ID: 1059697742

View in Genome Browser
Species Human (GRCh38)
Location 9:116744830-116744852
Sequence AGCTAGCAGAGGCAGAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 399}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059697742_1059697747 20 Left 1059697742 9:116744830-116744852 CCTCCTTTCTGCCTCTGCTAGCT 0: 1
1: 0
2: 0
3: 43
4: 399
Right 1059697747 9:116744873-116744895 CTGCTAACTGTGAGACCCACAGG No data
1059697742_1059697748 27 Left 1059697742 9:116744830-116744852 CCTCCTTTCTGCCTCTGCTAGCT 0: 1
1: 0
2: 0
3: 43
4: 399
Right 1059697748 9:116744880-116744902 CTGTGAGACCCACAGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059697742 Original CRISPR AGCTAGCAGAGGCAGAAAGG AGG (reversed) Intronic
900143205 1:1147110-1147132 AGCCACCAGGGGCAGAGAGGTGG + Intergenic
900661565 1:3787045-3787067 AGGAAGCAGAGGCGGGAAGGTGG - Exonic
902195797 1:14797021-14797043 AGGTAGAAAGGGCAGAAAGGTGG + Intronic
902872377 1:19322290-19322312 AACCAGCCCAGGCAGAAAGGGGG - Intronic
902996182 1:20227201-20227223 AGCAAGAGGAGGCAGAGAGGTGG - Intergenic
903046702 1:20569812-20569834 AGCTAGCAGATGGGGAAAGACGG - Intergenic
903873031 1:26450739-26450761 AGTTAGCAGAGGTAGAGAGCAGG + Intronic
904267198 1:29324909-29324931 AGCTAGGAAACCCAGAAAGGAGG - Intronic
904344412 1:29858543-29858565 AGCAAGCAGGAGGAGAAAGGAGG + Intergenic
904773213 1:32892615-32892637 AGCTTTCAGAGGCAGCATGGGGG + Intronic
904921789 1:34013764-34013786 AGGGAGCAGAGACAGAAAAGAGG - Intronic
904940876 1:34164441-34164463 ACCTTGCAGACGCAGAAATGGGG + Intronic
905006631 1:34715118-34715140 AGCTAGAAGAGGCAGACCTGGGG - Intronic
905231375 1:36516656-36516678 CACCAGCAGAGGCAGGAAGGGGG - Intergenic
905389430 1:37626690-37626712 AGTGAGAAGAGGCACAAAGGGGG + Intronic
906029215 1:42704266-42704288 ATCTAGGTGAGGCAGATAGGAGG - Intergenic
906042164 1:42795943-42795965 AGGTGGCAGAGGCAGAATGGTGG + Intergenic
906855027 1:49294828-49294850 AGGTTGCAGAGGGAGAAAAGAGG - Intronic
907270646 1:53288959-53288981 TGGTAGCAGAGGCAGGCAGGGGG - Intronic
907629093 1:56062056-56062078 AGGTAGCACAGGCAGGAAGGAGG + Intergenic
908512571 1:64861077-64861099 AGGTGGCAGAGGCACAAAAGTGG + Intronic
909480031 1:76121034-76121056 TGGAAGCAGAGTCAGAAAGGAGG - Intronic
911268445 1:95772069-95772091 AGCTAGAAGACTCAGAAAGCTGG - Intergenic
915910188 1:159910199-159910221 AGAGAGCAGAGGGAGGAAGGAGG + Intergenic
917139100 1:171816841-171816863 ATATACCAGAGGCACAAAGGTGG - Intergenic
917487188 1:175465998-175466020 AGAGACCAGAGGCAGAATGGAGG - Intronic
917655296 1:177119905-177119927 AAATAGCAGAGGAAGAAATGGGG + Intronic
919761226 1:201099379-201099401 GGCTGGCAGAGGCAGCAAAGTGG + Intronic
919833478 1:201557935-201557957 GGCTTGGAGGGGCAGAAAGGAGG + Intergenic
920113797 1:203605367-203605389 GGACAGCAGAAGCAGAAAGGAGG - Intergenic
920308521 1:205034164-205034186 AGCTGGCAGAGGCTGTGAGGTGG - Intergenic
920346280 1:205307667-205307689 ATCTAGCAGCTGCAGAAAGCAGG + Intronic
920543850 1:206799360-206799382 AGCTAGCTGCAGCAAAAAGGGGG + Intronic
920569193 1:207003433-207003455 AGCCAGGAGAGGCGGCAAGGTGG - Intergenic
920740407 1:208576600-208576622 AGCTAGAAGAGGGAGAGAGGAGG - Intergenic
921048311 1:211492759-211492781 AGAGAGCAGAGACAGGAAGGAGG - Exonic
921937391 1:220807853-220807875 AGCTACTAGGGGCAGAAAGCAGG + Intronic
922985113 1:229860307-229860329 AGGGAGCAGAGCCAGAGAGGGGG + Intergenic
924375842 1:243407705-243407727 AGAAAGCAGAAACAGAAAGGAGG - Intronic
924722978 1:246639969-246639991 AGATAGCAGAAGCAGGAAGAGGG - Intronic
924729312 1:246697259-246697281 ACCCAGCAGGGGCAGAAAGAAGG - Intergenic
1063290732 10:4744253-4744275 AGCTGGGTGAGGCAGGAAGGAGG + Intergenic
1063646537 10:7889446-7889468 AGGAAGCAGAGGCAGAAAGAAGG + Intronic
1063790426 10:9439255-9439277 AGCTAGGAGAGACAGCAAGTTGG + Intergenic
1064016009 10:11772970-11772992 ACCTTCCAGAGGCAGAAAGACGG - Intergenic
1064016204 10:11774288-11774310 AGCTAGCAGGTGCTGGAAGGAGG + Intergenic
1065348532 10:24773289-24773311 AGGTATCAGAGGGAGAAATGTGG + Intergenic
1065775029 10:29111719-29111741 GGATATCAGAGGCAAAAAGGAGG + Intergenic
1065825729 10:29568873-29568895 AGGGAGCAGAGGAAGGAAGGAGG + Intronic
1066513181 10:36124446-36124468 AGCAAACAGAGGCATAAAGGAGG - Intergenic
1067220336 10:44339581-44339603 AACTAGCACAGGAAGAGAGGAGG - Intergenic
1067432571 10:46253585-46253607 AAGGAGGAGAGGCAGAAAGGAGG + Intergenic
1067440689 10:46307862-46307884 AAGGAGGAGAGGCAGAAAGGGGG - Intronic
1067498317 10:46778562-46778584 AGGTAGGAGAGGCAGGAAAGTGG - Intergenic
1067576929 10:47414982-47415004 AGGTAGGAGGGTCAGAAAGGAGG - Intergenic
1067596329 10:47561853-47561875 AGGTAGGAGAGGCAGGAAAGTGG + Intergenic
1068338047 10:55664046-55664068 AGCTCACAGAAGCAGAAAGGAGG + Intergenic
1069273200 10:66556704-66556726 GGTTATCAGGGGCAGAAAGGTGG + Intronic
1069746725 10:70719798-70719820 AGCTTGCAGAGGCAGGAGAGTGG - Intronic
1071133321 10:82421707-82421729 AGCAAGCAGATGCAGAACTGGGG - Intronic
1071263093 10:83938896-83938918 ATCCATCAGAGGCAGCAAGGCGG - Intergenic
1071616138 10:87078393-87078415 AGGTAGGAGAGGCAGGAAAGTGG - Intronic
1071996970 10:91159011-91159033 GGCTAGCAGAAGCAGGAAGCAGG + Intergenic
1074130110 10:110566740-110566762 GGTTAGCAGAGGCAGTTAGGAGG + Intergenic
1074867604 10:117553926-117553948 ACTTAGGAGAGGCAGGAAGGCGG - Intergenic
1075087299 10:119422170-119422192 AGCTGGCAGAGGGTGAATGGTGG + Intronic
1076907402 10:133370030-133370052 AGCTAGCAGGAGTGGAAAGGAGG + Exonic
1077074121 11:692370-692392 ACTTTGCAGAGGCAGAGAGGAGG - Intronic
1077126103 11:937962-937984 GGCAATCAGAGGCAGAAAGGTGG - Intronic
1077166207 11:1140408-1140430 AGCCAGCAGAGGCAGAGCTGTGG + Intergenic
1077192454 11:1261090-1261112 AGCTAGAAGAGGCAGGAGGAAGG + Intronic
1077388147 11:2285091-2285113 AGAAAGCAGAGGAAGAGAGGAGG - Intergenic
1077615456 11:3670700-3670722 AGGCAGCAGAGGGAGAAGGGAGG - Intronic
1077739455 11:4829287-4829309 AGTTAGGACAGGCAGAAAAGTGG - Intronic
1078530285 11:12131578-12131600 AGCAAGCATATGGAGAAAGGAGG - Intronic
1078794383 11:14577431-14577453 GGATAGCAGAGGTAGAATGGAGG - Intronic
1079141841 11:17816138-17816160 AGCTGGAAGAGGCAGAATGAGGG - Intronic
1080099134 11:28439069-28439091 ATCCAGCAGAGGCAGAAAAGTGG + Intergenic
1082776734 11:57251049-57251071 AGACAGCAGAGGCTGAAAGAAGG + Intergenic
1083611012 11:64004298-64004320 AGCCAGCAGAGGCGGAAGGCAGG + Intronic
1083642346 11:64152391-64152413 AGGCTGCAGAGGCAGGAAGGAGG + Exonic
1084764290 11:71298095-71298117 AGGAAGCAGAGGCAGTCAGGTGG - Intergenic
1085337310 11:75706066-75706088 AGAAAGCAGATGAAGAAAGGGGG + Intergenic
1086129540 11:83386533-83386555 TTCTACCAGAGGCAGAAAGAGGG + Intergenic
1086396263 11:86418710-86418732 GGCTAGAGGAGGCAGAAATGGGG + Intronic
1086900140 11:92358066-92358088 AGGAAGCTGAGGCAGGAAGGAGG + Intronic
1087746186 11:101949982-101950004 AGGTACCAGAAGGAGAAAGGAGG - Intronic
1088648376 11:111936655-111936677 AAAGAGCAGAGGAAGAAAGGGGG - Intronic
1088877518 11:113948292-113948314 AGTTAACAGAGGAGGAAAGGAGG + Intergenic
1089126664 11:116181123-116181145 AGCAAGCAGAGGCAAAAGGAAGG + Intergenic
1089573040 11:119422756-119422778 AGCTCGCAGAGGCGGGGAGGAGG - Intronic
1089747148 11:120625383-120625405 AGAGAGAAGAAGCAGAAAGGAGG + Intronic
1090355609 11:126138603-126138625 AGGTAGCAGGGGCTGAAAGTGGG + Intergenic
1091318181 11:134630897-134630919 AGCCAGAGGAGGCAGAAATGGGG + Intergenic
1091545101 12:1496292-1496314 AGGTAGAAGAGCCAGAAGGGCGG + Intergenic
1091663594 12:2402431-2402453 AGCTGGAAGAGGCAGGCAGGAGG + Intronic
1092958097 12:13568927-13568949 AGCTGGAAGAGGCAGAAGGCAGG - Intronic
1093418871 12:18951544-18951566 AGCTAAGAGAGGCAGAGAAGGGG + Intergenic
1094481130 12:30882279-30882301 AGCAGGCAGAGGAAGAAAGCTGG - Intergenic
1095934050 12:47657697-47657719 AGCTGGCAGAGGCACACAGGTGG + Intergenic
1096070260 12:48771525-48771547 AGGTGTCAGAGGCAGCAAGGGGG - Intronic
1096259496 12:50081909-50081931 AGCTAGGGGAGGCAGCATGGAGG - Exonic
1096411105 12:51377643-51377665 AGATAGCAGATGAAGGAAGGGGG - Intronic
1096496212 12:52040781-52040803 AGCTAGGAGGGGCAAAGAGGAGG - Intronic
1096670245 12:53194166-53194188 AGCAAGCACAGGCAGAAGGCGGG - Exonic
1096682946 12:53268975-53268997 GGCTAGCAAAGGCAGGAAAGAGG - Intronic
1097685070 12:62683670-62683692 GTCTAGCAGGGGCGGAAAGGGGG + Intronic
1097880059 12:64678730-64678752 GCCAAGCAAAGGCAGAAAGGTGG + Intronic
1097920609 12:65068409-65068431 AGCAAACAGAGCAAGAAAGGGGG + Intronic
1099890546 12:88584217-88584239 TCCAAACAGAGGCAGAAAGGAGG - Intergenic
1099943230 12:89214948-89214970 AGCTGGCAGAAGCAGAGAGTTGG + Intergenic
1100680331 12:96912497-96912519 TGATAGCAGAGCCAGAAAGAAGG + Intronic
1100891055 12:99126328-99126350 GGATGGCAGAGGAAGAAAGGGGG + Intronic
1102033799 12:109759666-109759688 AGCAGGCAGAGGCAGAGTGGGGG + Intronic
1103381607 12:120497978-120498000 AGCCTGTAGGGGCAGAAAGGAGG - Intronic
1103443749 12:120980823-120980845 AGCTGGGAGAAGCAGAACGGAGG + Intronic
1103743990 12:123109847-123109869 AGCTACCAGAGGCAGAACATCGG + Intronic
1104011773 12:124935868-124935890 CGGTAGCGGAGGCAGAAAGAAGG + Intergenic
1104628867 12:130382382-130382404 AGCCTGCAGAGGCAGCAATGAGG - Intergenic
1104896477 12:132167340-132167362 AGCACGCACAGGCAGAAACGAGG - Intergenic
1105533590 13:21243249-21243271 TGCCAGCAGAGGCTGAGAGGCGG + Intergenic
1106418367 13:29565335-29565357 GGCCAGCAGAGAGAGAAAGGAGG + Intronic
1106763899 13:32894493-32894515 GGGTAGCTGAGGCAGAATGGAGG + Intergenic
1107037893 13:35920014-35920036 ATCTGGCAGTGGCATAAAGGTGG - Intronic
1107708990 13:43134120-43134142 GGTTTGCAGAGGGAGAAAGGAGG + Intergenic
1108343019 13:49516051-49516073 AGCTCCCAGATGCAAAAAGGAGG - Intronic
1110292045 13:73818829-73818851 AGCTAAAAGAGGGAGAAAAGAGG - Intronic
1110312728 13:74069683-74069705 AGGTAACAGAGGCAGAAAATAGG + Intronic
1110519895 13:76463340-76463362 AACTAGCAGAGGCAAAATGGGGG + Intergenic
1112551915 13:100429227-100429249 AGCAAGCAGAGAGAGAAAAGGGG - Intronic
1112939459 13:104843719-104843741 GGCTAGCAGAGGCAGATATGAGG - Intergenic
1113372627 13:109736997-109737019 AGAGAGCAGAGGGAGAAAGAAGG + Intergenic
1115412966 14:33096246-33096268 AATTAGCAATGGCAGAAAGGGGG - Intronic
1117767072 14:59094408-59094430 AGCTTACTGAGGCAGAAAAGTGG - Intergenic
1119520773 14:75283467-75283489 CGCGAGCAGAGGCAGAAGGGCGG - Intergenic
1119769668 14:77212675-77212697 AGCAAGCAGAGGCAGTAATGAGG - Intronic
1119879152 14:78086474-78086496 AGCTTGCAGAGGAAAAAAGGAGG + Intergenic
1120368323 14:83599429-83599451 AGCTAGCAGAGGTATGAACGGGG - Intergenic
1120810191 14:88794954-88794976 AGACAGCCGAGGCACAAAGGTGG + Intergenic
1121658215 14:95614178-95614200 AGTTAGCAGATGCAGGAAGCTGG + Intergenic
1202896045 14_GL000194v1_random:11094-11116 AGCTAGAGGTGGCAGAGAGGGGG - Intergenic
1123796877 15:23781509-23781531 AGCAAGCAGGGTCAGGAAGGGGG - Intergenic
1126175812 15:45734284-45734306 AGCTAGCAGATGCAGATGCGGGG + Intergenic
1128893442 15:71351501-71351523 GGCTAGGAGATGCAGCAAGGTGG - Intronic
1131713508 15:95081369-95081391 AGATAGATGAGGCAGAAAGGTGG + Intergenic
1132588472 16:716187-716209 AGCTGGCAGGGGCAGAGTGGAGG + Intronic
1132833119 16:1939186-1939208 AGCAAGCAGGGGCGGAAAGCCGG + Intronic
1132833479 16:1941174-1941196 GGCAAGCAGAGGGAGGAAGGTGG + Intronic
1133883456 16:9804615-9804637 AGGGAGTGGAGGCAGAAAGGTGG - Intronic
1133978109 16:10614793-10614815 TGCTAGCAGAGGGTGAAGGGTGG + Intergenic
1134368659 16:13603304-13603326 AGCTCCCAGAAGGAGAAAGGAGG - Intergenic
1134457798 16:14407272-14407294 ATCAAGCAGAGGAGGAAAGGAGG - Intergenic
1135073569 16:19373635-19373657 AGAAAGGAGAGGCAGAAAAGTGG + Intergenic
1135619644 16:23944890-23944912 AGCCTGCAAAGGCAGAAAGCAGG - Intronic
1136997649 16:35201786-35201808 AGTTAGCAGAGTCAGAAACAGGG - Intergenic
1137024078 16:35455972-35455994 ACCTAGCAGAGTCAGAAACAGGG - Intergenic
1137321776 16:47391125-47391147 CACAAGCAGAGGCACAAAGGTGG + Intronic
1137507042 16:49063146-49063168 AGCCAGCCAAGGCAGAAGGGTGG + Intergenic
1138160014 16:54744744-54744766 ACCTGGCAGAAGCAGAAAAGGGG + Intergenic
1138434341 16:56988924-56988946 AGGAATCACAGGCAGAAAGGGGG - Intergenic
1139303794 16:65966443-65966465 AGCCATCAGAGGAAGAATGGAGG - Intergenic
1140227725 16:73092204-73092226 AACACGCAGTGGCAGAAAGGTGG - Intergenic
1141352435 16:83310604-83310626 AGTGAGCAAAGGCAGAAAGGTGG - Intronic
1142114261 16:88348216-88348238 AGCCAGAAGAGGCAGGAAGGCGG - Intergenic
1142269158 16:89080137-89080159 AGAAAGCAGAGGGAGGAAGGAGG + Intergenic
1143542485 17:7577932-7577954 TGATAGCAAAGGCAGAAGGGAGG + Intronic
1143996212 17:11008583-11008605 AGTGAGCAGATGCAGACAGGTGG - Intergenic
1144442104 17:15292813-15292835 AGCTAGCGGAGGCAGCAGAGTGG - Intergenic
1145836363 17:27956994-27957016 CGCTAGCAGTGTCAGGAAGGGGG + Intergenic
1146826670 17:36029059-36029081 AGCTAGCAGGGCCTGAAAAGAGG - Intergenic
1147008427 17:37423592-37423614 TGCAAGCAGAGGAAAAAAGGAGG - Exonic
1148051862 17:44773447-44773469 AACTAGCAGAGGCTGGCAGGAGG - Intronic
1148890874 17:50806191-50806213 AGCCAGCTTGGGCAGAAAGGGGG + Intergenic
1149666893 17:58371234-58371256 AGGTAGTGGAGGCAGATAGGAGG + Intronic
1150500975 17:65650490-65650512 AGCAAGCAGAGGCAGCTGGGAGG - Intronic
1150979870 17:70129009-70129031 AGATAGCAGAAGCAGGAAGAGGG - Intronic
1152264314 17:79285239-79285261 ACCTGGCTGGGGCAGAAAGGGGG - Intronic
1152750236 17:82059228-82059250 AGCTGGGAGAGGCAGGAAGTGGG - Intronic
1153886272 18:9470079-9470101 AGATAGGAGAGGGAGAAAAGAGG - Intergenic
1153918405 18:9766295-9766317 AGCTCGCAGATGCAGAGATGAGG - Intronic
1154056369 18:11016365-11016387 AACATCCAGAGGCAGAAAGGAGG + Intronic
1154330168 18:13422902-13422924 AACTAGCAGAGGCGGAAAGCTGG + Intronic
1155313875 18:24551994-24552016 AGCCAGCAGAAGGAGAATGGGGG - Intergenic
1155493048 18:26418495-26418517 AGGCAGAACAGGCAGAAAGGGGG - Intergenic
1156160634 18:34354162-34354184 AGCTTGCAGAGCAAGAATGGGGG - Intergenic
1156828655 18:41464474-41464496 AGCTAACAGAGACAGAAAAATGG + Intergenic
1158755976 18:60326082-60326104 AGGTAGCAGAGGTGGAAATGAGG + Intergenic
1159174166 18:64812934-64812956 AGCTAGCAGAGAAAGGAAGATGG - Intergenic
1159540852 18:69773676-69773698 AGCTGGAAGAGGGAGAAATGAGG + Intronic
1159558398 18:69968638-69968660 AGCTGGCAGAGGCAGGGAGCAGG - Intergenic
1159927578 18:74282594-74282616 TGCTAGCAGAGGCACAAAACGGG + Intronic
1161345694 19:3767826-3767848 AGCCATCAGAGTCAGAAAAGAGG + Intronic
1161404026 19:4081869-4081891 AGGGAGCAGAGGCAAAGAGGAGG - Intergenic
1161421321 19:4177268-4177290 AGCTAGAAGAGCCAGAAAGAAGG - Intronic
1162340616 19:10089626-10089648 AGATAGCAGGGGCAGAAACTGGG - Intronic
1163081414 19:14945986-14946008 AGCTAGGAGGGGCAGTAAGGAGG - Intergenic
1163688114 19:18723827-18723849 AGCTGGCACAGGCAGCAAGGTGG - Intronic
1165826664 19:38709590-38709612 AGCTGGCAGAGCCAGCAAGAAGG + Intronic
1166315800 19:41988748-41988770 AGTCACCAGAGGCAGAAGGGAGG - Intronic
1166481345 19:43176717-43176739 AGCCAGTGGAGGCAGAAAGTGGG + Intronic
1166483817 19:43195841-43195863 AGCCAGTGGAGGCAGAAAGTGGG + Intronic
1166584846 19:43936637-43936659 AGCCAGCAGCGGAAGAAAGCAGG - Intergenic
1166716794 19:44973565-44973587 AGCCAGCAGAGGCTGACAGGAGG + Intronic
1166911328 19:46160394-46160416 AGCTGGGAGAGAAAGAAAGGAGG - Exonic
1167278009 19:48550484-48550506 ACCTAACAGATGCAGGAAGGGGG - Intergenic
1167801692 19:51747066-51747088 AACTGGCAGGGGCAGAAATGAGG - Intronic
925069868 2:957780-957802 AGCTAGAGGAGGCAGGAAGGAGG + Intronic
927361433 2:22239043-22239065 AGCTAGCATAGACAGAGAGATGG + Intergenic
927752760 2:25684757-25684779 AGCTGAGAGTGGCAGAAAGGAGG + Intergenic
928090134 2:28368867-28368889 AGCTGGAAGGGACAGAAAGGAGG - Intergenic
928458972 2:31451487-31451509 AGCAAGCATAGGCAGTAATGAGG + Intergenic
928737795 2:34312765-34312787 ATCTTGCAGTGGCAGAAAGCAGG + Intergenic
929432149 2:41896359-41896381 AGGTAGCAGAGACAGAAAACAGG + Intergenic
932321358 2:70824100-70824122 AGCCAGGAGAGGGAGAGAGGCGG + Intergenic
932615051 2:73226450-73226472 AGCAAGCAGAGGCGGGCAGGAGG + Exonic
933797349 2:85930268-85930290 AGCTAAGAGAGGCAGAAATGAGG - Intergenic
934732008 2:96665326-96665348 AGCTACTAGAAGCAGCAAGGAGG - Intergenic
935182963 2:100706485-100706507 AGCGGGCACAGGGAGAAAGGCGG + Intergenic
935730701 2:106062941-106062963 ACTTAGCAGCGGGAGAAAGGAGG + Intergenic
937273809 2:120671682-120671704 AGACAGCAGAGGCAGGAAGCAGG - Intergenic
937400188 2:121575743-121575765 GGTGAGGAGAGGCAGAAAGGAGG + Intronic
939428721 2:142074610-142074632 AGCCAGTAGAGGCAAAAGGGTGG - Intronic
939552173 2:143628528-143628550 AGCTACCTGAGGCAGATGGGTGG - Intronic
943538545 2:189182943-189182965 TACTAGCAGAAGAAGAAAGGTGG - Intergenic
943757451 2:191571365-191571387 AACAAGCAGAGGAAGAAAGAAGG - Intergenic
944183584 2:196924197-196924219 AGCCAGCAGAAATAGAAAGGTGG - Intronic
944913710 2:204335854-204335876 AGCCAGCAGAGACAGAGAGCAGG - Intergenic
946843237 2:223837760-223837782 ACAGAGGAGAGGCAGAAAGGAGG - Intronic
946937611 2:224737803-224737825 AGTTTGCAGAGGGAGAAAGGAGG + Intergenic
947027136 2:225748886-225748908 ATCTAGCAGAGACAGCAATGAGG + Intergenic
948451538 2:238077766-238077788 AGCTAGCAGGAGCAGGCAGGTGG - Intronic
948961340 2:241340844-241340866 AGCTAGTAGAGGCTGGCAGGAGG - Intronic
1168837660 20:888447-888469 AGCAAGCAGAAGCAGGTAGGGGG + Intronic
1169857194 20:10115779-10115801 AAATAGCAAAGGCAGAGAGGTGG - Intergenic
1170934343 20:20796848-20796870 AAATAGCAGAGGCAGAAAGTGGG + Intergenic
1173927614 20:46792482-46792504 GGCTTGCAGGGGCAGGAAGGAGG - Intergenic
1173975464 20:47183580-47183602 AGCAGCCAGAGGCAGAGAGGGGG - Intronic
1174279874 20:49431666-49431688 GACTAGAAGAGGCAGAAAAGAGG - Intronic
1174386068 20:50189363-50189385 GGCTAGGAGTGGCAGAGAGGTGG + Intergenic
1174397996 20:50259793-50259815 AGACAGGAGAGGAAGAAAGGAGG - Intergenic
1175033535 20:55978167-55978189 AGCTGGGAGAGGAAGAAAAGTGG + Intergenic
1175567997 20:59995980-59996002 AGCTTGCAGATGCAGAAGTGGGG + Exonic
1176615737 21:9027146-9027168 AGCTAGAGGTGGCAGAGAGGGGG - Intergenic
1176709433 21:10136657-10136679 AGCTAGAGGTGGCAGAGAGGGGG + Intergenic
1179273473 21:39869493-39869515 AGCAAGGGGAGGCAGAAAAGTGG - Intronic
1179516694 21:41913453-41913475 ATCCAGCAGAGGCAGGAACGGGG + Intronic
1181416319 22:22762089-22762111 AGGAAGGAGAGGCAGAGAGGGGG - Intronic
1182435139 22:30325707-30325729 AGCTAGCAGACAGAGAAATGTGG - Intronic
1182677828 22:32053715-32053737 AGTCGGAAGAGGCAGAAAGGTGG + Intronic
1185374682 22:50476844-50476866 AGCCAGCTGGGGCAAAAAGGAGG - Intergenic
949931424 3:9081418-9081440 AGGTAGCTGAGGCTCAAAGGGGG - Intronic
950149432 3:10675250-10675272 ACCCAGCAGAGGCACAAAGTGGG - Intronic
952052395 3:29400405-29400427 AGTTACCAGAGGCTGGAAGGAGG + Intronic
953261005 3:41339113-41339135 AGCTACCACAAGCAGAAAGATGG + Intronic
953534678 3:43768726-43768748 AGCTTGGAGAGGCTGAAGGGAGG + Intergenic
954077022 3:48188757-48188779 AGGTAGCGGAGGCCCAAAGGGGG - Intergenic
954873571 3:53785874-53785896 AACTTGCAGAGGCTGGAAGGAGG - Intronic
954932880 3:54299249-54299271 ACATAGCAGAGGCAGGGAGGAGG + Intronic
955156507 3:56421974-56421996 TGCTGGCAGAGGCAGAAATCAGG + Intronic
956034257 3:65073260-65073282 AGCTGGAAGAGGCAAAGAGGGGG + Intergenic
956203923 3:66736672-66736694 ACATAGCAGAGGCAGTAGGGAGG - Intergenic
956727932 3:72171916-72171938 AGCTACCAGAGGGAGGAAAGTGG + Intergenic
957034404 3:75280658-75280680 AGGTTGTAGAGGCAAAAAGGGGG - Intergenic
957651293 3:83008699-83008721 AGGGAGCAGAGGAAGAATGGTGG - Intergenic
959326109 3:104938385-104938407 AACCAGCAGAAGCTGAAAGGGGG + Intergenic
959805021 3:110540749-110540771 AGTTTGCAGTGGGAGAAAGGAGG + Intergenic
960241823 3:115351582-115351604 AGGAAGCAGAAGCAGAAATGAGG - Intergenic
960520385 3:118647667-118647689 AGGTAGAAGAGGAAGAAAGGGGG + Intergenic
961449817 3:126997626-126997648 ATCCAGGAGAGGCGGAAAGGGGG - Intronic
961540354 3:127595226-127595248 GGGTAGGAGAGACAGAAAGGTGG - Intronic
962382057 3:134905884-134905906 AGCTAGCAGATGGGCAAAGGGGG - Intronic
962536550 3:136334281-136334303 TGCAACCAGAGGCAGAAAGTTGG - Intronic
962569988 3:136703355-136703377 AGCAAGCTGAATCAGAAAGGTGG - Intronic
962901208 3:139763456-139763478 AGTGAGCAGAGGCACAAAGATGG - Intergenic
963965122 3:151359631-151359653 GGCTCTGAGAGGCAGAAAGGTGG - Intronic
963986406 3:151599469-151599491 AGATAACAGAGGCAAGAAGGTGG + Intergenic
964695015 3:159497633-159497655 AACAAGCAGAAGCAGAAAGAAGG + Intronic
966902689 3:184498539-184498561 ATCAAGAAGAGGGAGAAAGGAGG - Intronic
967109365 3:186280025-186280047 AGACAGCAGAGGCAGAAGGCAGG - Intronic
967301653 3:188020384-188020406 ATCTAACAGAGGCTGAAAGCAGG + Intergenic
968896933 4:3409805-3409827 AGACAGGGGAGGCAGAAAGGAGG - Intronic
969272598 4:6113019-6113041 AGTTAGCAGAGACAGAAGGGTGG + Intronic
969453274 4:7286921-7286943 AGTCAGCAGAGGCAGAGAGAGGG + Intronic
969828719 4:9778739-9778761 ATAGAGCAGAGGGAGAAAGGAGG + Intronic
970459050 4:16254704-16254726 AGATCTCAGAGACAGAAAGGAGG - Intergenic
971464038 4:26935441-26935463 AGCTTACAGAGTGAGAAAGGAGG + Intronic
971868559 4:32205720-32205742 AGCAAGGAGAGGAAGAAAGATGG - Intergenic
972466871 4:39366100-39366122 GGCTAGCAAAGGCAGAGAAGGGG - Intronic
972739770 4:41878635-41878657 CGCTGGCAGAGGCAGAGCGGAGG - Intergenic
973900717 4:55467753-55467775 AACTAGCATAGGCAGAAAAAAGG - Intronic
975467865 4:74730313-74730335 AGCTAGCAGCGGTAAAAATGTGG + Intergenic
975603291 4:76125808-76125830 AGGGAGAAGAGGGAGAAAGGGGG + Intronic
977555272 4:98481913-98481935 AGCTGGCAGATGCAGAAACCAGG + Intronic
977916669 4:102601837-102601859 AGCAATCAGGGGCAGGAAGGAGG - Intronic
979411858 4:120389065-120389087 AGCTGGCAGAGGCAGGGAGAAGG - Intergenic
981007601 4:139891893-139891915 AGCTGGTAAAGGGAGAAAGGAGG - Intronic
981111610 4:140940911-140940933 AGCTGGCAGTGGCAGAAAGCAGG - Intronic
982448036 4:155517608-155517630 AACTAGCAGAAACAGAAAGTAGG - Intergenic
983565495 4:169146678-169146700 AGAAAGCAGAGGCAGAGAGCAGG + Intronic
985695105 5:1335688-1335710 AGCTAGCAGGGGCAGTAGGGTGG + Intronic
987609885 5:20189642-20189664 AGCTAGCAGAGGCAGAACCAAGG + Intronic
988294010 5:29331004-29331026 AGCTAGAAGAGGGAGAGGGGTGG - Intergenic
988455190 5:31381368-31381390 AGCTAGCAGGGGAAGAAACCAGG + Intergenic
988967496 5:36433959-36433981 AGGTGGGAGAGGTAGAAAGGTGG - Intergenic
989132278 5:38119156-38119178 AGCTAGCAAAGACAGTGAGGAGG + Intergenic
989170590 5:38467890-38467912 AGCTGGAAGAGGCAGGGAGGAGG - Intergenic
989488869 5:42026557-42026579 AGCTAGAGGAGTCAGAAAAGAGG - Intergenic
990091464 5:52056214-52056236 AGATATCAGAAGGAGAAAGGAGG + Intronic
990468565 5:56092054-56092076 AGTTAGCAGAAGGAGAAATGAGG + Intergenic
991043504 5:62198816-62198838 AGTTAGCAAAGACTGAAAGGAGG - Intergenic
991433711 5:66574337-66574359 GGCTAGCAGAGGCAGATGGGTGG + Intergenic
992179548 5:74183206-74183228 CGCCAGGAGAGACAGAAAGGTGG - Intergenic
992831842 5:80601247-80601269 AACTAGCTCAGGCAGAAAAGAGG + Intergenic
993338944 5:86697984-86698006 AGTTAGTGGAGGCAGAAAGCGGG + Intergenic
995470170 5:112492976-112492998 AGCTACCAGATGCAGAAACCTGG - Intergenic
995512219 5:112921459-112921481 AGGTAGGAGAGGCACAATGGTGG - Intronic
996249951 5:121317365-121317387 TGCTAGCAGCAGCAGCAAGGTGG + Intergenic
996656515 5:125943338-125943360 AGGAAGGGGAGGCAGAAAGGAGG + Intergenic
999190640 5:149744359-149744381 ATCTACCAGAGGCAGACACGTGG + Intronic
1000034368 5:157432352-157432374 GGATGGCAGAGGCAGAAAGGTGG - Intronic
1000610975 5:163373958-163373980 GGCTGGCAGAGGGTGAAAGGGGG + Intergenic
1000830797 5:166098768-166098790 AGATAGCAGAGGGGAAAAGGAGG - Intergenic
1001394900 5:171411123-171411145 GGCTAGAATAGGCAGATAGGAGG - Exonic
1001798633 5:174524041-174524063 CCCTAGAAGAGGCAGACAGGAGG - Intergenic
1002161290 5:177315273-177315295 AGATGGCAGAGGCAGGGAGGTGG - Intergenic
1002461417 5:179375815-179375837 AGCCAGGAGAGGGGGAAAGGGGG + Intergenic
1002710029 5:181189952-181189974 AGCGTGGAGAGGCAGAGAGGAGG - Intergenic
1002874837 6:1201671-1201693 AACTTACAGAGGCAGAGAGGAGG - Intergenic
1003455485 6:6277954-6277976 CTCTGGCAGAGGCTGAAAGGTGG - Intronic
1004078236 6:12365232-12365254 AGCTACCCAAGGCAGACAGGAGG - Intergenic
1004741714 6:18468025-18468047 AGCTGGCAGACCAAGAAAGGAGG - Exonic
1006467179 6:34202761-34202783 AGCCTGCAGGGACAGAAAGGGGG + Intergenic
1006779661 6:36623673-36623695 TGCTGGCAGGGGCAGGAAGGAGG + Intergenic
1006833116 6:36980901-36980923 GGGCAGCAGAGGCAGCAAGGTGG + Intronic
1007256300 6:40531602-40531624 TGCTAGCAGAGGGAGGGAGGGGG - Intronic
1007926254 6:45651903-45651925 AGCTAGGATAGGCAGGCAGGAGG - Intronic
1008544825 6:52575738-52575760 AGCAAGCTGACGCAGAAGGGAGG + Intronic
1008765247 6:54904915-54904937 AGAGAGCAGAGAAAGAAAGGAGG + Intronic
1008892352 6:56509300-56509322 AGGTAGCAGAGTCAGTAATGAGG + Intronic
1011158722 6:84364180-84364202 AGGTAGAGCAGGCAGAAAGGAGG + Intergenic
1011618778 6:89222544-89222566 AACGAGCAGATGCAGAACGGGGG - Intronic
1012254959 6:97020897-97020919 AGCTAATAGAGACAGCAAGGTGG - Intronic
1012547140 6:100432883-100432905 AGCAGGCAGAGGCAGCAATGAGG - Intronic
1012643074 6:101646764-101646786 TGCTAGCAGAGACAGAAATGTGG - Intronic
1013363324 6:109415099-109415121 GGGTGGCAGAGGCAGAGAGGTGG + Intronic
1013437209 6:110122516-110122538 GAGTAGCAGAGGCAGAGAGGTGG - Intronic
1015452023 6:133380931-133380953 AGGGAGAAGAGGAAGAAAGGAGG - Intronic
1015631565 6:135236897-135236919 TGTTAGGAGAGGCAGGAAGGCGG - Intergenic
1017235110 6:152110950-152110972 AGGAAGCAGAGGCAGGAAAGGGG - Intronic
1017910838 6:158791577-158791599 AGATAGCAGAGAAAGAAAGGTGG - Intronic
1018363413 6:163095581-163095603 AGCTAGAAGCAGCAGGAAGGAGG - Intronic
1018659067 6:166068298-166068320 AAATAGCAGAGGTACAAAGGCGG + Intergenic
1018816801 6:167338958-167338980 AGCAAGCAGAGAAAGAAAGAGGG - Intronic
1018853199 6:167655855-167655877 AGCTAGAAGGAGGAGAAAGGTGG + Intergenic
1019109037 6:169694996-169695018 GGCCAGCAGAGGGAGAAGGGTGG + Intronic
1019409467 7:900301-900323 GGCAAGCAGAGGCAGAAATGTGG - Intronic
1020457046 7:8385660-8385682 AGATAGGAGAGGCATAAATGAGG - Intergenic
1021064381 7:16155470-16155492 GGGTGGCAGAGGCAGAAGGGAGG - Intronic
1022559808 7:31336522-31336544 CGCTCGGAGAGGGAGAAAGGGGG - Intergenic
1022693351 7:32680378-32680400 AGCCATCAGAGGCTGAGAGGAGG + Intergenic
1023220189 7:37914286-37914308 AGGCAGAAGAGGCAGAAAGTTGG + Intronic
1023322800 7:39017602-39017624 AGGTAGGAGAGGCAGAGAGGTGG - Intronic
1023817998 7:43964916-43964938 AACTTCCAGAGGCAGAAAGCAGG + Intergenic
1023981706 7:45074242-45074264 AGAGAGCAGAGCCAGATAGGGGG - Intronic
1025027025 7:55525014-55525036 AGCGGGAAGAGGCAGAAAGAAGG + Intronic
1028451281 7:90986828-90986850 AGCTATCAGAGGCTGAAAAGTGG - Intronic
1028999201 7:97135333-97135355 AGCTAAGAGAGGCAGGAAGAAGG - Intronic
1029591059 7:101507390-101507412 AGCCAGGAGGGGCAGAAAAGAGG - Intronic
1029742624 7:102499787-102499809 AACTTCCAGAGGCAGAAAGCAGG + Intronic
1029760614 7:102598952-102598974 AACTTCCAGAGGCAGAAAGCAGG + Intronic
1029856256 7:103519911-103519933 AGCTAGCATAGTAAGAAAGAGGG - Intronic
1030488863 7:110206189-110206211 AGCTTCCAGAGGCAGAGAGTAGG - Intergenic
1030887278 7:114953922-114953944 ATCCAGCAGGGGGAGAAAGGTGG - Intronic
1030968889 7:116028608-116028630 TGATAGCAGATCCAGAAAGGTGG - Intronic
1031070076 7:117152385-117152407 AGTTGGCAGAGACAGAAAGCAGG - Intronic
1033499440 7:141933186-141933208 ATCTGGAAGAGGCAGAAAGGAGG + Intronic
1034679879 7:152920493-152920515 AGCTAGGAGGGGAAGAAAGCAGG + Intergenic
1035300430 7:157893805-157893827 AGACAGCACCGGCAGAAAGGAGG + Intronic
1035878841 8:3221665-3221687 AGCTGGCAGAGGTAGAAATAAGG - Intronic
1036190549 8:6665946-6665968 TGGCTGCAGAGGCAGAAAGGGGG - Intergenic
1036499825 8:9303511-9303533 AGCTTACACAGGCAGAAAGGAGG + Intergenic
1037838095 8:22226372-22226394 AGCTAGCAGAGGGAAATGGGGGG + Intronic
1038401563 8:27288129-27288151 TGCAAGCAGAGGCGGAAATGGGG + Intronic
1040050804 8:43011994-43012016 TGCCAGCAGAGGAAGAAATGGGG + Intronic
1041291383 8:56311468-56311490 AGCTGGGAGAGGCAGCAAGAGGG + Intronic
1041640988 8:60201439-60201461 AGCATGCAGAGGATGAAAGGTGG + Intronic
1042586553 8:70345825-70345847 AGCTAGCAGAAGCAGAGCTGAGG + Intronic
1042650919 8:71040230-71040252 GGCCAGCACAGGGAGAAAGGAGG + Intergenic
1042703045 8:71637633-71637655 AGCTGTCAGAGGCAGACAAGTGG - Intergenic
1042852758 8:73233145-73233167 AGACAGAAGAGGAAGAAAGGAGG - Intergenic
1044582821 8:93839102-93839124 AGGTAGAAAAGGAAGAAAGGAGG - Intergenic
1044794704 8:95885125-95885147 AGATAGCAGAGACACAAAGGAGG - Intergenic
1046140889 8:110089886-110089908 TGAGAGAAGAGGCAGAAAGGGGG - Intergenic
1047277881 8:123419430-123419452 AGCTAACAGAAGTAGACAGGAGG - Intronic
1048309199 8:133305348-133305370 AGGGAGCAGAGGAAGAAAGAAGG + Intergenic
1048351034 8:133616713-133616735 AGGAAGCAGAGGCAGGAAGAGGG + Intergenic
1049425478 8:142536143-142536165 AGTTGGCAGAGGCAGAAAGAGGG - Intronic
1050540115 9:6662395-6662417 TGCTCGAAGAGCCAGAAAGGTGG - Intergenic
1051190691 9:14508762-14508784 AACTAGCACAGGCAAAAGGGGGG - Intergenic
1051529143 9:18080069-18080091 GCCTGGCAGAGGCAGAATGGAGG + Intergenic
1051896753 9:21995657-21995679 AGGAAGGAGCGGCAGAAAGGAGG + Intronic
1053646404 9:40122193-40122215 AGCTAGAGGTGGCAGAGAGGGGG + Intergenic
1053759309 9:41341358-41341380 AGCTAGAGGTGGCAGAGAGGGGG - Intergenic
1054327416 9:63720095-63720117 AGCTAGAGGTGGCAGAGAGGGGG + Intergenic
1054538165 9:66253780-66253802 AGCTAGAGGTGGCAGAGAGGGGG - Intergenic
1055370285 9:75591110-75591132 AACTAGGAGAGGCAGAAGGTAGG - Intergenic
1055399205 9:75905410-75905432 GGCAAGCTGAGGCAGAAAGAGGG + Intronic
1056406932 9:86283418-86283440 GGCTAGCAGATGAAGAGAGGAGG + Intergenic
1057742357 9:97722851-97722873 AGCAGGAACAGGCAGAAAGGAGG + Intergenic
1057870496 9:98713361-98713383 ACTTGGCAGAGGCAGCAAGGGGG + Intergenic
1058416723 9:104796329-104796351 GGCTAGCACAGGCAGATTGGTGG + Exonic
1059697742 9:116744830-116744852 AGCTAGCAGAGGCAGAAAGGAGG - Intronic
1059761523 9:117342261-117342283 ATCTAGAAGTGGCAGAATGGGGG - Intronic
1060720921 9:125976805-125976827 AGAAAGGAGAGACAGAAAGGAGG - Intergenic
1060822408 9:126669139-126669161 AGCTGGCATGGGCAGGAAGGTGG + Intronic
1061445233 9:130633773-130633795 AGCAAGCAGCGGGAGGAAGGAGG - Intronic
1061893405 9:133634542-133634564 AGCCAGCAGAGGCAGAGGTGAGG - Intergenic
1062324811 9:136007696-136007718 TGCTGGCAGAGGCAGACAGAGGG + Exonic
1202794192 9_KI270719v1_random:105624-105646 AGCTAGAGGTGGCAGAGAGGGGG + Intergenic
1185603531 X:1354770-1354792 AGAAAGAAGAGGAAGAAAGGAGG + Intronic
1186207226 X:7213485-7213507 AGGTGGCAAAGGCAGACAGGTGG + Intergenic
1186336420 X:8594210-8594232 ACCTAGCAGAGACAGAGAGAGGG + Intronic
1188163802 X:26836184-26836206 AGCTAGGGGAGGAGGAAAGGGGG - Intergenic
1188757596 X:33983042-33983064 GGTTAGCAGAGGCTGAAGGGTGG + Intergenic
1189052948 X:37665491-37665513 TACTAGCAGAATCAGAAAGGTGG - Intronic
1189254695 X:39628920-39628942 AACCTGCAGAGGAAGAAAGGAGG + Intergenic
1189363482 X:40370663-40370685 AGCAACCAGAAGCAGGAAGGTGG + Intergenic
1192611235 X:72569564-72569586 CGCTCTCAGAGGCAGATAGGAGG - Intronic
1193676156 X:84454716-84454738 AGCAAGCATAGGCAGTAACGAGG + Intronic
1195676786 X:107512776-107512798 CACTGGCAGAGGCAGCAAGGGGG - Intergenic
1196049027 X:111285520-111285542 AGCTATCAGAGGCTGAAGGGAGG - Intergenic
1198422904 X:136485742-136485764 ATTTTGCAGAGGCAGAAATGAGG - Intergenic
1199421190 X:147646421-147646443 ACCTTCCAGAGGAAGAAAGGGGG + Intergenic
1199456940 X:148039588-148039610 AGAGAGCATAGGCACAAAGGCGG + Intergenic
1199605991 X:149580039-149580061 AGGTCGCAGAGTCAGAAGGGAGG + Intergenic
1199633130 X:149789329-149789351 AGGTCGCAGAGTCAGAAGGGAGG - Intergenic
1200115487 X:153768069-153768091 AGCATCCAGAGGGAGAAAGGTGG - Intronic
1200131777 X:153852844-153852866 AGCTTGGAGAGGTAAAAAGGTGG - Intergenic
1200235402 X:154465606-154465628 AGCAGGCAGTGGCAGAAAAGTGG - Intronic
1200385962 X:155891154-155891176 AGCTAGCATAGCTAGAAGGGAGG + Intronic
1200775206 Y:7164437-7164459 AGAAAGCAGAGGGAGGAAGGAGG - Intergenic
1201149121 Y:11085801-11085823 AGCTAGAGGTGGCAGAGAGGGGG - Intergenic
1201579042 Y:15492092-15492114 AGGTGGCAAAGGCAGACAGGTGG + Intergenic