ID: 1059665858

View in Genome Browser
Species Human (GRCh38)
Location 9:116446036-116446058
Sequence TAACCCCTCCAGGCACTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059665858_1059665864 24 Left 1059665858 9:116446036-116446058 CCAGGCAGTGCCTGGAGGGGTTA 0: 1
1: 0
2: 1
3: 15
4: 150
Right 1059665864 9:116446083-116446105 TCCCTGATATGAAGGAGAGAGGG No data
1059665858_1059665861 -2 Left 1059665858 9:116446036-116446058 CCAGGCAGTGCCTGGAGGGGTTA 0: 1
1: 0
2: 1
3: 15
4: 150
Right 1059665861 9:116446057-116446079 TACTTGTGAAGGAGAGAAAGTGG No data
1059665858_1059665862 16 Left 1059665858 9:116446036-116446058 CCAGGCAGTGCCTGGAGGGGTTA 0: 1
1: 0
2: 1
3: 15
4: 150
Right 1059665862 9:116446075-116446097 AGTGGCAGTCCCTGATATGAAGG No data
1059665858_1059665863 23 Left 1059665858 9:116446036-116446058 CCAGGCAGTGCCTGGAGGGGTTA 0: 1
1: 0
2: 1
3: 15
4: 150
Right 1059665863 9:116446082-116446104 GTCCCTGATATGAAGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059665858 Original CRISPR TAACCCCTCCAGGCACTGCC TGG (reversed) Intronic
900102723 1:968897-968919 AGACCCCTCGGGGCACTGCCAGG + Intronic
901842151 1:11960556-11960578 TAGCACCTCCTGTCACTGCCAGG - Intronic
902091450 1:13907000-13907022 TAACCACTCCACGCATTACCTGG - Intergenic
903785592 1:25859224-25859246 TTACGCCTCCAGGCCCTACCTGG + Intronic
903868094 1:26412629-26412651 TAACCCCTCCCTGCCCGGCCTGG - Intronic
904412118 1:30330804-30330826 CAATCCCACCAGGCACTGCGAGG - Intergenic
904697433 1:32338142-32338164 CATCCCCGCCAGGCAGTGCCTGG - Intergenic
906021793 1:42635839-42635861 TAACCACTTGAGGAACTGCCAGG + Intronic
906696916 1:47829278-47829300 AAGCCCCTCCAGGAACTGGCTGG - Intronic
906939946 1:50247329-50247351 GAGCCCCTCCAGCCACTGTCTGG + Intergenic
908940307 1:69424391-69424413 TAACCCCACCAAGCACCCCCAGG + Intergenic
910322473 1:85963617-85963639 CAACTCCCCCAGGCAGTGCCAGG + Intronic
910726072 1:90340453-90340475 TAACCACTCCAGGAAATGACAGG - Intergenic
913112261 1:115666950-115666972 TAACTCTTCCAGCCACTGCTGGG - Intronic
914428734 1:147600602-147600624 TAACCTCTCCAAGCACTGCTTGG - Intronic
915211413 1:154312523-154312545 AAACTCTGCCAGGCACTGCCGGG - Intergenic
915212531 1:154321217-154321239 AAACTCTGCCAGGCACTGCCGGG - Exonic
918070615 1:181131291-181131313 CAACCCCTCAGGCCACTGCCAGG - Intergenic
923608250 1:235465011-235465033 TAATCACTTGAGGCACTGCCAGG - Intronic
1062905998 10:1180161-1180183 CAGCCCCTCCAGGCACATCCAGG + Exonic
1067065408 10:43101500-43101522 TGCCTCCTCCAGGAACTGCCTGG - Intronic
1067543521 10:47175390-47175412 CAGCCCTTCCAAGCACTGCCCGG + Intergenic
1069749783 10:70737664-70737686 TAACCCATCAAGGACCTGCCAGG - Intronic
1069861580 10:71475063-71475085 TTGCCCCTCCAGGCCCTGCAGGG + Intronic
1071315259 10:84389393-84389415 AAAGCCCTCAAGGAACTGCCAGG - Intronic
1074040145 10:109780333-109780355 CAACCCCTCCAGGAATAGCCAGG - Intergenic
1075044975 10:119139630-119139652 CATCCCCTGCTGGCACTGCCTGG - Intergenic
1076157989 10:128218148-128218170 TTACGCCTGCAGGCACTGCCTGG + Intergenic
1076363443 10:129906454-129906476 TAACCCCTCTCTGCACTGGCAGG + Intronic
1077474572 11:2780270-2780292 CAAGCCCTCCAGGCCCAGCCAGG - Intronic
1081567958 11:44271156-44271178 TACCCCCCCAGGGCACTGCCAGG + Intronic
1083282298 11:61634681-61634703 TCACCCCCCTAGGCACTGCCAGG + Intergenic
1084668680 11:70592496-70592518 CACCCCCTCCAGCCACGGCCAGG + Intronic
1089893596 11:121905332-121905354 TAATACCTCCAGGCTCTGCTTGG + Intergenic
1091453301 12:587000-587022 GAACCCCTCTTGGCACTGGCAGG - Intronic
1091753527 12:3037377-3037399 TTCCCCCTCTAGGCACTGCTGGG - Intronic
1096675273 12:53222660-53222682 GACCCCCTCCATGCAATGCCTGG - Intronic
1099335203 12:81347563-81347585 TCACCCCTCGAAGCCCTGCCAGG - Exonic
1099906901 12:88782160-88782182 TAACTCCTCAAGGAAATGCCTGG - Intergenic
1101491622 12:105214946-105214968 TCACCCCTCTGGGCTCTGCCAGG - Intronic
1105002860 12:132702521-132702543 TGGCCCCTGCAGGCTCTGCCAGG - Intronic
1105942052 13:25156295-25156317 CAGCCCATCCAGGCCCTGCCAGG + Intergenic
1105988025 13:25588771-25588793 TAACCCCCCAAGGCACTGAGAGG + Intronic
1108058606 13:46510164-46510186 CAACACCTCCAGGAGCTGCCTGG + Intergenic
1108576557 13:51796280-51796302 TGTCTCCTCCAGGCTCTGCCAGG - Intronic
1110660600 13:78055990-78056012 TAACTCCTCTAGCCAGTGCCTGG - Intergenic
1119682743 14:76605023-76605045 TTCCACCTCCAGGCACTGTCTGG - Intergenic
1121127323 14:91416908-91416930 TGACCCGTCCAGTCTCTGCCTGG - Intronic
1122144499 14:99681507-99681529 GAACAGCTCCAGGCACAGCCTGG - Intergenic
1122783203 14:104152394-104152416 CATGCCCTCCAGGCACTGCTGGG - Exonic
1202849702 14_GL000225v1_random:9048-9070 TAACCCCTGCAGGCACGGCCTGG - Intergenic
1124966534 15:34436757-34436779 TCTCCACGCCAGGCACTGCCTGG - Intronic
1126099655 15:45111683-45111705 TCTCCCCTCCAGGCCCTGCCAGG + Intronic
1126103876 15:45135354-45135376 TCTCCCCTCCAGGCCCTGCCAGG - Intronic
1128385727 15:67146987-67147009 GCACCCCGCCAGGCCCTGCCAGG + Intronic
1133118301 16:3590739-3590761 CAGCCCTTCCAGGGACTGCCAGG - Exonic
1135534360 16:23281540-23281562 TGACCCCACCAGGGACAGCCAGG - Intronic
1136000847 16:27291572-27291594 GCACCCCCCCAGCCACTGCCAGG + Intergenic
1141185560 16:81784567-81784589 TAACAACTCCAGGCACCTCCAGG + Intronic
1141743898 16:85913264-85913286 TAAACCCTTCAGGCCATGCCTGG - Intronic
1142934149 17:3313183-3313205 TAAATCCTTCAGGCACTTCCTGG + Intergenic
1145059587 17:19724363-19724385 TTACCCTTCCAGGCACTGGCAGG + Intergenic
1148844894 17:50523843-50523865 TGATCCCTTCAGTCACTGCCAGG - Intronic
1152783874 17:82238142-82238164 CAGCTCCTCCAGGCTCTGCCTGG + Intronic
1156373386 18:36491009-36491031 TACCCCAGCCAGACACTGCCAGG + Intronic
1159120035 18:64158281-64158303 TACCCCCCACAGGCACTGCGTGG + Intergenic
1159949540 18:74472624-74472646 AAACCTCTCCAGTGACTGCCAGG + Intergenic
1160691796 19:463768-463790 TAGCCCCTCCAGCCAAAGCCAGG + Exonic
1161146458 19:2681668-2681690 TAACCACTTCAGGAACTGCCAGG + Intronic
1161167648 19:2796857-2796879 GAGCCCCTCCACCCACTGCCCGG + Intronic
1161320430 19:3638363-3638385 GAAGCCCTCCTGCCACTGCCCGG + Intronic
1162966151 19:14157068-14157090 CACGCCCTCCAGGCACAGCCAGG + Exonic
1163033829 19:14560658-14560680 TGTCAACTCCAGGCACTGCCTGG - Intronic
1163053468 19:14702020-14702042 TAGCCCTTCCAGGCCATGCCAGG + Intronic
1164687689 19:30179017-30179039 AAACCCCACCAGGCACTCACAGG + Intergenic
1166750559 19:45162316-45162338 TCACCCCGTCAGGCCCTGCCTGG - Intronic
1167470227 19:49671711-49671733 TAAGCCCTCTGTGCACTGCCTGG + Intronic
1167858399 19:52262079-52262101 TAACCCCTCCCCGCACTCCCTGG + Intergenic
1168152355 19:54455916-54455938 CAACCCCGCCAGACACTGGCAGG - Intronic
925395824 2:3533104-3533126 TCACCTCTCCTGGCACAGCCTGG + Intronic
926689401 2:15722795-15722817 TAACCTCACTAGGCACTGACAGG - Intronic
927100893 2:19787067-19787089 TTAACCATCCAGGCACTGCCCGG - Intergenic
929588785 2:43132237-43132259 TAACCCGTCCTGGTTCTGCCAGG + Intergenic
929661253 2:43786951-43786973 TAGCCCCTAAAGGCACTGCTGGG - Intronic
931904813 2:66831040-66831062 TCACCTCTTCAGGCACTTCCGGG + Intergenic
932117839 2:69069209-69069231 TTCCCCCTCCAAGCAATGCCAGG + Intronic
932412359 2:71554903-71554925 AAACCCCTACAGCCACTGCCAGG - Intronic
932413294 2:71559699-71559721 TAACGCCTGCTGGCCCTGCCAGG + Intronic
934651170 2:96092124-96092146 TGTCCCCTCCAGGCCCTTCCAGG + Intergenic
935063819 2:99631098-99631120 TCACACGTCCAGGCACTCCCAGG - Intronic
937181936 2:120004342-120004364 TACCTCCTCCAGGGGCTGCCAGG + Intergenic
940461500 2:153968429-153968451 TAACCCCAAGAGGCACAGCCTGG - Intronic
941414385 2:165201224-165201246 TAAACTCTCCAGGAATTGCCTGG + Intronic
946406585 2:219495292-219495314 TAACCCCTCTGGGGATTGCCTGG - Intronic
948280146 2:236740743-236740765 TAACCTCTCCAGGCACTCAGAGG - Intergenic
1169057237 20:2633682-2633704 TACCTCCTCCAGTGACTGCCAGG + Intronic
1170962995 20:21041953-21041975 TCACCCTCCCAGGCACTTCCAGG + Intergenic
1173586613 20:44187371-44187393 TCATGCCTCCAGCCACTGCCCGG - Exonic
1173971420 20:47155457-47155479 CAAGCCCTTCAGTCACTGCCAGG - Intronic
1174097001 20:48097498-48097520 TAGCCTCTCCGGGCAATGCCAGG - Intergenic
1175399351 20:58692140-58692162 TTACAAATCCAGGCACTGCCTGG - Intronic
1176919567 21:14670759-14670781 TAGCCCTTCCAGGCTGTGCCTGG - Intergenic
1178137257 21:29641577-29641599 AAACCCATGCAGTCACTGCCAGG + Intronic
1181311905 22:21949476-21949498 CTGCCCCTCCAGGCACTCCCAGG - Intronic
1182557145 22:31135372-31135394 TACCTCCTCCTGGTACTGCCTGG + Exonic
1183590874 22:38778755-38778777 TGACCCCTCGAGAAACTGCCAGG + Exonic
1185158778 22:49210047-49210069 CCACCCCTCCAGGGGCTGCCCGG - Intergenic
1185387810 22:50544355-50544377 TCAACCCTCCAGGCGCGGCCCGG + Intergenic
1185393104 22:50573209-50573231 CAACACCTCCAGGCCCAGCCTGG - Intronic
952329102 3:32347485-32347507 TGCCCCCTCCAAGCCCTGCCCGG - Intronic
954195920 3:48997191-48997213 TAACCCCGCCAGGGAGAGCCTGG - Intronic
956780854 3:72601942-72601964 AAAGCCCTTCAGGCACTGACGGG + Intergenic
959902316 3:111674654-111674676 CAGCCCCTCCCCGCACTGCCGGG - Intronic
960814473 3:121658675-121658697 AACCACCTCCAGCCACTGCCTGG - Intronic
961536124 3:127572137-127572159 TCAACCCTCCAGGCCCTCCCAGG + Intergenic
961543996 3:127619287-127619309 TAGCACCTCCCGGCTCTGCCTGG - Intronic
965743540 3:171901537-171901559 TCAACCCTCCTGCCACTGCCTGG - Intronic
967201589 3:187076864-187076886 TGATTCCTCCAGGCTCTGCCTGG + Exonic
968457666 4:707206-707228 TAGCCCCCCCGGGCCCTGCCAGG - Intronic
973886246 4:55325039-55325061 TAACCCCTTCAAGCATTGCCTGG - Intergenic
975545226 4:75553964-75553986 TAATCACTTCAGCCACTGCCTGG - Intergenic
976565390 4:86546713-86546735 TTTCCCCTCCAAGCACTGCATGG - Intronic
981094220 4:140761633-140761655 TGACCACTCCTGGGACTGCCGGG - Intergenic
985151524 4:186952090-186952112 GAACCTCTCCAGGTAGTGCCAGG - Intergenic
990484823 5:56247839-56247861 TAAACCCTCCAGAGTCTGCCAGG - Intergenic
990848723 5:60176071-60176093 AAACCCCACCAGGCACTCACAGG - Intronic
998147403 5:139738092-139738114 AAACCTCCCCAGTCACTGCCAGG - Intergenic
1000037806 5:157461992-157462014 GGGCCCTTCCAGGCACTGCCTGG + Intronic
1001487393 5:172129259-172129281 CAACCATTCCAGGCCCTGCCAGG + Intronic
1004168879 6:13280317-13280339 TAACCCCCCCAGCCAGTCCCAGG - Intronic
1005649458 6:27873378-27873400 TAACGCCTCCACGCCGTGCCAGG + Exonic
1007752077 6:44076790-44076812 TAAAACCTGCAGGCGCTGCCCGG + Intergenic
1007959695 6:45947474-45947496 TCACCCCTCCATCCACTGCCTGG + Intronic
1007994463 6:46291499-46291521 TTCCCCCTCCAGGCACTGCAGGG + Intronic
1010294808 6:74183219-74183241 CAGCCACTCCAGGCACTGGCAGG - Intergenic
1010799062 6:80152978-80153000 AAAGCCCTCCAAGCACTGCTTGG - Intronic
1012227654 6:96723409-96723431 TCAGCCTTCCAGGCACTGACTGG - Intergenic
1013418980 6:109949207-109949229 CAATCCCTCCAGGAACTGCAAGG + Intergenic
1016013649 6:139163166-139163188 CAATGTCTCCAGGCACTGCCAGG - Intronic
1018224875 6:161619056-161619078 GAACCACTTCAGGCTCTGCCAGG - Intronic
1018716537 6:166537095-166537117 AAAGCCCTCCAGACACTTCCTGG + Intronic
1018730610 6:166647036-166647058 GATGTCCTCCAGGCACTGCCAGG + Intronic
1018964397 6:168473308-168473330 CAAGCCCTCCAGGCACAGCAGGG + Intronic
1024261823 7:47579243-47579265 TAACCCCTGCAAGCTGTGCCTGG - Intronic
1026679413 7:72454239-72454261 CAGCTTCTCCAGGCACTGCCTGG - Intergenic
1028984827 7:97001667-97001689 AAACCCATCCAGGTCCTGCCTGG + Intergenic
1029698257 7:102228867-102228889 TAAGCCATCCTGGCACTGCCGGG - Intronic
1033818390 7:145103154-145103176 GGACCCCACCAGGCTCTGCCTGG - Intergenic
1037784487 8:21894540-21894562 TAACGCCTCCATGAAATGCCAGG - Intergenic
1037784554 8:21894913-21894935 TAACGCCTCCATGAAATGCCAGG + Intergenic
1040585747 8:48739433-48739455 AGACCCCACCAGGCAATGCCTGG + Intergenic
1041139543 8:54801644-54801666 GAACCCCACCAGGCACTTGCAGG - Intergenic
1045583063 8:103500224-103500246 GAACTCCTCCAGGCACACCCGGG - Intergenic
1048431397 8:134374858-134374880 TAAACCAGCCTGGCACTGCCTGG - Intergenic
1048506447 8:135026486-135026508 CACCCCCACCAGGAACTGCCAGG - Intergenic
1048865374 8:138757111-138757133 TAGCCCCTGCAGGCACTTCCAGG + Intronic
1051416365 9:16845115-16845137 CAACCTTCCCAGGCACTGCCAGG + Intronic
1051907483 9:22113114-22113136 TCAGACCTCCAGGCACTGCGTGG + Intergenic
1056490056 9:87097332-87097354 TAATCCCTCCCTGCAGTGCCTGG + Intergenic
1057606587 9:96502192-96502214 TTTCCCCGCCAGGCACTGTCGGG - Exonic
1059410756 9:114130845-114130867 TTTCCCCTCCAGTCTCTGCCAGG + Intergenic
1059665858 9:116446036-116446058 TAACCCCTCCAGGCACTGCCTGG - Intronic
1062002306 9:134222474-134222496 TTAACCCTCCAGGCTGTGCCAGG - Intergenic
1062024315 9:134333280-134333302 TCACCCCAGCAGGCAGTGCCTGG - Intronic
1062574349 9:137199583-137199605 CATCCCCTCCAGGCACCGGCTGG + Exonic
1188336840 X:28946511-28946533 AAACCACTCCAGAGACTGCCTGG + Intronic
1192848018 X:74925570-74925592 GAGCCTCTGCAGGCACTGCCTGG + Intergenic