ID: 1059691436

View in Genome Browser
Species Human (GRCh38)
Location 9:116688709-116688731
Sequence GCTTGGGGGTACAGGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 297}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059691436_1059691443 9 Left 1059691436 9:116688709-116688731 CCTTTTTCCCTGTACCCCCAAGC 0: 1
1: 0
2: 3
3: 26
4: 297
Right 1059691443 9:116688741-116688763 AGATAGAAAGTGAGACCTCCAGG No data
1059691436_1059691445 11 Left 1059691436 9:116688709-116688731 CCTTTTTCCCTGTACCCCCAAGC 0: 1
1: 0
2: 3
3: 26
4: 297
Right 1059691445 9:116688743-116688765 ATAGAAAGTGAGACCTCCAGGGG No data
1059691436_1059691444 10 Left 1059691436 9:116688709-116688731 CCTTTTTCCCTGTACCCCCAAGC 0: 1
1: 0
2: 3
3: 26
4: 297
Right 1059691444 9:116688742-116688764 GATAGAAAGTGAGACCTCCAGGG No data
1059691436_1059691446 20 Left 1059691436 9:116688709-116688731 CCTTTTTCCCTGTACCCCCAAGC 0: 1
1: 0
2: 3
3: 26
4: 297
Right 1059691446 9:116688752-116688774 GAGACCTCCAGGGGAATGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059691436 Original CRISPR GCTTGGGGGTACAGGGAAAA AGG (reversed) Intronic
901065629 1:6492911-6492933 GCCAGGGGGCACAGGGAGAAGGG - Intronic
902797749 1:18810359-18810381 GATTGGGGGTACTGAGAAGAGGG - Intergenic
903953537 1:27010321-27010343 GCAGGGGGGTAGAGGGAGAAAGG + Intronic
905176596 1:36139884-36139906 TGTTGGTGGTAAAGGGAAAATGG + Intronic
905398424 1:37683616-37683638 GCTTTGTGCTACAGGGAAAGAGG + Intronic
907999371 1:59665603-59665625 GGTTGGGGGTAGAGGGCAAATGG - Intronic
908204549 1:61832170-61832192 ACTTGGGGGTAGAGGGTAGAAGG + Intronic
911995281 1:104758213-104758235 GCGTGGGGGTATGGGGAAGAGGG + Intergenic
912926159 1:113915109-113915131 GCTTGAAGGTGCTGGGAAAAAGG + Intergenic
914691116 1:150028598-150028620 GTTAGGGGGAACAGGGAGAATGG - Intergenic
914912585 1:151799740-151799762 GCTTGGAGGAACAGGGAGGAGGG - Intergenic
916829689 1:168477855-168477877 GCTTGTGGGGAGAGGGGAAAAGG - Intergenic
917152346 1:171958414-171958436 GTTTGGGAGAACAAGGAAAAGGG + Intronic
917172260 1:172190155-172190177 CGGTGGGGGTGCAGGGAAAAGGG - Intronic
918803981 1:189015599-189015621 ACTTGAGGGTACAGGGTAGAAGG - Intergenic
920102997 1:203529576-203529598 GCATGGGGGCGCAGGGAAACAGG - Intergenic
920286962 1:204887149-204887171 GCTTGGGGGAGGAGGGAATAGGG - Intronic
920697795 1:208194913-208194935 GCTTGTGGGTACAGCTCAAAAGG + Intronic
921127768 1:212193203-212193225 GCTGGGGGGTTGGGGGAAAATGG - Intergenic
923603832 1:235425686-235425708 GCTTGGGGGTACTAGAAACAAGG - Intronic
924673308 1:246150720-246150742 GGTTGGGGGGACATGGAAAAAGG + Intronic
1063708790 10:8457120-8457142 GCTGGGGAGTACAGGGGAGAAGG - Intergenic
1063939777 10:11115980-11116002 GCTGGCTGCTACAGGGAAAAAGG - Intronic
1066515711 10:36157976-36157998 GTTTAGGGGCAAAGGGAAAACGG - Intergenic
1066706335 10:38183053-38183075 CTTTGGGGACACAGGGAAAAGGG - Intergenic
1067673261 10:48346080-48346102 ACTTGGGGGTGAAGGGAAGACGG - Intronic
1069492075 10:68869557-68869579 GGTGGGGGATACAGGGACAAAGG + Intronic
1069842892 10:71351051-71351073 GTTTGGGGGCAAAGGGAAGAAGG - Intronic
1070692699 10:78539355-78539377 GCATGGGAGAACAGGGAAGAAGG - Intergenic
1072633647 10:97163987-97164009 GGGTGGGGGTACAGGGAGACAGG - Intronic
1074767952 10:116714412-116714434 GCTTGGGGGTAGAATGAGAAAGG - Intronic
1075287105 10:121196379-121196401 GCTTGGGTGAACAGAGAAAAGGG - Intergenic
1076122400 10:127946630-127946652 AATTGTGGGTACAGGGACAAAGG + Intronic
1077548205 11:3186069-3186091 GTTTGGGGGAAAAGGGAAAGGGG - Intergenic
1077614540 11:3665679-3665701 GCTGAGGGGCTCAGGGAAAAGGG - Exonic
1078096587 11:8301117-8301139 GACTGGGGGTACAGGGTAGAAGG + Intergenic
1078292277 11:10024699-10024721 GCTTGGGGGTACAGGGAGGAGGG - Intronic
1078467224 11:11559318-11559340 GCTTGGGGGAAAGGGGAGAAGGG + Intronic
1078548539 11:12264112-12264134 GCTTGGGTGTGCGGGGGAAACGG - Intergenic
1079125430 11:17715006-17715028 GGTTGGGGGCGGAGGGAAAAAGG - Intergenic
1079135733 11:17775164-17775186 CCTTGGGGGTACAGTGAGACTGG - Intronic
1080552280 11:33382892-33382914 ATTTGGGGGTTCAGGGAGAAGGG + Intergenic
1080936814 11:36871927-36871949 GCTTGGAGAGACAGGGAGAATGG + Intergenic
1081854739 11:46296216-46296238 GGTTGGGGGTAGAGGGGACAAGG + Intronic
1083266914 11:61551037-61551059 GCTTGGAGGTCCAGGGAAGCCGG + Intronic
1083636455 11:64123439-64123461 CCTTGGAGGTGCAGGGAAAGGGG + Intronic
1086132264 11:83413159-83413181 GTTGGGGGGTGCAGGGGAAAGGG - Intergenic
1086402667 11:86473366-86473388 GCATGGGGTTAAAGTGAAAATGG + Intronic
1088401000 11:109422647-109422669 AGTTGGGGGCACAGGGAAATGGG + Intronic
1089403940 11:118181843-118181865 GTTTGGGGGTTCAGGGAGAGGGG + Intergenic
1090388180 11:126368696-126368718 CCTTGTGAGTACAGGGGAAATGG + Intronic
1090390920 11:126386675-126386697 CCTTGTGAGTACAGGGGAAATGG + Intronic
1090462511 11:126904692-126904714 GCTTGGGGGTAGGGGGTCAAAGG + Intronic
1091335490 11:134762794-134762816 GCCTGGGGCTGCAGGGAGAAAGG + Intergenic
1091667601 12:2430644-2430666 GCTTGGGTTTACAGGGGAAAGGG - Intronic
1091769930 12:3144905-3144927 GTCTGGGGGAATAGGGAAAAGGG - Intronic
1091778499 12:3199816-3199838 GCTAGGGCGCACAGGGAGAAGGG - Intronic
1095276933 12:40296933-40296955 GCTGGAGGGTAGAAGGAAAAAGG - Intronic
1096049947 12:48598769-48598791 CCTTGGAGGTACTGGGGAAAGGG - Intergenic
1099201077 12:79677975-79677997 GTTTGGGGGTAGAGGGCAGATGG - Intronic
1099827673 12:87799129-87799151 ACTTGAGGGTACAGGGTAAGAGG - Intergenic
1100377668 12:94032285-94032307 CTTTTGGGGAACAGGGAAAAGGG + Intergenic
1102874735 12:116440853-116440875 ACATGGGGTTACAGGGAGAAGGG + Intergenic
1105260164 13:18773172-18773194 GGTTGGGGGTGGAAGGAAAAGGG - Intergenic
1105574676 13:21639245-21639267 GGGTGGGGGTACAGGGGGAAAGG - Intergenic
1107002377 13:35564030-35564052 GCTTGAGGGTAGAGGGAAGGAGG - Intronic
1107660518 13:42634533-42634555 GCTTGGAGGTCCAGAGATAAGGG - Intergenic
1108122916 13:47208993-47209015 GGTTTGGGGTACAGGGTCAAAGG - Intergenic
1110434321 13:75462521-75462543 GGTGGAGGGTAGAGGGAAAAAGG + Intronic
1112986406 13:105455447-105455469 TGGTGAGGGTACAGGGAAAAAGG + Intergenic
1113625365 13:111792012-111792034 GCTTGCTGGTTCAGGAAAAATGG - Intergenic
1113932910 13:113977704-113977726 GGTGGGGGGTACAGGGAGGAGGG - Intergenic
1113950811 13:114069972-114069994 ACTTGGGGGAACCGGGAAACTGG + Intronic
1113950859 13:114070085-114070107 ACTTGGGGGGACCGGGAAACTGG + Intronic
1116962177 14:50977839-50977861 GTTTGGGGATACACGGAAATTGG - Intronic
1118701674 14:68439567-68439589 CTTTGGGGGAACAGGGACAATGG - Intronic
1118941712 14:70345419-70345441 GCTCAGGAGAACAGGGAAAAAGG - Intronic
1119217670 14:72881529-72881551 TCTTGGGGGTAGGAGGAAAAGGG + Intronic
1119881397 14:78102741-78102763 GCTAGGGGGAACAGGGAATGGGG + Intergenic
1122084031 14:99287171-99287193 GCTGGGGGGAGGAGGGAAAATGG - Intergenic
1122185591 14:99991732-99991754 GCTTGGGGCAAAGGGGAAAAGGG + Intronic
1122407382 14:101508639-101508661 GCTTTGGGCTATAGGGAAAAGGG - Intergenic
1122837129 14:104435824-104435846 TCTTGGGGGTAGAGTGCAAAGGG - Intergenic
1123661993 15:22572609-22572631 GCTTGAGGGAGCAGGGAGAAAGG - Intergenic
1124887626 15:33701715-33701737 GTTTGGGAGCACACGGAAAAGGG + Intronic
1125578069 15:40768402-40768424 GCTACGGGGTAGAGGGAAAGGGG - Intronic
1126212901 15:46119912-46119934 GCTTGGGGAAAGAGGAAAAAAGG + Intergenic
1126526612 15:49663227-49663249 GCATGGGTTTACAGGGGAAAAGG - Intergenic
1128983182 15:72200848-72200870 GAATGGGGGTAGAGGGCAAATGG - Intronic
1129188778 15:73926040-73926062 GCTTTAGGGAACAAGGAAAAGGG + Intronic
1130876888 15:88022317-88022339 GCTTGGGCGTAAAGCCAAAATGG - Intronic
1131274915 15:90972846-90972868 TCTTGGTCTTACAGGGAAAATGG + Intronic
1131282814 15:91034563-91034585 GCTTTGAGGCACAGGGAAAGAGG - Intergenic
1132121038 15:99175593-99175615 GCTTGGTGGCACAGGCACAAAGG - Intronic
1133339468 16:5027302-5027324 TCTTGGGGTCACAGGGACAATGG + Exonic
1133572148 16:7051727-7051749 GCTGGGGTTTTCAGGGAAAAGGG + Intronic
1133920141 16:10145169-10145191 GGTTGGGGGCATAGGGAAATGGG + Intronic
1135114757 16:19715139-19715161 GCGTTGTGGGACAGGGAAAATGG + Intronic
1135496426 16:22955620-22955642 GCTTGGGGGCATTGGGAGAACGG - Intergenic
1135671838 16:24382212-24382234 GATGGGGGGTACAAGGAAAGGGG - Intergenic
1135696323 16:24590020-24590042 GGATGGGAGGACAGGGAAAAAGG - Intergenic
1136281302 16:29213087-29213109 GGTTGGGGGTGCAGGGAGGACGG - Intergenic
1136508833 16:30723499-30723521 GCTTGGGGGTATGGGAAAGATGG + Intronic
1137746344 16:50822981-50823003 GAATGGGGGTATGGGGAAAAAGG + Intergenic
1138387982 16:56649172-56649194 GACTGGGGCTACAGGGACAAAGG - Intronic
1139491527 16:67288612-67288634 GCTGGTGGGTATAGGGCAAATGG - Intronic
1140049219 16:71464782-71464804 TCTTGGGGCTGCAGGGACAAAGG - Intronic
1142085671 16:88179015-88179037 GGTTGGGGGTGCAGGGAGGACGG - Intergenic
1142232433 16:88906117-88906139 GCTTGGGGGTGCAGGGATAGAGG - Intronic
1143771012 17:9168842-9168864 TGTGGGGGGTGCAGGGAAAAGGG + Intronic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1145043283 17:19592651-19592673 GCTTGGGGATAGCGGGGAAAAGG + Intergenic
1148855147 17:50574929-50574951 GGAGGGGGGCACAGGGAAAATGG + Intronic
1150277271 17:63907162-63907184 TATTGGTGGAACAGGGAAAACGG - Intergenic
1150696041 17:67406365-67406387 GGTTGGGGAAACAGGGAAATGGG - Intronic
1151255979 17:72876936-72876958 GGTTGTGGGCACAGGGAAATTGG - Intronic
1152339429 17:79716095-79716117 CCCTGGGGGTACAGGGCAGAGGG + Intergenic
1152371257 17:79890085-79890107 GCTTGGGGGAGCAGGGAGACGGG - Intergenic
1154425863 18:14271628-14271650 GGTTGGGGGTGGAAGGAAAAGGG + Intergenic
1154433552 18:14326870-14326892 GGTTGGGGGTGGAAGGAAAAGGG + Intergenic
1155103771 18:22640541-22640563 GCTTGGGTGTGCAGTGAAAATGG - Intergenic
1156281380 18:35642748-35642770 GCTTGGGGAACCAGGGAAGAGGG - Intronic
1157903795 18:51547361-51547383 GCTGGGGGGTGCAGGGAAGTAGG - Intergenic
1158194977 18:54874864-54874886 GTTTAGGGGAAGAGGGAAAAAGG + Intronic
1159442834 18:68504068-68504090 GCTTGGAGGTACTGAGAGAAAGG - Intergenic
1159839988 18:73388306-73388328 GATTGGGGATACAGGGAACTGGG - Intergenic
1160402414 18:78620624-78620646 GCCTTGGGGCACAGGGAAAGAGG - Intergenic
1160421477 18:78750074-78750096 GTGTGGGGGGACATGGAAAACGG - Intergenic
1161176646 19:2846961-2846983 TATTGGAGGTTCAGGGAAAAGGG - Intronic
1161954519 19:7485829-7485851 GCCTGGGGGCACAGGTAACAGGG - Exonic
1162679779 19:12332162-12332184 GCTAAGGGGAACAGGGGAAAAGG + Intronic
1163668559 19:18614222-18614244 GGGTGGGGGTATTGGGAAAAGGG - Intronic
1163810314 19:19427381-19427403 GCTTGGGGACAAAGGGACAAAGG + Intronic
1164236863 19:23345216-23345238 GCTAGAGAGAACAGGGAAAAGGG - Intronic
1164267953 19:23639225-23639247 CTTTGGGGATACAGGGAGAAAGG + Intronic
1164826748 19:31289728-31289750 GCTAGGGGCTACAGGGACAGTGG - Intronic
1164880436 19:31728213-31728235 GCGTGGGGGTACATGGAAACCGG - Intergenic
1166630520 19:44402438-44402460 GCTTGAGGGTGCGTGGAAAAGGG - Intergenic
1166852563 19:45767559-45767581 GGTTTGGGTTACAGGGAAACCGG + Intronic
1167975060 19:53219509-53219531 GCGTGGGGGTACAGTGTATATGG - Intergenic
925206107 2:2007792-2007814 GCTTGAGGGTAAAGGCAAAATGG - Intronic
926386723 2:12342604-12342626 CCTTGGGGGTACAGAGATAAAGG + Intergenic
927123942 2:19995990-19996012 TCTTATGGGTACAGGGATAATGG - Intronic
927240983 2:20919341-20919363 GCAGGGGGCTGCAGGGAAAAAGG - Intergenic
927924610 2:27002496-27002518 TTTTGAGGGTACAGGGAAATGGG - Intronic
929531782 2:42757220-42757242 GCCTGGGGGCACAGGGTCAAAGG - Intergenic
929632720 2:43481468-43481490 GATTTGGGGTACATGGAAACAGG - Intronic
930675924 2:54200415-54200437 GTTTGAGGGTAGAGGGAAATAGG - Intronic
932380280 2:71276236-71276258 GCTTGGGGACACATGGAAATAGG - Intergenic
933168442 2:79098836-79098858 GCTGGGGAGAACAGGGAAAAAGG + Intergenic
933846621 2:86332051-86332073 CCCTGGGAATACAGGGAAAAAGG - Intronic
934778473 2:96953930-96953952 GCCTGGAGGAAAAGGGAAAAAGG + Intronic
935338470 2:102038178-102038200 GGATGGGGGTGCAGAGAAAAGGG - Intergenic
937333271 2:121045185-121045207 GCTTGGAGGTCCCGGGACAAAGG - Intergenic
937449383 2:121989155-121989177 GGTTGGGGGAACTGGGAAAAGGG + Intergenic
938055773 2:128213579-128213601 GCTTGGGTGTACACAGAGAAGGG + Intergenic
938543145 2:132303270-132303292 GCTTGAGGGTGCATGGAAAACGG + Intergenic
939165661 2:138638720-138638742 GGTTGGGGGCAGAGGGAAATGGG + Intergenic
939496997 2:142936482-142936504 GCATGGGAGAACAGAGAAAAAGG + Intronic
939994324 2:148906125-148906147 CCTTGGGGCCAGAGGGAAAAAGG + Intronic
940123703 2:150298068-150298090 TCTTGGGGCAAAAGGGAAAAGGG + Intergenic
940851426 2:158691049-158691071 GCTGGGGAGCACAGGGAAAGAGG + Intergenic
941305872 2:163866609-163866631 GCTTAGGAGTACAGGTAAATAGG + Intergenic
942300711 2:174558817-174558839 GCCTGGAGGTACAGGGAGGATGG + Intergenic
942301261 2:174564624-174564646 TCTAGAGGGTACAGGGAAGATGG + Intronic
945058551 2:205888680-205888702 GTTTGGGGGTTCAGTGAGAAGGG + Intergenic
945315064 2:208361586-208361608 GCTTGGGAGTAGGGGGAAAGAGG - Intronic
947569944 2:231225710-231225732 GCTGGGGAGAGCAGGGAAAATGG + Intronic
1168909931 20:1439690-1439712 GCAGGGAGGGACAGGGAAAACGG - Intergenic
1169496817 20:6123267-6123289 GCCTGGGGGAACAGGGAAACTGG - Exonic
1169860041 20:10141550-10141572 GCTTGTGGGCACATGGAGAATGG - Intergenic
1171872029 20:30536104-30536126 GCTTGAGGGTGCGTGGAAAACGG + Intergenic
1171963966 20:31515550-31515572 TCTTGGGGGTATGGGGAGAAGGG - Intronic
1173049646 20:39546881-39546903 GCTTGGGGATACCAAGAAAAGGG - Intergenic
1176695648 21:9973909-9973931 TTTTGAGGGTACAGGGAAGAGGG + Intergenic
1178306803 21:31497959-31497981 GCTTGGGGGAACAGGGCTATGGG - Intronic
1179162913 21:38912592-38912614 GCTGGGGGGTAGGGGGAAATGGG + Intergenic
1180785050 22:18542473-18542495 GCTGTGGGGTACAGGGAGAGGGG + Intergenic
1180840700 22:18957622-18957644 GTTTGGGGGCTCAGGGAACAGGG + Intergenic
1180909375 22:19438166-19438188 GCTTGGGGGAAGAGGGGAACAGG - Intronic
1181060787 22:20281152-20281174 GTTTGGGGGCTCAGGGAACAGGG - Intronic
1181092019 22:20480188-20480210 GCCTGGGGGTAAAGGAGAAAAGG + Intronic
1181128633 22:20716506-20716528 GCTGTGGGGTACAGGGAGAGGGG + Intronic
1181241953 22:21481827-21481849 GCTGTGGGGTACAGGGAGAGGGG + Intergenic
1181570641 22:23766274-23766296 GCCTGGGGGTACAGTGCAAGAGG + Exonic
1181899311 22:26139615-26139637 GCATGGGGTTACAGGGAAGTCGG + Intergenic
1183013873 22:34970123-34970145 GTCTAGGGGTACAGAGAAAATGG + Intergenic
1183608249 22:38879639-38879661 GCTTGGGGGGACATAGAACAGGG + Intergenic
1183611349 22:38908729-38908751 GCTGGGGGGACTAGGGAAAATGG - Intergenic
1183766589 22:39882317-39882339 AGTTGGGGATAGAGGGAAAAAGG + Intronic
1183960676 22:41410211-41410233 ACTTGGGGGCACAGGGAAGCTGG + Intergenic
1185160663 22:49227417-49227439 GGTTGGGGGTGTAGGCAAAATGG + Intergenic
949182021 3:1144029-1144051 ACCTGGTGGTACAGAGAAAAAGG - Intronic
950105003 3:10382809-10382831 GCTTGGGGGAGCAGGGTCAAAGG + Intronic
950434866 3:12973400-12973422 GCCTGGGGGTAGAGGGATTAGGG - Intronic
952332170 3:32374069-32374091 GCTTGGGAGTTCTGGGAAAGAGG + Intergenic
953493088 3:43366046-43366068 GCTTGGGCTTGCAGAGAAAAGGG - Exonic
953879427 3:46683936-46683958 TCATGGGGGTAAAGGGAAGAAGG + Intronic
955258487 3:57359796-57359818 TCTTGTGGGTTCAGGGAAAAGGG + Intronic
956672096 3:71700681-71700703 GCTTGGGGGTTGTGGGATAAAGG + Intronic
957650801 3:83000343-83000365 GCTTGGGGGTAAAAGAGAAAGGG + Intergenic
960824914 3:121772354-121772376 GCTTGGGGAAACAGGTAAGAAGG + Intronic
961013659 3:123450918-123450940 GCTTGGGGGCAAAGGGAATTGGG - Intergenic
961078429 3:124003412-124003434 GCTTTGGGGAAAAGGGTAAATGG - Intergenic
961095252 3:124149365-124149387 ACTGGGGGGTACAGGGAGATAGG - Intronic
961305043 3:125953033-125953055 GCTTTGGGGAAAAGGGTAAATGG + Intergenic
961485848 3:127215713-127215735 GCATGGTGGTACAGGGAGAAAGG + Intergenic
964090250 3:152867580-152867602 GCTTTAGGATACAGGGAAAAAGG - Intergenic
964421629 3:156510115-156510137 GCTTGGTGGAATTGGGAAAAGGG - Intronic
964472457 3:157069739-157069761 ACTTGGGGGTAGAGGGATACAGG + Intergenic
964580327 3:158227293-158227315 TCTTGGGGGCAGAGGGAAGAGGG - Intronic
964607761 3:158575489-158575511 GTTTGGGGGTTGAGGTAAAACGG - Intronic
964734311 3:159900724-159900746 GCTTGGGGCTACAGTTACAAGGG - Intergenic
964827477 3:160844906-160844928 GGTTGGGGGGACAAGGAAGATGG - Intronic
964971984 3:162575253-162575275 GCGTGGAAGTACAGGAAAAACGG - Intergenic
965162272 3:165149814-165149836 GCTTATGAGTACAGGGAAAATGG - Intergenic
966338019 3:178892503-178892525 GCTGGGGGGTTCAGGGCACAGGG + Intergenic
968108780 3:196025063-196025085 GCTTCTGGGAAAAGGGAAAAGGG - Intergenic
969318526 4:6396324-6396346 GCTTTGGGGTACAGGCCACAAGG - Intronic
969546635 4:7834342-7834364 CTTTGGGGATTCAGGGAAAAAGG + Intronic
970538497 4:17054439-17054461 GCTTGGGCTTACTGGGAAATAGG - Intergenic
970793524 4:19887944-19887966 GCATGGGAGAACAGGGAAAAAGG - Intergenic
973864395 4:55097368-55097390 GGTTCTGGGTACAGGGAAAAAGG - Intronic
974140156 4:57876084-57876106 GCTAAGTGTTACAGGGAAAAAGG - Intergenic
974208607 4:58740743-58740765 GCCTGGGGGTAAAGGGCAGAAGG - Intergenic
974513925 4:62883098-62883120 ACTTGGGGGTGCAGGGTGAAAGG - Intergenic
974958501 4:68672535-68672557 GCTCGAGAGAACAGGGAAAAAGG - Intergenic
975600172 4:76090911-76090933 GCCTGGGGGGACTGGGAAACAGG - Intronic
975753921 4:77553043-77553065 GCTTGGGGGTGGAGTGGAAAGGG + Intronic
977141136 4:93373769-93373791 TCTTGGGAGAACTGGGAAAATGG + Intronic
977732851 4:100376041-100376063 GTATGGGGGAACAGGGGAAAGGG + Intergenic
978570693 4:110133572-110133594 GCCTGAGAGGACAGGGAAAAAGG + Intronic
979120744 4:116897257-116897279 GCTTGGGGGTGGAGGGAGATGGG - Intergenic
980368270 4:131834142-131834164 TTTTGAGGGTACAGGGAAGAGGG + Intergenic
981206304 4:142044687-142044709 GCTTGGAGGCACAGAGAAAGGGG + Intronic
982305667 4:153928259-153928281 CCTTGGGGTTACAGGCTAAAAGG + Intergenic
983232756 4:165146233-165146255 GGGTGGGGATTCAGGGAAAATGG - Intronic
989586091 5:43074845-43074867 GCTCAGGAGAACAGGGAAAAAGG + Intronic
991585021 5:68193272-68193294 GCTGGGAGGTACAAGGTAAAGGG - Intronic
993697090 5:91074322-91074344 ACTTGAGGGTAGAGGGAAAGAGG - Intronic
993776789 5:92010004-92010026 GCTTGAGGGGATAGGGAAAATGG + Intergenic
995094969 5:108225090-108225112 GCTTGGAGGTAGTGGGAAATAGG - Intronic
995109656 5:108414727-108414749 GCTTGAGGGTAGTGGGAAAGAGG - Intergenic
995328379 5:110918222-110918244 GCGTGAGGGTACAGAGAGAAGGG + Intergenic
995753934 5:115481751-115481773 TCTTGGGGGTATAAGGAAGAAGG + Intergenic
997274813 5:132576111-132576133 GCGTGGGGGTAGGGAGAAAATGG - Intronic
998015050 5:138725114-138725136 GCCTGGGGAGAGAGGGAAAAGGG + Intronic
998371744 5:141666389-141666411 GTTTGGGGGGACAGGGATGAAGG - Intronic
999206450 5:149851737-149851759 GTTTGGAGGTACCGGGTAAATGG + Exonic
999827788 5:155290640-155290662 GGTTGGGGGTGGAGGGGAAATGG + Intergenic
1001638913 5:173231761-173231783 GCTTGGGAGCACAGGGAAGGCGG + Intergenic
1003100503 6:3172970-3172992 GCTTGGAGAAACAGTGAAAAAGG - Intergenic
1004131573 6:12925822-12925844 GCTTTGGGTTGCAGGGAAATGGG - Intronic
1004546575 6:16603794-16603816 GCTGTGGGGTACAGGGGAAGAGG + Intronic
1006167098 6:32071402-32071424 GCCTGGGGGTGCTGGGAGAAGGG - Intronic
1006968503 6:38014795-38014817 TCTTGAGGATACAGGGAAGATGG + Intronic
1007414485 6:41683849-41683871 GGTGGGGGGTACAGGGAAGAGGG - Intergenic
1013291136 6:108719681-108719703 GCCTGGGAGTGCAGGGAGAACGG + Intergenic
1014648667 6:124007914-124007936 TTTTGGGGTTACAGGCAAAAAGG + Intronic
1016348343 6:143140462-143140484 AGTTGCGGGAACAGGGAAAAAGG - Intronic
1016369445 6:143357045-143357067 TCCTGGGGGTATAGGGAAATTGG + Intergenic
1018349150 6:162938056-162938078 CCTTGGGGACACAGGGGAAAAGG - Intronic
1020687098 7:11309569-11309591 GCTTGGGGGTGGAGGGACAGAGG + Intergenic
1020853577 7:13389137-13389159 GCCTGGAGGTACAGGGAACCTGG - Intergenic
1022003071 7:26244365-26244387 GCTCAGGAGAACAGGGAAAAAGG - Intergenic
1022108813 7:27215165-27215187 GCAAGAGGGGACAGGGAAAAAGG + Intergenic
1024010238 7:45260521-45260543 ACTAGGAGGGACAGGGAAAAGGG + Intergenic
1026521069 7:71118693-71118715 GGTTGGGGGTACAGGGACCCAGG - Intergenic
1029664356 7:101985344-101985366 CCCTGGGGGTTCAGGGAAACTGG + Intronic
1029803442 7:102974004-102974026 GCTCGGGAAAACAGGGAAAAAGG - Intronic
1029970700 7:104785937-104785959 ATTTGGGGGTTCAGGGAAGAAGG - Intronic
1031330099 7:120453407-120453429 GGTTGGTGGTACAGGGAGGATGG - Intronic
1032079416 7:128851211-128851233 CCCTGGGGATACAGAGAAAAAGG - Exonic
1032960578 7:137029018-137029040 GCTTGGGGACACAGCAAAAAGGG + Intergenic
1033651461 7:143346673-143346695 GTTTGGGGATACAGGGGAAAGGG + Intronic
1034020463 7:147636589-147636611 GTTGGGGGGTGCAGGGTAAATGG - Intronic
1036163101 8:6406930-6406952 GTTTGGGGGGACAGGGAGCACGG - Intronic
1037839334 8:22232624-22232646 GCTTGGGGGTCCACAGGAAAAGG + Intergenic
1037881119 8:22573963-22573985 GCAGGGGTGTGCAGGGAAAAGGG + Intronic
1038129279 8:24711380-24711402 GCTTGTGAGTATAGAGAAAATGG - Intergenic
1038420839 8:27433243-27433265 GCATGGGCGTACAGGTGAAAGGG + Intronic
1038650525 8:29398928-29398950 GAATGAAGGTACAGGGAAAAAGG + Intergenic
1040102687 8:43519423-43519445 GGGTGGGGGTGCAAGGAAAAAGG + Intergenic
1040887275 8:52278548-52278570 GGTTGGGGGTAGATGGAAAAGGG - Intronic
1041390203 8:57341105-57341127 GCCTGGGGGTACAGGGTATTGGG + Intergenic
1042604347 8:70530846-70530868 GCTTCAGGGTTCATGGAAAATGG - Intergenic
1043331202 8:79120663-79120685 GGTTGAGGCTCCAGGGAAAATGG + Intergenic
1044081024 8:87884043-87884065 TCTTATGGGTAGAGGGAAAAAGG - Intergenic
1044843358 8:96356761-96356783 GCATGGGTTTACAGGGAAAAGGG + Intergenic
1047420389 8:124703172-124703194 GCTTGGGGATAGGGTGAAAAAGG - Intronic
1047794084 8:128236203-128236225 GTTTGGGGGAAATGGGAAAAAGG - Intergenic
1048666095 8:136662973-136662995 GTTTGGGGGTAGAGGGTATATGG + Intergenic
1048717026 8:137282086-137282108 GCTTGGGAGAACAGGGAAAAAGG - Intergenic
1049217445 8:141414719-141414741 GCTGGGGGGAGCAGGGATAAGGG + Intronic
1051220794 9:14846355-14846377 GTTCGGGGGTAGAGGGGAAAGGG + Intronic
1052383106 9:27793187-27793209 TATTGGGGGTACAGGGCAAGAGG + Intergenic
1053632632 9:39959866-39959888 TTTTGAGGGTACAGGGAAGAGGG + Intergenic
1053773128 9:41503665-41503687 TTTTGAGGGTACAGGGAAGAGGG - Intergenic
1054211256 9:62290831-62290853 TTTTGAGGGTACAGGGAAGAGGG - Intergenic
1054313722 9:63558015-63558037 TTTTGAGGGTACAGGGAAGAGGG + Intergenic
1056037822 9:82627528-82627550 GTTTGGGGGTAGAGGGTATATGG + Intergenic
1057170369 9:92959874-92959896 GCATGGGGGTACAGGGGACGTGG - Intronic
1057246377 9:93458529-93458551 TGTTGGGGGTACTGGAAAAAAGG - Intronic
1057334019 9:94142035-94142057 GCCTGGGGATTCAGGGACAAGGG - Intergenic
1057676173 9:97137663-97137685 GGTTGGGGGTGGAAGGAAAAAGG - Intergenic
1057967170 9:99515539-99515561 GCCTGGGGCTGCAAGGAAAAAGG - Intergenic
1058758273 9:108104197-108104219 CATTTGGGGCACAGGGAAAAAGG + Intergenic
1059307710 9:113367763-113367785 TCTGGGGGGCACAGGGGAAATGG + Intronic
1059691436 9:116688709-116688731 GCTTGGGGGTACAGGGAAAAAGG - Intronic
1060070839 9:120545933-120545955 GCCTCAGGGCACAGGGAAAAGGG + Intronic
1186383481 X:9085731-9085753 TCTTGAGGGTAGAGGGTAAAAGG + Intronic
1187406938 X:19012905-19012927 GCTTAGTGGTACAGAGATAAAGG - Intronic
1187759367 X:22563322-22563344 GCTGGGGGGTAGGGGGAAATGGG - Intergenic
1188573337 X:31616249-31616271 GCTTGGGGGCTCAGGGAAAAAGG + Intronic
1188679255 X:32981066-32981088 ACATGGAGGGACAGGGAAAACGG + Intronic
1189700825 X:43715388-43715410 GCTAGGGGATGCAGGGAAGATGG + Intronic
1190732759 X:53235824-53235846 GCTTGTGGGTGCAGGGAAGCGGG - Exonic
1192504123 X:71670530-71670552 GCTGGGGGAGACAGGGAGAACGG + Intergenic
1192555426 X:72085224-72085246 GCTGGGTGGTACAGGGGAGAGGG - Intergenic
1192902884 X:75519039-75519061 ACTTGGGGGAAGAGGGAACAGGG + Intronic
1193082173 X:77416702-77416724 GGCTGGGGGTACAGGGATCAAGG + Intergenic
1194569747 X:95540652-95540674 GCTTGGGGGTAAAGGGAGAGAGG + Intergenic
1195588521 X:106596762-106596784 CCTTGAGGCTACAGAGAAAAGGG + Intergenic
1197745887 X:129932142-129932164 GCGCGGGGGTACGGAGAAAAGGG - Intergenic
1199077290 X:143537832-143537854 TCTTGGGGCAAAAGGGAAAAGGG - Intergenic
1199608796 X:149596652-149596674 TCTTTGGGGTACAGGGGAACGGG - Exonic
1199630326 X:149772708-149772730 TCTTTGGGGTACAGGGGAACGGG + Intergenic