10:84107007-84107029 AAGCTTTTCTAGAGAGAGAACGG + Intergenic
1071819656 10:89266758-89266780 AATCTGTTCCAGAGCAAGAATGG + Intronic
1071930514 10:90464525-90464547 AAGCTGTGCTCTAGGCAGAATGG - Intergenic
1072337913 10:94416150-94416172 CACCTGTGCTACTGGAAGAAAGG + Intronic
1073070500 10:100790510-100790532 AGCCTGTGCTTGGGGAAGAAGGG - Intronic
1075687009 10:124371276-124371298 AATCTGGGGTAGAGGAAGCAGGG - Intergenic
1075883096 10:125871834-125871856 AAGCAGAACTAGGGGAAGAAAGG - Intronic
1075922541 10:126225102-126225124 AGGCTGTGCTGGTGGCAGAAGGG + Intronic
1076333200 10:129686798-129686820 AGGCTGTGATAGAGGAAGGCCGG + Intronic
1077211929 11:1375158-1375180 AGGCTGTGCTGGAGAAAGATGGG - Intergenic
1078169072 11:8914836-8914858 CATCTGTGCCAGAGGAAGGAGGG + Exonic
1080330350 11:31130189-31130211 AAGGTCTGCTAGAGGAAGTGGGG - Intronic
1080341153 11:31266835-31266857 AAGCTGTTCTACAGGCTGAAAGG - Intronic
1080417170 11:32079477-32079499 AAGCTGTGTTAGTGGATGTATGG + Intronic
1081296039 11:41390587-41390609 AAAGTTTGCTACAGGAAGAAAGG - Intronic
1082156365 11:48821864-48821886 AAGCTGCGCAAGTGAAAGAAAGG - Intergenic
1082955531 11:58866164-58866186 AAGCTTTTACAGAGGAAGAAAGG - Intronic
1082962998 11:58936943-58936965 AAGCTTTTAGAGAGGAAGAAGGG - Intronic
1083746678 11:64740986-64741008 AGGCTCTGCTAGACCAAGAAGGG - Exonic
1084054411 11:66623063-66623085 AAGCTGTGGTAGGAGAAGACAGG - Intronic
1085708667 11:78809753-78809775 AAGCTCTGCAAGGGGAAAAAAGG - Intronic
1086884926 11:92194215-92194237 TTGCTGTGCTAGATGAAGATAGG - Intergenic
1088002501 11:104899337-104899359 CAGGTGTTCAAGAGGAAGAAGGG - Intergenic
1088552136 11:111023682-111023704 AAGAGGTGAGAGAGGAAGAAAGG + Intergenic
1088801399 11:113310628-113310650 AAGCAGTGCAAGATGAAGCAAGG - Intergenic
1089198757 11:116710844-116710866 GAGCTGTGCCAGAGGAGAAATGG + Intergenic
1089699233 11:120234452-120234474 GAGCAATGCTAGAGGAAGAGGGG - Intergenic
1089890320 11:121874273-121874295 TAGCTCTGCAAGAGGTAGAATGG - Intergenic
1090590593 11:128262720-128262742 GGGCTGGGCTAGAGGAAGGAAGG + Intergenic
1090828255 11:130402978-130403000 GATCTGTGATAGAGGAATAAAGG + Intergenic
1091251823 11:134150503-134150525 GAGCTGTGCTGGATGAAGCAAGG - Exonic
1091325232 11:134681912-134681934 AAGCTCTGCCAGAGAAAGACTGG - Intergenic
1092254024 12:6916580-6916602 AAGCCATGCTAGAGGAGGACTGG - Intronic
1093380367 12:18483979-18484001 ATGCTGTTCTCCAGGAAGAAAGG + Intronic
1093461472 12:19410879-19410901 TAGCTGTGTTTGAGGAAGGAGGG + Intronic
1094879506 12:34702860-34702882 AAACTGTTCTATAGAAAGAAAGG - Intergenic
1095034030 12:37334592-37334614 ATGCTGTGCTATAAAAAGAAAGG + Intergenic
1095034318 12:37340290-37340312 ATGCTGTGCTATAAAAAGAAAGG + Intergenic
1095056680 12:37614415-37614437 AACCTGTGCTATCAGAAGAAAGG - Intergenic
1096424223 12:51487561-51487583 AAGTGGTGCTAGAGGATAAAAGG - Intronic
1097605257 12:61745869-61745891 ATGCAGTGGAAGAGGAAGAAAGG + Intronic
1097991756 12:65842618-65842640 AATCTCTGCTATTGGAAGAAAGG - Intronic
1098154324 12:67581661-67581683 AGGATGTCCTAGAGGCAGAATGG + Intergenic
1102975931 12:117207299-117207321 CAGCTGTGCTGGAGGAAAAGGGG + Intergenic
1104344861 12:127986895-127986917 AAAGTGTGCTACAGGAAGATGGG - Intergenic
1105891571 13:24685973-24685995 GAGCTGTCTTAGAGGCAGAAGGG + Intronic
1106098811 13:26675992-26676014 AAGTAGGGCTAGAGGAAGAATGG + Intronic
1107725689 13:43296812-43296834 AATCTTTTCTAGAGGGAGAAAGG + Intronic
1107829698 13:44363431-44363453 AAGTTGTCCTAGATTAAGAATGG - Intergenic
1108020424 13:46122308-46122330 ATGCTGTCCTAGAAGAATAAAGG - Intergenic
1108424866 13:50289415-50289437 ATGGCGTGATAGAGGAAGAAAGG - Intronic
1110634594 13:77751794-77751816 ATGCTGTGCTCTAGGAAGAGTGG + Intronic
1110700467 13:78541396-78541418 AAGCTGAGCTAGATGGAGAAAGG - Intergenic
1110701788 13:78556943-78556965 AAGATGTGCTAGAGGCAGCCGGG + Intergenic
1112579507 13:100666100-100666122 AGGGTGTGCTACAGAAAGAAAGG + Intronic
1113616193 13:111682297-111682319 AAGATGTTCTAAAGGAAAAATGG + Intergenic
1113621661 13:111767190-111767212 AAGATGTTCTAAAGGAAAAATGG + Intergenic
1113892427 13:113743443-113743465 AAGCAGGGAAAGAGGAAGAAGGG + Intergenic
1115036115 14:28858619-28858641 AAGCTGTACGAAAGGAAGAAGGG - Intergenic
1117652641 14:57922830-57922852 CAGCTATGTTAGAGGAAGAAGGG - Intronic
1118364746 14:65085325-65085347 TAGTTGTGTTAGAGGAAGGAGGG + Intronic
1118520214 14:66575167-66575189 AAGCTGTCCTTCAGGAATAAAGG - Intronic
1126696043 15:51326310-51326332 AAGCTCTTCTAGAAAAAGAAAGG + Intronic
1126822803 15:52521484-52521506 ATGCTGGGCTAGAGGGAGACTGG - Intronic
1126884392 15:53134095-53134117 AGGCTGAGCTGGAGGAAGAAAGG + Intergenic
1127101936 15:55575570-55575592 AAGGTGTGCTAGAGGGAGACTGG + Intronic
1127185802 15:56479647-56479669 AAGCTGTGGTAGAGTAAGGACGG + Intergenic
1127839245 15:62816393-62816415 AAGCTCTGCCAGTGGAAGCAAGG - Intronic
1131018709 15:89079778-89079800 ATGCTGAGCTAGAAGAAGGAGGG - Intergenic
1132367628 15:101269045-101269067 CAGTTGTGCCAGAGGAAGACTGG + Intergenic
1132877307 16:2145761-2145783 ACGCTGTGCTACAGGAATATTGG - Intronic
1133887474 16:9844076-9844098 AGCCTGTGATAGGGGAAGAAGGG - Intronic
1135174786 16:20218302-20218324 GAGCTGGGCTAGAGCAGGAAAGG - Intergenic
1136082435 16:27860904-27860926 AAGCTGTGGTAGAAGAGGATTGG + Intronic
1136525632 16:30828145-30828167 ATCCTGTGCTAGAGGAGAAATGG + Intergenic
1136547513 16:30964108-30964130 CAGCTGTGTCAGAGGAAGAGCGG - Exonic
1136747952 16:32608618-32608640 CAGCTGTGGTGGAGGATGAATGG - Intergenic
1137815120 16:51391688-51391710 TAGCTGAGCTAAAAGAAGAAAGG - Intergenic
1138678729 16:58670244-58670266 AAGCAGTGCTGGATGGAGAAAGG + Intronic
1140342714 16:74180853-74180875 AAACTGTGCCAGGGGAAGCAAGG + Intergenic
1140462042 16:75147738-75147760 AAACTGTTCTAAAGGATGAAAGG + Intergenic
1140646400 16:77036066-77036088 CACCTGTGCTAAAGGAAGACAGG - Intergenic
1141135393 16:81461543-81461565 AAGCTGGGCTACATCAAGAATGG - Intronic
1141428287 16:83957474-83957496 AGGCTGTGTGAGAGCAAGAAGGG + Intronic
1203050089 16_KI270728v1_random:867825-867847 CAGCTGTGGTGGAGGATGAATGG - Intergenic
1144001896 17:11063151-11063173 GAGCTGTGATTAAGGAAGAATGG - Intergenic
1144595863 17:16569488-16569510 CAGATTTCCTAGAGGAAGAATGG + Intergenic
1144642583 17:16945749-16945771 AGGCTGTGCTAGATTAAAAATGG + Intronic
1148087682 17:45004300-45004322 AAGCGGTGAGAGAGGAAGGAAGG - Intergenic
1148807404 17:50270969-50270991 GGGCTGTTCTAGAGGAAGGAGGG - Intergenic
1149495068 17:57112329-57112351 AAGCTCTGCTTTAGGAAGAAAGG - Intronic
1150315925 17:64168816-64168838 CACCTGAGTTAGAGGAAGAAAGG + Intronic
1152191482 17:78890878-78890900 AAGCTGAGCTAGAAAAAGAGAGG - Exonic
1152350572 17:79781946-79781968 AAGCTGAGAGACAGGAAGAAAGG - Intronic
1154967522 18:21374571-21374593 AAGCTGTGGTACAGGTAGATGGG - Intronic
1155433532 18:25787256-25787278 AGGCTGTGTTAGATGAAGACTGG - Intergenic
1155673521 18:28401288-28401310 AAGCTGTGCTAGGGGATTTAAGG + Intergenic
1156164580 18:34402967-34402989 AACCTGAGCTACTGGAAGAAGGG - Intergenic
1157532805 18:48436193-48436215 GAGCTTTGCTGGTGGAAGAAAGG + Intergenic
1158119223 18:54029886-54029908 AACCTGTTCTAGCTGAAGAAGGG - Intergenic
1159616506 18:70586136-70586158 AAGCTGTCCTTCAGAAAGAAAGG + Intergenic
1159741243 18:72173668-72173690 AAGTTGTGCAGGAGGATGAAAGG - Intergenic
1159848075 18:73490107-73490129 AATATGTGTTAGAGGAAGGAAGG + Intergenic
1161936549 19:7375922-7375944 AAGCAGTGCTATAGGTAGGAAGG + Intronic
1164274242 19:23702740-23702762 CAGGTGGGCTAGAGGAAGAAAGG - Intergenic
925537514 2:4933384-4933406 AATCTCTCCTAGAGGAGGAAAGG - Intergenic
927068288 2:19496190-19496212 AGGCTGAGCCAGGGGAAGAACGG - Intergenic
928203768 2:29269475-29269497 CAGCTGTGCTCCAGGAAGAGAGG - Intronic
931207635 2:60163584-60163606 AAGCTGTGATACAAAAAGAAAGG - Intergenic
931226848 2:60339219-60339241 AAGCTGTCATCTAGGAAGAAAGG + Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
932945909 2:76230369-76230391 AAGCTTTGCTGGACGATGAAAGG + Intergenic
933188969 2:79311744-79311766 CAGCTTTGCTAGAGGAAGGATGG - Intronic
933281942 2:80341396-80341418 AAGCTGTGTGACAGGAACAAAGG + Intronic
934093482 2:88575989-88576011 ATGATGTGCTATAGGAAGGAAGG - Intronic
935207103 2:100905681-100905703 AAGCAGTGGCAGAGGCAGAAAGG - Intronic
937169342 2:119850184-119850206 AAGCTGTGTTAAAGGGAGACAGG - Intronic
939537510 2:143450007-143450029 AAGCTGTCTTAAAGTAAGAAAGG - Intronic
940662736 2:156567704-156567726 AAGCTGGTCTACATGAAGAAGGG + Intronic
940697067 2:156993065-156993087 AAGATGTGTAAAAGGAAGAAAGG + Intergenic
942199747 2:173559207-173559229 AACCTTTGCTGAAGGAAGAAAGG - Intergenic
942325468 2:174772649-174772671 CAGCTGTTCTAGATGAAGGAAGG - Intergenic
942593129 2:177567387-177567409 GAGCAGTGCTGGAGGAAGAGGGG - Intergenic
943540802 2:189211924-189211946 AAGCTGTGCAAAAGAAAGCAAGG + Intergenic
945050742 2:205821914-205821936 AAGCTCAGCTGGAGGAGGAAGGG + Intergenic
945561001 2:211340232-211340254 AAGCTAGGCTAGACAAAGAAGGG - Intergenic
945920253 2:215748536-215748558 CAGCTGTGCTGGAGGAACTAAGG + Intergenic
946130852 2:217605515-217605537 TAGCTGGGCAAGAGAAAGAAGGG + Intronic
946401584 2:219471409-219471431 CAGCTGTGCTGGAGACAGAATGG + Intronic
946581455 2:221132650-221132672 AAACTACACTAGAGGAAGAATGG - Intergenic
946649974 2:221882582-221882604 AATATGGGCTAAAGGAAGAAAGG + Intergenic
947669583 2:231927733-231927755 AAGCTGTGCCTGAGGCAGGAAGG + Intergenic
947839805 2:233200446-233200468 AACCAGTGTTAGAGGAAGAGAGG - Intronic
947978550 2:234388167-234388189 CAGCTGTGCCAGAGGAGAAAGGG + Intergenic
1170661597 20:18346393-18346415 AAACTGTACTGAAGGAAGAAGGG + Intergenic
1173759598 20:45547867-45547889 AAACTGTGGGAGAGGGAGAAAGG - Intergenic
1175963838 20:62650300-62650322 CAGCTGGGCTTGGGGAAGAAGGG - Intronic
1181449614 22:23010570-23010592 AAGTTGTGCCACTGGAAGAATGG + Intergenic
1181687572 22:24540213-24540235 AGGCAGTACTAGAGGTAGAAGGG - Intergenic
1183045292 22:35214586-35214608 AACCAGTGTTATAGGAAGAATGG - Intergenic
1183756392 22:39770257-39770279 AAGAGGTGCTAGAGGGAGATGGG + Intronic
1185102596 22:48849687-48849709 AAGTTGGGAGAGAGGAAGAAAGG + Intronic
949280533 3:2341633-2341655 AATCTGTGGTAGAGGAAGAAAGG - Intronic
952133825 3:30394992-30395014 AAGCAGTGGAGGAGGAAGAAGGG - Intergenic
953164731 3:40454800-40454822 AAGGTGAGCTAGAAAAAGAAGGG + Intergenic
953429784 3:42829671-42829693 CAACTGTGCTATAGGAAGAAGGG - Intronic
953833500 3:46323285-46323307 AGGCAGTGGCAGAGGAAGAAAGG - Intergenic
955882296 3:63560357-63560379 AAGCTGTGATTGGGGAAGTAAGG + Intronic
957389920 3:79550995-79551017 AAGCTGAGCAAGAGCAAGAGGGG - Intronic
958274094 3:91551117-91551139 TAGCTGCTCTATAGGAAGAAAGG + Intergenic
959502491 3:107122573-107122595 AGGCTGGGCTAGGGGAAGACAGG + Intergenic
959762474 3:109982856-109982878 ATGCTGTGCTATAGAAAAAAGGG - Intergenic
963523853 3:146390951-146390973 AAATTGTGTTGGAGGAAGAATGG + Intergenic
966268925 3:178081629-178081651 AAGCTGTTTTGGAGGGAGAAAGG - Intergenic
966547536 3:181167229-181167251 GAACATTGCTAGAGGAAGAAGGG + Intergenic
968787891 4:2637621-2637643 CTGCTGAGCTAGAGGCAGAAAGG - Intronic
970320959 4:14874963-14874985 CAGCTGTGCCAGAAGAAGATGGG + Intergenic
972943796 4:44228691-44228713 AAACTGTGATAGAGGAATAATGG - Intronic
974824389 4:67108251-67108273 GAGCTGAGCTAGTGGAAAAAAGG - Intergenic
974993574 4:69125074-69125096 AGGCTGTGCTGGAGGCAGCAGGG - Intronic
976205463 4:82619550-82619572 AAGCTGTTCCGGATGAAGAATGG - Intergenic
977910879 4:102534569-102534591 ATGCTGTGAAAGAGAAAGAAAGG + Intronic
978149696 4:105418291-105418313 AAGTTGTGTTTTAGGAAGAAAGG + Intronic
978650304 4:110996194-110996216 AAGCTGTGCTGCAAGAAGAGGGG - Intergenic
978826049 4:113025318-113025340 AAATTGTGACAGAGGAAGAAAGG + Intronic
979715360 4:123831079-123831101 AAACTGCACTAGAGGAAGACAGG - Intergenic
982331194 4:154183861-154183883 AAACTGTGCTACAGGAGAAAAGG + Intergenic
982724469 4:158890918-158890940 ACACTGTGATAGAGGAAGGATGG + Intronic
983168768 4:164512205-164512227 AAGAGGTGCAAGAGGAGGAAGGG - Intergenic
983618876 4:169738383-169738405 AACATGAGCTAAAGGAAGAATGG - Intronic
984172463 4:176376940-176376962 AAACTGTTCTAGAGAAAAAAAGG + Intergenic
984496355 4:180502873-180502895 AAGGTGTGCTAAAGAAATAAGGG + Intergenic
984496493 4:180504741-180504763 AAGGTGTGCTAAAGAAATAAGGG - Intergenic
984830410 4:183967457-183967479 GAGTGGTGCAAGAGGAAGAAAGG + Intronic
986143663 5:5056090-5056112 GAGATGAGCTAGAGGAAGAATGG - Intergenic
986582619 5:9281216-9281238 ATTCTGTGCTAGAGGGAAAATGG - Intronic
986884565 5:12217180-12217202 AAGCTGTGAGGGAGGAAAAAAGG + Intergenic
987079666 5:14415327-14415349 AAGCTCTGCCTGAGGAAGAGGGG - Intronic
987379828 5:17275226-17275248 AAGCTCAGCAAGAAGAAGAAGGG + Exonic
988877723 5:35466625-35466647 ATGCTGAGATAGAGGAAAAATGG - Intergenic
989264698 5:39459260-39459282 AAGATGTGTTTGAGCAAGAAGGG - Intronic
991115511 5:62950138-62950160 AAGATGTTATTGAGGAAGAAAGG - Intergenic
991205464 5:64044723-64044745 AATCTTTACTAGAGGAAGACAGG + Intergenic
992947979 5:81828220-81828242 AAGCGGTGAGAGAGGAAGCAGGG - Intergenic
993559319 5:89384719-89384741 AAGTTATGATAGAGAAAGAAGGG + Intergenic
994098035 5:95864978-95865000 AAGGTGGGGTAGATGAAGAAGGG + Intergenic
994284750 5:97951160-97951182 AAGGGGTGCTGGAGGAAGAAGGG + Intergenic
994634910 5:102332784-102332806 AAGATGTACTAAAGGAGGAATGG + Intergenic
998734062 5:145114713-145114735 AGGAAGTGCTAGAAGAAGAAAGG + Intergenic
999087897 5:148909852-148909874 TAGCTGTGCTCCAGGAAGAGAGG + Intergenic
999263207 5:150250302-150250324 GAGCGGTGCTGGAGGAAGTAGGG + Exonic
999393122 5:151208678-151208700 ACCCTGGGCTGGAGGAAGAAGGG + Intronic
999651751 5:153774832-153774854 AAGCTGTGTTAGTGACAGAATGG + Intronic
1000772711 5:165376702-165376724 AAGCTGTGCTAGAGGGCAACTGG + Intergenic
1000858391 5:166428445-166428467 AAGCTAAGCAAAAGGAAGAAAGG + Intergenic
1001989173 5:176101974-176101996 CAGCTGTGGTGGAGGATGAATGG - Intronic
1001989842 5:176107298-176107320 CAGCTGTGGTGGAGGATGAATGG - Intronic
1002106693 5:176882782-176882804 AAGCTGTGTCAGAGAAAGGAAGG - Intronic
1002227029 5:177730840-177730862 CAGCTGTGGTGGAGGATGAATGG + Intronic
1002227697 5:177736164-177736186 CAGCTGTGGTGGAGGATGAATGG + Intronic
1002266449 5:178037589-178037611 CAGCTGTGGTGGAGGATGAATGG - Intronic
1002267119 5:178042934-178042956 CAGCTGTGGTGGAGGATGAATGG - Intronic
1005890177 6:30130979-30131001 AAACTGTGTAAGAGGAAGAGGGG - Intergenic
1006805710 6:36787792-36787814 AGGCAGTGATGGAGGAAGAAGGG - Intronic
1007594833 6:43045072-43045094 GAGCTGTGGGAGGGGAAGAAAGG - Intronic
1008913575 6:56762604-56762626 AAACTGTGATAGTGAAAGAAGGG - Intronic
1011937249 6:92795873-92795895 ACCCAGTGCTAGCGGAAGAAAGG - Intergenic
1013102383 6:106997947-106997969 AGGCTGTGCCAGAGCAGGAAAGG + Intergenic
1013235556 6:108195144-108195166 AAGCTCTGCAATAGGAAGGAAGG + Intergenic
1013666188 6:112351353-112351375 TAGCTGTGGTGGAGGAAGAGGGG - Intergenic
1013872026 6:114775692-114775714 AATCTGTGCTAGAAAAAAAATGG - Intergenic
1014715006 6:124853834-124853856 CAGCTGTGCTAGAGGAAAGGCGG - Intergenic
1015279865 6:131421545-131421567 AAGCTGTCCTGGGGGAAGCAAGG - Intergenic
1015825552 6:137307216-137307238 CAGCTGTGCTGGATGAGGAAAGG + Intergenic
1016989598 6:149920103-149920125 CAGGAGTGCTAGAGGAGGAAGGG + Intronic
1017479554 6:154838115-154838137 AAGATGAGTTATAGGAAGAAAGG + Intronic
1017625017 6:156339263-156339285 AGGCTGTGATAGAGCAAGAGTGG - Intergenic
1017655789 6:156627806-156627828 TAGCTGTGCTAAAGGAAAAGTGG - Intergenic
1018316880 6:162565286-162565308 CACCTCTGCTAGAGGAAGATAGG + Intronic
1019550093 7:1597858-1597880 GAGCAGTGATGGAGGAAGAAGGG + Intergenic
1022488419 7:30798338-30798360 GTGCTGTGTTAGAGAAAGAAAGG + Intronic
1023100314 7:36711381-36711403 ATGCTGTGCTTCAGGAACAAAGG - Intronic
1024348007 7:48333139-48333161 AATCTGTGCAACAGGGAGAAAGG - Intronic
1024667665 7:51562801-51562823 AATCTGTGAAACAGGAAGAAAGG - Intergenic
1028623838 7:92854785-92854807 AAGCTGGGTTAGATAAAGAATGG - Intergenic
1029599228 7:101553967-101553989 AAGCTGGGGTAGTGGATGAAGGG + Intronic
1030160997 7:106508477-106508499 TAGCAGTGGCAGAGGAAGAAGGG + Intergenic
1030608074 7:111659975-111659997 AAGCTGAGCGTGAGGATGAAGGG - Intergenic
1032163384 7:129527229-129527251 AAGCTGAGCTGGAGGATGAACGG - Intergenic
1034380089 7:150684402-150684424 GAAATGTGCTAGAGGGAGAAGGG - Intergenic
1035202334 7:157275707-157275729 AAAGTGGGCTAGAGGAGGAAGGG - Intergenic
1036061192 8:5323199-5323221 AAGCTGTGCTGGAAAGAGAAGGG - Intergenic
1038300326 8:26340090-26340112 AAGCTTTGCTTGACAAAGAATGG + Intronic
1042904389 8:73758246-73758268 AAGCTGGAGTAGAGGAGGAAAGG - Intronic
1044644271 8:94421490-94421512 AATCTGGGCTAGAGAAAAAAAGG - Intronic
1045147018 8:99357182-99357204 TAGGTGAGGTAGAGGAAGAAAGG - Intronic
1045402490 8:101833085-101833107 AAGCTGTGGCTCAGGAAGAAGGG - Intronic
1046244914 8:111546514-111546536 AAGCTGTGCTAAAGGGAGTAAGG + Intergenic
1046316173 8:112505121-112505143 AAGCAGTGGTAAAGAAAGAATGG + Intronic
1047290646 8:123526739-123526761 AAGATGTGGTAGAGGCAGATAGG - Intronic
1047563859 8:126019533-126019555 AAACTGTGAGAGTGGAAGAATGG + Intergenic
1048337869 8:133516289-133516311 AAGTTGTGGCAGAAGAAGAAGGG - Intronic
1048857552 8:138697471-138697493 AACCTTTGCTGGAGGAAGGAGGG - Intronic
1049091906 8:140521825-140521847 AAAATGTGCCAGAGGAAGAGGGG + Intergenic
1049212814 8:141394538-141394560 AGGCTGGGCTAGAGGCAGGAGGG + Intronic
1049993018 9:1007743-1007765 ACGGTGTGGTAGGGGAAGAATGG - Intergenic
1050476768 9:6048742-6048764 AAGCTGTGCTAGAAGGAGCCAGG - Intergenic
1051403230 9:16706196-16706218 AATCAGTGGTAGAAGAAGAAAGG - Intronic
1052324550 9:27203472-27203494 AAGGAGTGTTTGAGGAAGAATGG - Intronic
1052984487 9:34476555-34476577 GAGCTGTGCTAGAAGAACAAGGG + Intronic
1054993688 9:71360035-71360057 GAACAGTGCTAGAGGAAGAGTGG + Intronic
1056238514 9:84620005-84620027 AAGTTGTGATAGAGGAAGAGGGG + Intergenic
1056286246 9:85090661-85090683 CAGCTGTGAGGGAGGAAGAATGG + Intergenic
1057489957 9:95512788-95512810 AAGGGGTGCCAGAGGCAGAAGGG - Intronic
1059064087 9:111064427-111064449 AAACTCTGCTAGAAAAAGAAAGG - Intergenic
1059663554 9:116425025-116425047 AAGCTGTGCTAGAGGAAGAATGG - Intergenic
1060944490 9:127561916-127561938 CTTCTGTGCTGGAGGAAGAAGGG - Intronic
1061178409 9:129010630-129010652 GGGCTGGGCTCGAGGAAGAAGGG - Intronic
1061561608 9:131407786-131407808 AAGCTGTGGTAGAGTGAGGAGGG + Intronic
1062720048 9:138036112-138036134 AAGCTGTTCTTCAGGCAGAAGGG - Intronic
1186397323 X:9222990-9223012 AAGCTGTACTAGAGAAATATGGG - Intergenic
1187423419 X:19156316-19156338 AAGTTTTGATAGAGGCAGAAAGG + Intergenic
1187775106 X:22747637-22747659 ATGCTATGCTAGGGGAAAAAGGG + Intergenic
1188814288 X:34692150-34692172 CACCTTTGCTAGAGGAAGACAGG - Intergenic
1192220088 X:69191945-69191967 AGGCTCTGCCAGAGGAGGAAGGG - Intergenic
1195011823 X:100739820-100739842 AAACATTGCTAGAGGATGAAAGG - Intergenic
1197092802 X:122558735-122558757 AAGCTGTGCTGGATGAAGGATGG - Intergenic
1198553001 X:137763822-137763844 TAAATGTGCTAGAGGCAGAATGG + Intergenic
1200135043 X:153870682-153870704 AAGCTGTTCTTGAGGAAGCCTGG + Intronic
1201885671 Y:18879552-18879574 AAGGTGGGAGAGAGGAAGAAAGG + Intergenic