ID: 1059671178

View in Genome Browser
Species Human (GRCh38)
Location 9:116493784-116493806
Sequence CAGTGGGAGTGGGGGGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059671171_1059671178 -8 Left 1059671171 9:116493769-116493791 CCAGAATGGAAGGAGCAGTGGGA 0: 1
1: 0
2: 2
3: 32
4: 303
Right 1059671178 9:116493784-116493806 CAGTGGGAGTGGGGGGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059671178 Original CRISPR CAGTGGGAGTGGGGGGATGT GGG Intronic
No off target data available for this crispr