ID: 1059671360

View in Genome Browser
Species Human (GRCh38)
Location 9:116495496-116495518
Sequence CTCAGACACAACTGGGTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059671360_1059671366 -4 Left 1059671360 9:116495496-116495518 CCCTGGACCCAGTTGTGTCTGAG 0: 1
1: 0
2: 0
3: 12
4: 209
Right 1059671366 9:116495515-116495537 TGAGGCCTAGATCTACCCTTGGG No data
1059671360_1059671365 -5 Left 1059671360 9:116495496-116495518 CCCTGGACCCAGTTGTGTCTGAG 0: 1
1: 0
2: 0
3: 12
4: 209
Right 1059671365 9:116495514-116495536 CTGAGGCCTAGATCTACCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059671360 Original CRISPR CTCAGACACAACTGGGTCCA GGG (reversed) Intronic
901678582 1:10900661-10900683 CTCAGGCTCCACTGGGTGCAGGG - Intergenic
901783848 1:11611758-11611780 TTCAGACACAGCTGAATCCAGGG + Intergenic
902200518 1:14830124-14830146 TTCAGGCACAGCTGGATCCAGGG + Intronic
902714796 1:18265344-18265366 CTGGGACACATCTGGCTCCAAGG + Intronic
903523188 1:23970693-23970715 CTCAGACACATTTAGGTTCAGGG - Exonic
904620840 1:31774200-31774222 TTCAGAAACAACTGGGGCAATGG + Intergenic
905276426 1:36821571-36821593 CCCAGACACCACCGGGTCCCAGG + Intronic
905455331 1:38084374-38084396 CCCAGAAACAACTGTGCCCAGGG + Intergenic
906166998 1:43693950-43693972 CTCAGTCACCTCTGGGCCCAAGG - Intronic
907596293 1:55723109-55723131 GTCAGACAGATCTGGGTTCAGGG + Intergenic
910169773 1:84365845-84365867 CTCAGACACTTCTGAGGCCATGG - Intronic
911195164 1:94987187-94987209 TTCAGGCACAACTGGATTCATGG - Intronic
912974441 1:114315199-114315221 CACAGACACACCTGGCTGCAAGG - Intergenic
915504749 1:156346882-156346904 CTGTGACACAACTGGCTCCTGGG + Exonic
916870155 1:168904877-168904899 AGCATACACAACTGTGTCCATGG - Intergenic
917630091 1:176883185-176883207 TTCAGACACAACTAGGGCAAGGG + Intronic
919337451 1:196255498-196255520 CTCAAACACATCTAGCTCCAAGG - Intronic
920514152 1:206572082-206572104 CTCAGAAGTAAATGGGTCCATGG + Intronic
922696352 1:227732990-227733012 ATCAACCACAACTGGGTCAATGG - Exonic
1067346487 10:45442137-45442159 CTCAGCCAGAAATGGATCCAGGG + Intronic
1068023711 10:51616935-51616957 CTCTGACACCACTGGGACCCAGG + Intronic
1069201476 10:65622758-65622780 CTGAGTCACAAATGGCTCCAAGG + Intergenic
1069708678 10:70475386-70475408 CTCAGAGACCACTGGGCTCAGGG + Intergenic
1076059995 10:127406333-127406355 CTCACACACAGCAGGCTCCAGGG + Intronic
1076285995 10:129296943-129296965 CACAGACACACCTGGTTGCAAGG - Intergenic
1076419978 10:130324436-130324458 TTCAGGCACAGCTGGATCCAGGG - Intergenic
1077532967 11:3105914-3105936 CTCCATCACAGCTGGGTCCAGGG + Intronic
1078007510 11:7543503-7543525 CTCTGGCTCAACTGTGTCCAAGG + Intronic
1079048910 11:17135625-17135647 CTCAGACAAAATTAGGTCCATGG + Intronic
1079873621 11:25830565-25830587 CACACACACAAATGGGTACAAGG - Intergenic
1080224256 11:29942967-29942989 CTCAGATGCAACTGGTACCAAGG + Intergenic
1081785720 11:45745588-45745610 CTCTGACACCACTGGGCCCTGGG - Intergenic
1084409833 11:69000395-69000417 TTCAGACACAGCTGGATCCAGGG - Intergenic
1085382769 11:76135385-76135407 CTCAGAGAAAACTTGATCCAAGG + Intronic
1087835976 11:102875568-102875590 CTCAGTCCCAACTGGGTACCTGG + Intergenic
1093930412 12:24949927-24949949 CTCAAACAGAACTGGGCCCTTGG + Intergenic
1096950694 12:55466091-55466113 CAAAGACACAAGTGGGTTCAAGG - Intergenic
1100744832 12:97634305-97634327 ATCACAGACAATTGGGTCCAGGG - Intergenic
1101738498 12:107481715-107481737 CTTTGACACAGCTGGATCCAGGG + Intronic
1102786998 12:115613155-115613177 CTCAGAAACGACTAGTTCCATGG + Intergenic
1102894992 12:116591825-116591847 TTCAGGCACAACTGGATCAAGGG - Intergenic
1103144187 12:118580073-118580095 TTCAGGCTCAACTGGATCCAGGG + Intergenic
1103982287 12:124744427-124744449 TTCAGGCACAGCTGGATCCAGGG + Intergenic
1104377416 12:128277260-128277282 TTCAGGCACAGCTGGATCCAGGG + Intronic
1104517977 12:129445612-129445634 TTCAGGCACAGCTGGATCCAGGG - Intronic
1109983955 13:69950766-69950788 ATCAAACTCAACTGGGTTCAAGG - Intronic
1113812969 13:113153491-113153513 AGCAGGCACAGCTGGGTCCAGGG + Intergenic
1117625324 14:57631111-57631133 CTCAGACACATTTAGGTTCAGGG + Intronic
1117753140 14:58944569-58944591 CTGCCACACAGCTGGGTCCAAGG - Intergenic
1119140449 14:72262818-72262840 GTCAGCCACAGCTGGATCCAGGG + Intronic
1120680468 14:87475001-87475023 CTGAAACACAACTGCCTCCAAGG - Intergenic
1121421500 14:93818863-93818885 CACAGACACAATTAGATCCAGGG - Intergenic
1122294472 14:100697655-100697677 CCCAGACACACCTGGGCTCAGGG + Intergenic
1123627392 15:22237229-22237251 TTCAGGCACAACTGGATCCAGGG - Intergenic
1125343692 15:38698288-38698310 TTCAGACAATGCTGGGTCCAAGG + Exonic
1127851160 15:62913078-62913100 CTCACACATATCTGGGACCAGGG - Intergenic
1128591281 15:68899737-68899759 CTCACACACACCTGATTCCAAGG - Intronic
1129255415 15:74331401-74331423 CACAGACATAACTGAGTGCAGGG - Intronic
1130149454 15:81300067-81300089 CTCAGACACACCTGGGTCTCTGG - Exonic
1130153525 15:81330500-81330522 CTCAGGCCCAACTGGAGCCAGGG - Intergenic
1130302790 15:82692671-82692693 CTCAGACCAAACTGATTCCAGGG + Intronic
1134125526 16:11613438-11613460 TTCAGACACAGCTGGGTCTGAGG + Intronic
1134366253 16:13581960-13581982 CCCAGGCACAACTGGGTAGAAGG - Intergenic
1136040557 16:27575566-27575588 GTCAGGCTCAGCTGGGTCCAGGG + Intronic
1137562890 16:49514396-49514418 CTGAGACAGAACTGGGAACAAGG - Intronic
1138214492 16:55191312-55191334 TTCAGGCACAACTGGGCTCAGGG - Intergenic
1138447286 16:57072100-57072122 TTCAGGCACAGCTGGATCCAGGG + Intronic
1138519954 16:57565430-57565452 TTCAGACATAGCTGGATCCAGGG + Intronic
1139445443 16:66995470-66995492 CTCAGCCACAAATGGGACCCTGG - Intronic
1139445459 16:66995535-66995557 CTCAGCCACAAATGGGACCAAGG - Intronic
1141205808 16:81932469-81932491 CTTAGAAACAAATGGGTGCATGG - Intronic
1141976565 16:87520149-87520171 TTCAGGCGCAACTGGATCCAGGG + Intergenic
1142029778 16:87832756-87832778 CACAGGCACACCTGGGTCCCTGG + Exonic
1142353509 16:89590610-89590632 CTCAGGCACTGCTGGATCCAGGG + Intronic
1142879125 17:2870798-2870820 CTCAGAAACAGCTGGATCCAGGG + Intronic
1143100021 17:4499616-4499638 CTCATACACACCCGGGGCCAAGG + Intronic
1144356801 17:14454227-14454249 GTCAGAGAAAACTGGGCCCATGG + Intergenic
1146530733 17:33605795-33605817 CTCAGCCCAAACTGGGTCCCTGG + Intronic
1148291318 17:46452888-46452910 CACAGGAACAAATGGGTCCAGGG - Intergenic
1148313505 17:46670591-46670613 CACAGGAACAAATGGGTCCAGGG - Intronic
1148392086 17:47280004-47280026 CTCAGCCAGAGCTGGGTGCACGG + Intronic
1151006244 17:70439622-70439644 CTCAGACACAAGTGGGAGCTTGG + Intergenic
1151052763 17:70997044-70997066 CACAGACACAGCTGAGTCCCAGG + Intergenic
1151665926 17:75545125-75545147 CACAGACAGAACTTGGTGCAAGG - Intronic
1152026894 17:77815753-77815775 CTCAGAGATTACGGGGTCCAAGG + Intergenic
1153026593 18:678611-678633 CTAACACACAACTGTGTCCTCGG + Intronic
1154251881 18:12751595-12751617 TTCAGACACAACTGGATCGGGGG + Intergenic
1155148895 18:23106681-23106703 CTCTAACACAACTGGGTCCCTGG + Intergenic
1160226092 18:77012250-77012272 CTCACACACAACGGGGGTCATGG - Intronic
1160737578 19:671019-671041 TTCAGGCACAGCTGGATCCAGGG + Intergenic
1160795552 19:943828-943850 CTCAGACACATGTGTGCCCAGGG - Intronic
1160926990 19:1551260-1551282 TTCAGGCACAGCTGGATCCAGGG + Intergenic
1162928369 19:13942224-13942246 TTCAGGCACAGCTGGATCCAGGG + Intronic
1163249525 19:16118166-16118188 CTCAGACACAACTTGGGAAATGG + Intronic
1163450414 19:17373666-17373688 CTCAGACACAACTTCATCCAGGG - Intronic
1163668894 19:18616238-18616260 TTCAGGCACAGCTGGATCCAGGG + Intronic
1164123692 19:22290991-22291013 CTCAGAAACAGATGGGTCTATGG + Intronic
1167465248 19:49647206-49647228 CTCAGACACACCAGGGCTCAAGG - Intronic
1168431900 19:56288100-56288122 CACAGGCCCAAATGGGTCCATGG + Intronic
925072370 2:980243-980265 CTCAGTTACAACTCGGTCCTGGG + Intronic
925615594 2:5741782-5741804 CTCACACAAACCTGGCTCCATGG + Intergenic
926554604 2:14342142-14342164 CCCAGACACAATTAGGTACATGG - Intergenic
927513643 2:23659679-23659701 CTCATACCCAACTGTGCCCAGGG + Intronic
928256459 2:29727150-29727172 CTCAGCCACGACTGTTTCCATGG + Intronic
929698542 2:44141321-44141343 CTCAGGAATAACTGGCTCCAAGG + Intergenic
932277952 2:70465492-70465514 CTCTGACACATCTGGCTCCAGGG + Intronic
934103963 2:88679364-88679386 CGCAGACTCAACAAGGTCCATGG + Intergenic
934938739 2:98484151-98484173 CTCAGAGACCTCTGGGGCCAGGG - Intronic
937792297 2:125974902-125974924 CTCTGACAGCAATGGGTCCAAGG - Intergenic
939736721 2:145856003-145856025 CTCAGACCCACTTGGGACCAGGG + Intergenic
945507446 2:210658799-210658821 CTCAGACACAAACAGATCCAGGG - Intronic
945588078 2:211692274-211692296 TTCGGACACAATTGGATCCAGGG - Intronic
946227023 2:218269648-218269670 GTCAGACACACCGGGGTCCGCGG + Intronic
947907716 2:233777706-233777728 CTCAGAGACATCTAGGGCCAAGG - Intronic
1174104266 20:48151034-48151056 CTCAGATGCAGCTGGATCCAGGG - Intergenic
1176161147 20:63649467-63649489 CACAGACACAGCTGGTGCCAGGG + Intronic
1176409293 21:6439238-6439260 CCCAGATCAAACTGGGTCCAGGG + Intergenic
1176669874 21:9723194-9723216 CTCAGCCATTACTGGGTTCACGG - Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1180037140 21:45255842-45255864 CTCAGGCACGGCTGGATCCAGGG - Intergenic
1180968556 22:19803059-19803081 CTCAGACACCACAAGGACCAGGG + Intronic
1182234990 22:28868018-28868040 TTCAGACACTAATGGGACCAGGG - Intergenic
1182355745 22:29721537-29721559 CTCAGAGACCCCTGGATCCAAGG - Intronic
1183308266 22:37095682-37095704 CTCAGACAAGGCTGGCTCCAAGG - Intronic
1184318897 22:43723802-43723824 CTAAGCCACAGCTGGGACCAAGG + Intronic
1184688324 22:46106310-46106332 TGCAGACACACCTGCGTCCATGG - Intronic
1184868073 22:47214356-47214378 CTCAGGGACAAATGGGACCAGGG - Intergenic
949477492 3:4462439-4462461 CCCAGACACACCTGGATACAGGG - Intronic
949599189 3:5580041-5580063 TTCAGACACAGCTGGTTTCAGGG + Intergenic
950047813 3:9960878-9960900 TTCAGGCACAGCTGGGTCCAGGG - Intergenic
950132760 3:10558577-10558599 TTCAGGCACAGCTGGATCCAGGG - Intronic
953224002 3:40999711-40999733 CTCAGACATTACTTGATCCAGGG - Intergenic
954108622 3:48422253-48422275 CTCACCCACAAGTGGGTCCCTGG + Intronic
954305098 3:49721457-49721479 CTCAGGCACAATTAGGGCCATGG - Exonic
954678768 3:52330227-52330249 CTCAGTCACAGCTGTGTCCCTGG - Intronic
955463386 3:59210119-59210141 CTCAGAAACACCTGCATCCAAGG - Intergenic
956311330 3:67883957-67883979 CTTAGTAACAACTGGGGCCATGG + Intergenic
956982149 3:74651407-74651429 TTCTGACTCAGCTGGGTCCAGGG + Intergenic
961741286 3:129034581-129034603 TTCAGGCACAGCTGGGTCCAGGG + Intronic
961860453 3:129913046-129913068 CTCAGAGACAAGTGGGCCCTTGG + Intergenic
962313192 3:134340231-134340253 CTCAGAGACAGCTGGAACCAAGG + Intergenic
962326852 3:134441584-134441606 CTCTGGCAAAACTGGGACCAAGG - Intergenic
962469119 3:135689499-135689521 CTCAGACACACCCAGGCCCAGGG + Intergenic
963005404 3:140722429-140722451 CTCAGACTTCACTGGATCCAGGG - Intergenic
963651191 3:147982315-147982337 TTCAGACACACTTGGATCCAGGG + Intergenic
963651495 3:147986284-147986306 CTCAGGGATAACTGAGTCCAGGG - Intergenic
964127237 3:153247749-153247771 CTCAGACAGAACTGGTTAAAGGG - Intergenic
967217808 3:187225163-187225185 CCAAGTCAGAACTGGGTCCAAGG - Intronic
975971761 4:80047817-80047839 CTCAGGTACAGCTGGATCCAAGG - Intronic
976700609 4:87965905-87965927 CCAAGGCAGAACTGGGTCCAGGG + Intergenic
977530732 4:98197881-98197903 CTCAGACACAACTAAATCAAGGG + Intergenic
978108982 4:104938910-104938932 TTCAGACACAATTGAATCCAGGG - Intergenic
979176083 4:117665908-117665930 TTCAGACACATCTGGATTCAGGG - Intergenic
980201725 4:129664017-129664039 CTCAGACATAAATGGGTTAAGGG + Intergenic
985638884 5:1053972-1053994 TCCTGATACAACTGGGTCCAAGG + Intronic
992847895 5:80772503-80772525 CTAAGACAGAATTGGGTCCCAGG + Intronic
993103345 5:83568928-83568950 CTCAGATACAGCTGGGTGTATGG - Intronic
994027953 5:95106468-95106490 TTCAGACTCAACAGGATCCAAGG - Intronic
998810523 5:145961895-145961917 CTCAGACCCAGCAGGATCCATGG + Intronic
999254050 5:150199758-150199780 TTCAGGCACAGCTGGGTCTAGGG + Intronic
1000269135 5:159666598-159666620 TTCAGACACGGCTGGATCCAAGG - Intergenic
1001050662 5:168411525-168411547 TTCAGGCACAGCTGGATCCAGGG + Intronic
1001701122 5:173707084-173707106 CTCAGGGCCCACTGGGTCCAGGG - Intergenic
1005225685 6:23639320-23639342 ATCAGTAACAACAGGGTCCAGGG - Intergenic
1005909489 6:30295709-30295731 CTCAGGTACAACTGGAACCAGGG + Intergenic
1006435929 6:34026310-34026332 CTCAGTGACAACAGGGGCCATGG - Intronic
1009878385 6:69534801-69534823 CTCAGATAAAACTGGGTTGATGG + Intergenic
1010083401 6:71888143-71888165 CTCAGACAAAACTGCTTACAAGG + Intronic
1010716196 6:79233426-79233448 CTCACACACAAATTAGTCCATGG + Intronic
1011503343 6:88014417-88014439 CTGAGATGCAACTGGGGCCAGGG - Intergenic
1011643336 6:89434394-89434416 GACAAACACACCTGGGTCCAAGG + Intronic
1014103322 6:117535904-117535926 CTCAGACCCACTTGGGTCCTGGG - Intronic
1016394316 6:143606022-143606044 CTGAAACACAACTGACTCCAAGG - Intronic
1017216132 6:151909655-151909677 CTCAGCCACCACTGGGTTCAGGG + Intronic
1017228860 6:152050807-152050829 GTCAGAAACAAATGGGTCCTGGG + Intronic
1017778047 6:157695012-157695034 ATCAGACCCAGCTTGGTCCAGGG + Intergenic
1019414491 7:921014-921036 CACACACACACCTGGGGCCAGGG - Intronic
1022161076 7:27711863-27711885 GTCAGACACATCTGTGTCCCTGG - Intergenic
1022599363 7:31742483-31742505 CTCGAACACACCTGGGTTCAAGG - Intergenic
1023039644 7:36160985-36161007 CTCAGCCACAGCTGTGTCCTGGG + Intronic
1023088745 7:36598258-36598280 CTGAATCACAACTGGGGCCAGGG + Intronic
1023154623 7:37236205-37236227 CTCAGACAGAACAGGCTGCAAGG + Intronic
1029117491 7:98244790-98244812 CTCAGGCACCACAGGGTGCAGGG + Intronic
1030979699 7:116171823-116171845 CTCAGACTCAGGTGGATCCAAGG + Intergenic
1031861968 7:126990256-126990278 ATCAGCCAGAACTGTGTCCAGGG - Intronic
1032000410 7:128261546-128261568 CACACACAGAACTGGCTCCAGGG + Intergenic
1032746986 7:134795913-134795935 CTCAGACACAGGTGGGTCAGTGG - Intronic
1033981179 7:147167491-147167513 CTCTGTCAAAGCTGGGTCCATGG - Intronic
1035901884 8:3465549-3465571 CTCAGAGACAACAGTGCCCAAGG + Intronic
1037037997 8:14191600-14191622 CTCAAACACACCTGGCTGCAAGG + Intronic
1038687892 8:29735204-29735226 ATCAGACACACCTGGGTTCCTGG - Intergenic
1040828951 8:51655900-51655922 CTCAGGCAATCCTGGGTCCAGGG - Intronic
1040889786 8:52305332-52305354 CACAGACACAAGTGAGACCAAGG - Intronic
1042781280 8:72493860-72493882 CTCAGAGAGAACAGGGTCCGTGG - Intergenic
1044806003 8:96009033-96009055 CTTAGACACAGCTGTGCCCATGG - Intergenic
1045707738 8:104945971-104945993 CTCAGACTCAACCTGGTACACGG + Intronic
1047233218 8:123015469-123015491 GGGAGACACAACTGGGGCCAGGG - Exonic
1047325926 8:123835810-123835832 CTCAGAGACAACTAGGATCAGGG + Intergenic
1048030028 8:130622145-130622167 CACAGACACTACTGGGTCATTGG + Intergenic
1048066847 8:130978966-130978988 TTCAGGCACAGCTTGGTCCAGGG - Intronic
1048688517 8:136931841-136931863 TTCAGAGAAAACTGGATCCAGGG - Intergenic
1049369850 8:142259077-142259099 GTCAGACAGACCTGGGTTCAAGG - Intronic
1050182059 9:2933351-2933373 CCAAGACAGAACTGGGCCCAGGG + Intergenic
1051344616 9:16140862-16140884 CTCAGGCTCCACTGGGTCCTTGG + Intergenic
1052081397 9:24210255-24210277 TTCAGACACAACTAGATACAGGG - Intergenic
1052273959 9:26657354-26657376 TTCAGGCACCACTGGATCCAGGG + Intergenic
1053524973 9:38819284-38819306 CACAGACACAAATGTGTACATGG - Intergenic
1054197204 9:62043699-62043721 CACAGACACAAATGTGTACATGG - Intergenic
1054641204 9:67544995-67545017 CACAGACACAAATGTGTACATGG + Intergenic
1057282764 9:93724839-93724861 CTCAGACTCCACTGCGTGCAAGG - Intergenic
1057952211 9:99378103-99378125 CTCAGACAGACCTGAGTTCAGGG + Intergenic
1058116035 9:101085220-101085242 CTTGGAGACAACTGGGGCCAGGG - Intronic
1059671360 9:116495496-116495518 CTCAGACACAACTGGGTCCAGGG - Intronic
1060017548 9:120099645-120099667 CAGAGACACCACTGGGACCAAGG + Intergenic
1060553645 9:124497503-124497525 ATCGGACACAACTGGGCCCCTGG + Intronic
1186004027 X:5047856-5047878 GTCAGACACAGCTAGGTCTAAGG - Intergenic
1186641680 X:11462280-11462302 CTGAGTCACAGCTGGGTCGAAGG + Intronic
1187717750 X:22120021-22120043 CACAGTCACAACTAGGCCCATGG - Intronic
1189114443 X:38328266-38328288 ATCAGACACAATTGGATTCAGGG + Intronic
1198866623 X:141129998-141130020 CTCAGGCACAACTACATCCAGGG + Intergenic
1199546045 X:149008162-149008184 CTCTGACACCACTGGCTACATGG - Intergenic
1199753838 X:150846273-150846295 CACACACACAATTGGGGCCAAGG + Intronic