ID: 1059664978

View in Genome Browser
Species Human (GRCh38)
Location 9:116437911-116437933
Sequence GAGAGCCTCAAATTCTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059664970_1059664978 15 Left 1059664970 9:116437873-116437895 CCGTTTTATCCCTGGACCAAGCT 0: 1
1: 0
2: 0
3: 22
4: 136
Right 1059664978 9:116437911-116437933 GAGAGCCTCAAATTCTTGGAGGG No data
1059664972_1059664978 5 Left 1059664972 9:116437883-116437905 CCTGGACCAAGCTCTCATCTCTG 0: 1
1: 0
2: 0
3: 33
4: 307
Right 1059664978 9:116437911-116437933 GAGAGCCTCAAATTCTTGGAGGG No data
1059664971_1059664978 6 Left 1059664971 9:116437882-116437904 CCCTGGACCAAGCTCTCATCTCT 0: 1
1: 0
2: 3
3: 24
4: 386
Right 1059664978 9:116437911-116437933 GAGAGCCTCAAATTCTTGGAGGG No data
1059664973_1059664978 -1 Left 1059664973 9:116437889-116437911 CCAAGCTCTCATCTCTGTCCCTG 0: 1
1: 0
2: 2
3: 63
4: 574
Right 1059664978 9:116437911-116437933 GAGAGCCTCAAATTCTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059664978 Original CRISPR GAGAGCCTCAAATTCTTGGA GGG Intronic
No off target data available for this crispr