ID: 1059670613

View in Genome Browser
Species Human (GRCh38)
Location 9:116488078-116488100
Sequence CATCATGTACATCCTGTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059670613_1059670618 14 Left 1059670613 9:116488078-116488100 CCATGTACAGGATGTACATGATG 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1059670618 9:116488115-116488137 CCATGTACAGGATGGAACAATGG No data
1059670613_1059670615 2 Left 1059670613 9:116488078-116488100 CCATGTACAGGATGTACATGATG 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1059670615 9:116488103-116488125 ATGGAACGTTCACCATGTACAGG No data
1059670613_1059670619 15 Left 1059670613 9:116488078-116488100 CCATGTACAGGATGTACATGATG 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1059670619 9:116488116-116488138 CATGTACAGGATGGAACAATGGG No data
1059670613_1059670616 6 Left 1059670613 9:116488078-116488100 CCATGTACAGGATGTACATGATG 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1059670616 9:116488107-116488129 AACGTTCACCATGTACAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059670613 Original CRISPR CATCATGTACATCCTGTACA TGG (reversed) Intronic
901848818 1:12002065-12002087 CATCATGGACTCCCTGCACATGG + Exonic
902104266 1:14020458-14020480 CTTTTTGTTCATCCTGTACAAGG - Intergenic
902513531 1:16978544-16978566 CATCAAGTACACCCACTACACGG - Intronic
903155703 1:21440822-21440844 CCTCATGTGCATCCTGGACCTGG - Intronic
904296990 1:29526223-29526245 CCTCCTGTACATTCTGTCCAGGG - Intergenic
907855369 1:58298512-58298534 CAACATGTACAGCCTGCAGAAGG + Intronic
913077209 1:115350951-115350973 CCTCATGTCCAGCCTGGACAGGG - Intergenic
914086700 1:144460914-144460936 CCTCATGTGCATCCTGGACTTGG + Intronic
914590507 1:149102800-149102822 CCTCATGTGCATCCTGGACTTGG + Intronic
917361517 1:174181623-174181645 CACCATGCCCAGCCTGTACAAGG + Intronic
918619682 1:186588726-186588748 GATCAAGTTCATCCTGTAAATGG + Intergenic
919616016 1:199810055-199810077 CTTTCTGTAGATCCTGTACATGG - Intergenic
922977149 1:229794575-229794597 CATCTTGTTCATCCTTAACATGG - Intergenic
923921994 1:238577125-238577147 CAGCATATAGATCCTGTACATGG - Intergenic
924805078 1:247355460-247355482 TATCATGAATATCCTGTTCACGG + Intergenic
924838096 1:247675676-247675698 AATGATGGACATCCTGAACAAGG - Intergenic
1067317565 10:45182382-45182404 GAACCTGCACATCCTGTACATGG + Intergenic
1070620050 10:78002475-78002497 GAACATGTACATCTTCTACAAGG + Intronic
1070790400 10:79185880-79185902 CATCATCTGCTCCCTGTACAGGG + Intronic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1078259229 11:9689119-9689141 CATTACGCACATCCTGTAAAGGG + Intronic
1078428065 11:11267394-11267416 CCCCAGGTACATCCTGTGCATGG + Intergenic
1080539144 11:33249991-33250013 CACCATGTCCAGCCTGGACAAGG + Intergenic
1080636177 11:34125637-34125659 CAGAATGTACATCCTCAACAGGG - Intronic
1082837401 11:57661403-57661425 CATCATGGATATCCGGTTCATGG + Exonic
1090745909 11:129704664-129704686 CTTCATGTAGATCCTGTAAGTGG - Intergenic
1092615597 12:10213126-10213148 CATCATGAAGTTCCAGTACAAGG + Exonic
1096844339 12:54397364-54397386 ACTCATCTACATCCTCTACAAGG - Exonic
1098530840 12:71539876-71539898 CCAAATGTACATACTGTACAGGG - Intronic
1103320469 12:120089977-120089999 CATCATATCCATCCTGCACTTGG - Exonic
1104158153 12:126153159-126153181 CATCACCCCCATCCTGTACATGG + Intergenic
1104738978 12:131158774-131158796 CATCAAGTATATCCCCTACAGGG - Intergenic
1106086537 13:26547429-26547451 CATCATATACATCCTTTTCCTGG + Intergenic
1107670352 13:42739907-42739929 CATCCTGTTCATCCTCTACAGGG + Intergenic
1111334988 13:86808980-86809002 CACCATGAACATCCTGCATATGG + Intergenic
1111841060 13:93451562-93451584 GTTCATGTACATGTTGTACATGG + Intronic
1114531432 14:23399007-23399029 CATCATGTCCATCCTGGAGGAGG - Exonic
1114536766 14:23427864-23427886 CATCATGTCCATCCTGGAAGAGG - Exonic
1114731184 14:24994253-24994275 CATCTAATACATTCTGTACATGG + Intronic
1117980485 14:61338012-61338034 TGTCATGCACATCCTGTACCTGG + Intronic
1120305346 14:82762841-82762863 CATCATGTACAATGTTTACAAGG + Intergenic
1123478569 15:20610820-20610842 AATCATCTATATCCTGAACATGG - Intergenic
1128429623 15:67578427-67578449 CATCAAGGACATGCTGTAAAGGG - Intronic
1135506180 16:23038415-23038437 GATCCTGTAGATCCAGTACAAGG - Intergenic
1137343866 16:47636772-47636794 CATCATCAACATGCTGTCCATGG - Intronic
1138303763 16:55955952-55955974 CCTCTTGCACATCATGTACATGG + Exonic
1140451378 16:75073711-75073733 CATCATGTACATGCTCTGCGGGG + Intronic
1141123461 16:81381935-81381957 CATCATGTACATCAGGCACTTGG - Exonic
1141295228 16:82761560-82761582 CATCATGAATATGCTGAACAAGG + Intronic
1144811475 17:18002674-18002696 CACCAGGTGCTTCCTGTACACGG + Intronic
1145932903 17:28698715-28698737 CATCAGGTAAAGCCAGTACAGGG - Intronic
1148777794 17:50105392-50105414 CATCATGGAGTTCCTGGACAAGG + Exonic
1152311333 17:79551849-79551871 CTTCATGTACAGCCTGCTCATGG + Intergenic
1154013637 18:10596903-10596925 CAGCATGTACATCCTATGCAGGG + Intergenic
1155382526 18:25239828-25239850 CTTCATTTACATCCTGTTTAAGG + Intronic
1155927880 18:31677414-31677436 CAGCATTTACATCCTGTATTAGG - Intronic
1157483343 18:48069939-48069961 CTTTATGTACATGCTGTCCATGG + Intronic
1160783739 19:890212-890234 CATGATCCACATCCTGGACACGG - Exonic
1162541633 19:11300087-11300109 AATCCTGTACATCAGGTACAGGG + Intronic
1163329949 19:16629622-16629644 CATTGTGTACATGGTGTACATGG + Intronic
1164422005 19:28102289-28102311 GATCATGTAAGTCCTCTACAAGG - Intergenic
1166860203 19:45805788-45805810 CATCAGGGACATCCTGTCCAAGG - Intronic
1168133830 19:54337580-54337602 CATCAGATACACTCTGTACAAGG - Exonic
929337038 2:40761481-40761503 AATCTTGTGCTTCCTGTACATGG + Intergenic
930276589 2:49318290-49318312 CATCATATACATCAAGTAAATGG + Intergenic
931052122 2:58427436-58427458 CATCATTTAAATCCTGTTCTAGG - Intergenic
933272572 2:80248954-80248976 TATCATTTACATGCTGAACATGG + Intronic
933468963 2:82695527-82695549 CATCTTTTTCTTCCTGTACAAGG + Intergenic
933796560 2:85924614-85924636 CATCAAGAACATCCTGTTCCAGG - Intergenic
937058610 2:118963541-118963563 CAGAATGTACATCCTTTTCAAGG - Intronic
939864086 2:147453239-147453261 CTTCCTTTACATCCTCTACATGG + Intergenic
944500347 2:200352987-200353009 CAGCATCTACATGTTGTACATGG + Intronic
946577884 2:221096015-221096037 CCTCATGTAATTCCTATACAAGG + Intergenic
1175282925 20:57816518-57816540 CATCATTTGCATCCTTTAAAAGG - Intergenic
1175967957 20:62669057-62669079 CATCATGGGGCTCCTGTACAAGG + Exonic
1177497245 21:21905521-21905543 CAACATGTATTTTCTGTACAAGG + Intergenic
1185104554 22:48859963-48859985 AAGCCTGTACATCCTGTGCAAGG + Intergenic
1185327436 22:50233924-50233946 CAGCATCTACACCCTGTCCATGG + Intronic
1185383431 22:50520972-50520994 CAGCATGTACCTCCTGGGCAGGG - Exonic
949095632 3:82041-82063 CATCTGGTACAACCTGTGCATGG - Intergenic
949837743 3:8287423-8287445 CTTCATTTACATACTGTCCATGG - Intergenic
951640879 3:24833739-24833761 CATCATGTACATTGTGTCCAAGG + Intergenic
953537080 3:43784565-43784587 CATCATCTTCACCCTGGACAGGG - Intergenic
953721977 3:45364029-45364051 CATCATCTACATTCTCTACCAGG - Intergenic
954325438 3:49860935-49860957 CATCATGTACATCCTGTGAGTGG - Exonic
954637491 3:52079137-52079159 GATCATATACATTCTGAACAAGG - Intronic
955033135 3:55240333-55240355 AAACCTGAACATCCTGTACATGG + Intergenic
955338505 3:58106810-58106832 CATCAAGGACAGCCCGTACATGG + Exonic
956087882 3:65632709-65632731 CTTCATGTACATCTTGTCAATGG - Intronic
960317993 3:116201457-116201479 CATCAGGAACCTCCTGTGCATGG + Intronic
963966134 3:151372934-151372956 ACTCATGTCCATCCTTTACACGG + Intronic
968905177 4:3447582-3447604 CATCCCGTACACCCTGTACTCGG + Exonic
969385958 4:6848249-6848271 CATTATTTATATGCTGTACAGGG + Intronic
970836072 4:20409098-20409120 CAACCTGCACATCCTGCACATGG - Intronic
971308759 4:25506142-25506164 CATCAAGTACATGCCGTACGCGG + Intergenic
972172640 4:36365491-36365513 CATCAAGTAGATCATGTACATGG + Intergenic
973828404 4:54733274-54733296 CATAATGTAAATCCTGTCTAGGG + Intronic
980646496 4:135649779-135649801 TATCATGTACAAACTGTAAAAGG - Intergenic
980651889 4:135727327-135727349 CATCATGCACATTATGTGCAAGG - Intergenic
981593999 4:146398703-146398725 CAACAAGTACATCCTGAAAAAGG + Intronic
986667182 5:10114135-10114157 CAGCACCCACATCCTGTACATGG + Intergenic
990764916 5:59171318-59171340 CATTATCTTGATCCTGTACAAGG + Intronic
993661631 5:90644783-90644805 CAAGATGTATTTCCTGTACAAGG + Exonic
995746025 5:115404730-115404752 TATCATGTACATCCTAAAAATGG + Intergenic
995898593 5:117043682-117043704 CAACATGTAAATGCTGTGCATGG + Intergenic
996327493 5:122291927-122291949 CCTTCTGTACATGCTGTACAAGG - Intergenic
1005203158 6:23370021-23370043 GATCATGTGTTTCCTGTACATGG - Intergenic
1006613458 6:35309789-35309811 CAACAAGTACATCCTGGACAAGG + Exonic
1007734607 6:43972749-43972771 ACTCATATACATCCTGTGCAGGG + Intergenic
1008685519 6:53921975-53921997 CAGCATGTACATCTTTTAAATGG - Intronic
1009649681 6:66458892-66458914 CATTTTTTACATCCTTTACATGG + Intergenic
1010915955 6:81619109-81619131 CATCTTTTACATCCTGTCAAGGG - Intronic
1011984337 6:93423819-93423841 AATCAAGTCCACCCTGTACAAGG + Intergenic
1015927745 6:138327224-138327246 AAACCTGTACATCCTGCACATGG + Intronic
1018320597 6:162604156-162604178 CTTCATGTACTCCTTGTACATGG + Intronic
1019751274 7:2731573-2731595 GATCACGTCCATCCTGTTCATGG - Exonic
1022432191 7:30335862-30335884 CATCACCTACACCCTGAACATGG - Intronic
1024489042 7:49956583-49956605 CATCATATAGATCTTATACATGG - Intronic
1026747148 7:73022454-73022476 CATCTTCTACTTCCTGTACGAGG - Intergenic
1026750798 7:73050597-73050619 CATCTTCTACTTCCTGTACGAGG - Intergenic
1026754447 7:73078707-73078729 CATCTTCTACTTCCTGTACGAGG - Intergenic
1026758099 7:73106740-73106762 CATCTTCTACTTCCTGTACGAGG - Intergenic
1027033252 7:74907025-74907047 CATCTTCTACTTCCTGTACGAGG - Intergenic
1027089306 7:75286744-75286766 CATCTTCTACTTCCTGTACGAGG + Intergenic
1027092949 7:75314672-75314694 CATCTTCTACTTCCTGTACGAGG + Intergenic
1027096592 7:75342639-75342661 CATCTTCTACTTCCTGTACGAGG + Intergenic
1027322755 7:77025041-77025063 CATCTTCTACTTCCTGTACGAGG - Intergenic
1032897920 7:136272640-136272662 CATCATTTTCACCCTGTAAATGG - Intergenic
1033656002 7:143374883-143374905 CATCCGGTAGAGCCTGTACATGG - Intergenic
1040548402 8:48419900-48419922 CTTCATGTTCATCCTCCACAAGG - Intergenic
1045029353 8:98120450-98120472 AAACATATACATACTGTACATGG - Intronic
1046190898 8:110792583-110792605 CATTATTTACATCCTCTACTGGG - Intergenic
1048794323 8:138135094-138135116 CATCATTTACATATTGTATATGG - Intronic
1049942018 9:555333-555355 CATCATGTACATGGTGTGGAAGG - Intronic
1059670613 9:116488078-116488100 CATCATGTACATCCTGTACATGG - Intronic
1060587376 9:124795055-124795077 CATCAAGTCCATGCTGTACAGGG - Exonic
1189717027 X:43877513-43877535 CGTTATCTACATGCTGTACAAGG - Intronic
1190336890 X:49268126-49268148 ACTCATGGACATCCTGAACATGG + Intergenic
1192068437 X:67911439-67911461 CATCAATTCCATCCTGTCCAGGG + Intergenic
1192718209 X:73665357-73665379 CTTCAAGAACATCATGTACAAGG - Intronic
1192765047 X:74131548-74131570 CATCCTGTACAGCCAATACAAGG - Intergenic
1194214247 X:91109065-91109087 CATCATGTACATGCCTGACATGG + Intergenic
1200019374 X:153188998-153189020 CCTCATCTACATACTGCACATGG - Intergenic