ID: 1059681244

View in Genome Browser
Species Human (GRCh38)
Location 9:116588488-116588510
Sequence CCTGAAGTCTTAATGGGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059681240_1059681244 8 Left 1059681240 9:116588457-116588479 CCAGGGCTTCTGAAGCAAAGATA 0: 1
1: 0
2: 1
3: 21
4: 193
Right 1059681244 9:116588488-116588510 CCTGAAGTCTTAATGGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059681244 Original CRISPR CCTGAAGTCTTAATGGGTCC TGG Intronic
No off target data available for this crispr