ID: 1059697743

View in Genome Browser
Species Human (GRCh38)
Location 9:116744833-116744855
Sequence GACAGCTAGCAGAGGCAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 308}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059697743_1059697747 17 Left 1059697743 9:116744833-116744855 CCTTTCTGCCTCTGCTAGCTGTC 0: 1
1: 0
2: 1
3: 24
4: 308
Right 1059697747 9:116744873-116744895 CTGCTAACTGTGAGACCCACAGG No data
1059697743_1059697748 24 Left 1059697743 9:116744833-116744855 CCTTTCTGCCTCTGCTAGCTGTC 0: 1
1: 0
2: 1
3: 24
4: 308
Right 1059697748 9:116744880-116744902 CTGTGAGACCCACAGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059697743 Original CRISPR GACAGCTAGCAGAGGCAGAA AGG (reversed) Intronic
902090925 1:13902523-13902545 GGCGGCTACCAGAGGCAGGAAGG + Intergenic
902912055 1:19606277-19606299 GACAAATAGGAGAGGCAGAGAGG + Intronic
903660552 1:24974838-24974860 GACAGCTAGCAGAGAGTGTAGGG - Intergenic
903909504 1:26712217-26712239 GACAGCCATCACAGGCAAAAGGG - Intronic
904012804 1:27399454-27399476 GAAAGCTGTCAGAGGCAGAGAGG - Intergenic
904155077 1:28476279-28476301 GAAAGCTATCAGAGTAAGAAAGG + Exonic
905768967 1:40625217-40625239 GAAAGCAAGCAGAGGCAGGTGGG + Exonic
906679190 1:47713639-47713661 GACTGAGAGCAGAGGCAGGATGG + Intergenic
906819347 1:48912964-48912986 GACAGCTAGGATAGGGTGAAAGG + Intronic
907455514 1:54572833-54572855 GACAGCCACCAGAGGCAGTGTGG + Intronic
907629092 1:56062053-56062075 AACAGGTAGCACAGGCAGGAAGG + Intergenic
907862274 1:58364932-58364954 GACAGCAACCAGAGTAAGAAAGG - Intronic
908927306 1:69271166-69271188 GACAGTTAGCAGACTCAAAATGG - Intergenic
909324510 1:74333199-74333221 GCCAGCTAGCAGAGGAATAAAGG - Intronic
912486099 1:110029707-110029729 GACAGCCAGATGAGGAAGAAAGG - Intergenic
913107723 1:115629791-115629813 GACAGAGACCAGAGGCAGGATGG - Intergenic
913469979 1:119177731-119177753 AGCAGCTGGCAGAGGCAGAAAGG + Intergenic
918601346 1:186366208-186366230 GTCAGGTTGCAGAGGTAGAAGGG - Intronic
919275448 1:195409308-195409330 GACAACCAGAGGAGGCAGAAAGG + Intergenic
919307106 1:195856054-195856076 GAACTCTAGCAGAGGCAGCATGG + Intergenic
920059529 1:203217843-203217865 GTCAGCTATCTGAAGCAGAAGGG - Exonic
921126107 1:212179553-212179575 GACAGGGATCAGAGGCAGGATGG - Intergenic
921232157 1:213083817-213083839 GACTGTTAGCATATGCAGAAGGG + Intronic
921452912 1:215330832-215330854 TACTGTTAGCAGAGGAAGAAGGG - Intergenic
922410116 1:225365412-225365434 GACCGATGGCATAGGCAGAAGGG + Intronic
922728485 1:227937677-227937699 GGCAGCTGGCAGAGGCAGGAAGG + Intronic
924204587 1:241698679-241698701 GACAGAAAGAAGAGGAAGAATGG - Intronic
1063611222 10:7563451-7563473 CAGAGCTATCAGTGGCAGAAAGG + Intronic
1064323087 10:14324084-14324106 AACTGCTAGCATTGGCAGAAAGG - Intronic
1067251933 10:44593984-44594006 GACAGTGAGCAGAAGCAGAGTGG + Intergenic
1067274913 10:44825555-44825577 GGCAGGTAGCAGAGGCAGTGTGG + Intergenic
1068461825 10:57339257-57339279 GACATCTAGTGGAGGCAGACCGG - Intergenic
1069849043 10:71393262-71393284 CACAGGCAGCAGAAGCAGAAGGG - Intergenic
1070186292 10:74066010-74066032 AACATCCAGCAGAGGTAGAATGG + Intronic
1072766662 10:98099939-98099961 GGAAGCCAGCAGAAGCAGAATGG - Intergenic
1074398558 10:113121271-113121293 GACAGCTAGGAGAGGAAGGAAGG - Intronic
1074979139 10:118605340-118605362 GACAGCTTGAAGAGACATAAAGG + Intergenic
1075087298 10:119422167-119422189 AACAGCTGGCAGAGGGTGAATGG + Intronic
1077556392 11:3228084-3228106 GACAGCCAGTAGATGCCGAAGGG + Exonic
1077651532 11:3977450-3977472 CACAGCTGGAAGAGGCAGAATGG - Intronic
1077736193 11:4794187-4794209 AAGATCTAGCTGAGGCAGAAGGG + Intronic
1078510948 11:11983567-11983589 GACAGGCTGCAGAGGGAGAAGGG + Intronic
1079036812 11:17027026-17027048 GACAGCTAGGAAAGGAAGGAAGG + Intergenic
1079272408 11:19000517-19000539 GACCCCTAGCAGAGGCAGTGTGG - Intergenic
1080409518 11:32010362-32010384 GACAGCAAGCAGGGGGAAAAGGG - Intronic
1085283555 11:75345839-75345861 GACCGATAGCAGAGGCAAGAAGG + Intronic
1086181168 11:83953495-83953517 GACAGGTGGCAGGGGCAGGATGG - Intronic
1088423020 11:109669509-109669531 GAAAGGTCCCAGAGGCAGAATGG + Intergenic
1089172620 11:116525988-116526010 TCCAGCTTGCAGAGGAAGAAAGG - Intergenic
1089768148 11:120783472-120783494 GAGAGGGAGCAGAGGGAGAAAGG - Intronic
1090036126 11:123251252-123251274 GACAGAGAGGAGAGGCAGATAGG + Intergenic
1091658149 12:2360737-2360759 AACAGCCAGTAGAGACAGAAAGG - Intronic
1092011061 12:5112961-5112983 GACAGCCAGGACACGCAGAAGGG + Intergenic
1098251277 12:68571955-68571977 TCTAGCTAGCAGAAGCAGAAAGG - Intergenic
1099929765 12:89059881-89059903 GTCAGATCGCTGAGGCAGAAAGG + Intergenic
1101365017 12:104063572-104063594 GACTGCTACCAGAGGCAGTATGG + Intronic
1101365022 12:104063611-104063633 GACTGCTATCAGAGGCAGTATGG + Intronic
1106073913 13:26441039-26441061 GACAGAGATCAGAGGCAGAGGGG + Intergenic
1106585100 13:31050318-31050340 TACAGATGGCAGAAGCAGAACGG - Intergenic
1107984435 13:45763277-45763299 TAGAGCTGGCAGAGACAGAAGGG + Intergenic
1108737820 13:53304066-53304088 GACAGCCAGAGGAGGCAGACAGG + Intergenic
1110072873 13:71199946-71199968 TAAAGAAAGCAGAGGCAGAAAGG - Intergenic
1110519892 13:76463337-76463359 TACAACTAGCAGAGGCAAAATGG + Intergenic
1110612948 13:77509262-77509284 GCCAGATACTAGAGGCAGAATGG - Intergenic
1111889070 13:94059359-94059381 GAAAGATAGGAGAAGCAGAAAGG - Intronic
1111993670 13:95141228-95141250 AACAGCCAGCACAGGCTGAAGGG + Intronic
1112132649 13:96540847-96540869 GACAGCTGGCAGCACCAGAATGG + Intronic
1112975529 13:105313327-105313349 GAGAGTTAGCAGAGACATAATGG - Intergenic
1115419290 14:33174803-33174825 GACAGCTGGAAGAGCCAGATGGG + Intronic
1117063785 14:51988967-51988989 GAGAGTTAGGAGAGACAGAATGG + Intergenic
1119571040 14:75672667-75672689 TACAGCAAGCAGAGGTTGAAGGG - Intronic
1121499795 14:94425745-94425767 GAAAGCTAGCAGAGGGACACGGG - Intergenic
1124626190 15:31308732-31308754 GACATCTCAGAGAGGCAGAAGGG + Intergenic
1126663664 15:51056087-51056109 GAGAGCCAGCTGAGGCTGAATGG + Intergenic
1126694694 15:51315973-51315995 GACAGTTAGCAGAACCTGAATGG + Intronic
1127855608 15:62951061-62951083 GACACCTAGCAGAGACTGACAGG - Intergenic
1129166415 15:73780738-73780760 GAGAGCCAGCAGAGGCAGGGGGG + Intergenic
1130033945 15:80341207-80341229 GACAGAGAGCATAGCCAGAACGG - Intergenic
1130756680 15:86771794-86771816 AGCAGCTAAGAGAGGCAGAATGG - Intronic
1133142484 16:3757570-3757592 GACAGGTACCACAGGCAGAGAGG + Intronic
1133514262 16:6492623-6492645 CACAGATTCCAGAGGCAGAAAGG - Intronic
1133725283 16:8531530-8531552 GCAAGATAGCAGAGGTAGAAGGG + Intergenic
1133978108 16:10614790-10614812 GAGTGCTAGCAGAGGGTGAAGGG + Intergenic
1138079251 16:54073125-54073147 GACACGTAGGAGAGGAAGAAAGG - Intronic
1138161231 16:54756682-54756704 GACATCTAGCACAGGCAGCAAGG - Intergenic
1139368013 16:66445709-66445731 GAAAGGTACCAGAGGCAGTAGGG + Intronic
1140427788 16:74875289-74875311 AAAAGCCAGCAGAGGCAGGAGGG - Intronic
1140526338 16:75626067-75626089 GAAAGCTAGAAGGGACAGAAGGG - Intergenic
1141189582 16:81814722-81814744 GACATGAAGCACAGGCAGAATGG + Intronic
1141774810 16:86116144-86116166 GACTGATAGCAGCGGCAGCAAGG - Intergenic
1142262376 16:89049008-89049030 GAGACCTAGCAGAGCCAGACAGG + Intergenic
1143542484 17:7577929-7577951 AACTGATAGCAAAGGCAGAAGGG + Intronic
1143730542 17:8880434-8880456 AACAGCTATCAGAGAGAGAAGGG - Exonic
1146249236 17:31323659-31323681 GACAGCTAGTCTAGCCAGAATGG - Intronic
1147129769 17:38400319-38400341 GACAGCTGGCAGAAGCAATAGGG - Exonic
1149853271 17:60054474-60054496 TACACCTAGCAAAGCCAGAAGGG + Intronic
1151585677 17:75006967-75006989 GACAGATATCTGAGGAAGAATGG - Intergenic
1151704007 17:75757352-75757374 GGGAGCTAGCAGAGGGAGAAGGG + Intronic
1152113184 17:78368598-78368620 GAGAGCTGGCAGAGGCAGGGAGG + Intergenic
1152218231 17:79046807-79046829 GACAGGGAGCAGAGGCAGGCAGG + Intronic
1152530929 17:80918636-80918658 GAAAGCTAGCAGAACTAGAATGG - Intronic
1152580879 17:81165227-81165249 GACAGCTGGGATAGGCAGAGGGG - Intronic
1155171618 18:23270836-23270858 GACAGTTACAATAGGCAGAAGGG + Intronic
1156493161 18:37508332-37508354 GAGAGCGTGCAGAGGCAGGAGGG + Intronic
1156638815 18:39064756-39064778 GATACCTAGGAGAGGCAAAAAGG + Intergenic
1157462346 18:47910584-47910606 CACAGGTAGAAGAGGCAGACTGG - Intronic
1157963218 18:52179753-52179775 GTCGGGGAGCAGAGGCAGAAAGG - Intergenic
1158298402 18:56024909-56024931 GACAGATAGCAGGGAAAGAATGG + Intergenic
1158552921 18:58452133-58452155 GACACCTCTCAGAGACAGAATGG - Intergenic
1158634056 18:59140426-59140448 GGCAGGTGGAAGAGGCAGAAAGG + Intronic
1163024042 19:14499308-14499330 GCCAGCTAACACATGCAGAAGGG + Intergenic
1164049329 19:21570648-21570670 GGCATCTAACAAAGGCAGAAAGG + Intergenic
1166007474 19:39917276-39917298 GACATGTCCCAGAGGCAGAAAGG - Intronic
1166315801 19:41988751-41988773 GAGAGTCACCAGAGGCAGAAGGG - Intronic
1167747935 19:51363802-51363824 GACAGAAAGCAGAGGTAGGAGGG + Intronic
1167980036 19:53267662-53267684 GACAGACATCAGTGGCAGAATGG - Exonic
1167985848 19:53315118-53315140 GACAGACATCAGTGGCAGAATGG + Intergenic
1168563517 19:57403634-57403656 GACAGGAAGCAGCGGCAGCAGGG + Intronic
927380558 2:22475274-22475296 GGCAGCAAGCAAAGACAGAATGG - Intergenic
927882726 2:26699988-26700010 CACAGCTAGCGGTGGCAGATGGG + Intronic
928393613 2:30927780-30927802 GCTAGCTAGGAGAGGCAGCAGGG + Intronic
928596070 2:32860300-32860322 GGCAGCTACCAGAGGCAGTGAGG - Intergenic
928732082 2:34243037-34243059 GACAGCTGGCATTTGCAGAAAGG + Intergenic
930624886 2:53685995-53686017 GACAGATAGAAGAGGCAAGAGGG + Intronic
931708925 2:64970700-64970722 GACATCCAGCAGAGGAAGACAGG + Intergenic
932300814 2:70665753-70665775 TTTAGATAGCAGAGGCAGAAAGG - Intronic
932830020 2:74980319-74980341 GGCAGCATGCTGAGGCAGAAGGG + Intergenic
933606991 2:84393629-84393651 CACAGACAGCAGAGGCAGAGTGG - Intergenic
934659683 2:96136610-96136632 GTCAGCTCACAGAGGAAGAAGGG + Intronic
935434014 2:103008721-103008743 GACGGGGAGCAGAGGCAGCAAGG - Intergenic
936838558 2:116740416-116740438 AAAAGCAAGCTGAGGCAGAAAGG + Intergenic
937628146 2:124067363-124067385 GGCAGCTTCCAGAGCCAGAAGGG - Intronic
938449123 2:131400686-131400708 GACAGAAACCAGAGGCAGCAAGG - Intergenic
938784144 2:134610037-134610059 GACCCCTGGCAGAAGCAGAAAGG + Intronic
940328683 2:152452331-152452353 AAATGCTAGCAGAGGCAGGAAGG - Intronic
942789633 2:179745484-179745506 AACAGCTAGCACAGAAAGAAAGG + Intronic
943022225 2:182589167-182589189 GAAAGATAGCAGAGGAAGAAGGG + Intergenic
946226001 2:218264452-218264474 GTCTGCCAGCAGAGGCAGTAGGG - Exonic
946937610 2:224737800-224737822 GAAAGTTTGCAGAGGGAGAAAGG + Intergenic
948732750 2:239977443-239977465 GACACCTAGAAGAGGCAGCCAGG + Intronic
1169431904 20:5544007-5544029 GAGAGCGAGCCTAGGCAGAAAGG + Intergenic
1170000666 20:11609799-11609821 GACTTAGAGCAGAGGCAGAATGG + Intergenic
1172393408 20:34581932-34581954 CAGAGCTGGCAGAGGCAGAGGGG - Intronic
1172936384 20:38623419-38623441 AACAGCCAGCAGAGCCAGCAGGG - Exonic
1174743243 20:53037226-53037248 CTCAGGAAGCAGAGGCAGAAAGG + Intronic
1175107732 20:56626801-56626823 GACAGCCGGCACCGGCAGAAGGG - Intergenic
1175574302 20:60049240-60049262 GGCAGATAGAAAAGGCAGAAAGG - Intergenic
1176423816 21:6535531-6535553 CACAGCTGCCAGAGGCAGGATGG - Intergenic
1176889441 21:14296433-14296455 GAGAGATAGTAAAGGCAGAAGGG + Intergenic
1178743530 21:35225978-35226000 CACAGCTAGTGAAGGCAGAATGG + Intronic
1179699309 21:43143846-43143868 CACAGCTGCCAGAGGCAGGATGG - Intergenic
1180151995 21:45953404-45953426 GGCATCTAACAAAGGCAGAAAGG + Intergenic
1181681930 22:24501440-24501462 GACAGACAGCAGAGGAAGAGTGG + Intronic
1183327033 22:37199868-37199890 GGCAGCTGCCAGAGGGAGAACGG - Intergenic
1183366887 22:37411571-37411593 CACAGCAAGCGGAGGCAGGAAGG + Intronic
1183454386 22:37913833-37913855 GACCGACAGCAGAGGCAGGAGGG - Intronic
1184092510 22:42299919-42299941 GAAAGGGAGCAGAGGAAGAAAGG + Intronic
1184273481 22:43397776-43397798 GGCAGGTGGCAGAGTCAGAACGG + Intergenic
1184572529 22:45335127-45335149 GCCAGCTGGCAAAGGCAGCATGG - Intronic
1184992088 22:48177536-48177558 GACTTCTGGCAGAGGCAGGATGG - Intergenic
1185262924 22:49880212-49880234 AACAGCAAGCAGGGTCAGAAGGG - Intronic
949113953 3:296999-297021 GACAGATAGGAGAGGTACAAAGG + Intronic
950142386 3:10624354-10624376 GAGAGCTGGAAGAGGCAGAGGGG - Intronic
952215197 3:31271434-31271456 GGCTGCAAGCAGAGGCAGAAAGG + Intergenic
952332741 3:32379581-32379603 GAGAGCTGGCACAGGCTGAAGGG + Intergenic
952453480 3:33452057-33452079 AGCAGCTGGCAGAGGCAGCAAGG + Intergenic
953355718 3:42254822-42254844 GACAGCTAGCAGGAAAAGAATGG + Intergenic
953900122 3:46835285-46835307 GACAGGTAGCCGAGGGAGAGAGG + Intergenic
954367922 3:50155899-50155921 GAGAGAGAGCTGAGGCAGAAGGG - Intronic
955314413 3:57924117-57924139 GACATCTAGCATAATCAGAATGG + Intronic
955316700 3:57945248-57945270 GACTGTTAGCACAGGCAGCAAGG - Intergenic
956203924 3:66736675-66736697 GTCACATAGCAGAGGCAGTAGGG - Intergenic
956587988 3:70884337-70884359 GAGGGCCAGCAGAGGCAGCACGG - Intergenic
956626618 3:71273090-71273112 TACAACGAGCAGAGGCAGTAAGG + Intronic
957128224 3:76190087-76190109 GAAAGCTAGCAGAGGCATGGAGG - Intronic
957231542 3:77523770-77523792 CACAGTTAGCAGTGGGAGAAAGG - Intronic
957512157 3:81203046-81203068 GAGAGCGAGCAGAGGGAGAGAGG + Intergenic
959058161 3:101589107-101589129 GACAGTTAATAGATGCAGAAAGG - Intronic
959601351 3:108190013-108190035 CAGAGGTGGCAGAGGCAGAAGGG + Intronic
959984935 3:112561845-112561867 GACAGCTCGCAGAGGGCGAGGGG - Exonic
960100224 3:113734291-113734313 GACTACTAGAAGAGGGAGAAGGG + Intronic
960813563 3:121649652-121649674 GACAGCTAGAAGAGATAGAGAGG + Intronic
961707021 3:128795128-128795150 AACAGCTTGCAGGGGCAGGATGG + Intronic
962283073 3:134066577-134066599 GAGAGCTGACAGAGGCATAAGGG + Intronic
962422734 3:135242295-135242317 GACAGCTAAAAGAGAAAGAATGG + Intronic
963087790 3:141454592-141454614 GCCTGCTAGGAGAGGCAAAAGGG + Intergenic
964282320 3:155080013-155080035 GAGAGCGAGCTGAGGGAGAAAGG + Intronic
964950040 3:162279452-162279474 GAGAGCATGCTGAGGCAGAAAGG + Intergenic
965703015 3:171477758-171477780 GACTGCTAGAAGAGGGAGAGAGG + Intergenic
966041664 3:175498126-175498148 TACAGATAGCACAGTCAGAAAGG + Intronic
966910896 3:184559432-184559454 GTCTGATAGCAGAGGCAGCAGGG - Intronic
967159545 3:186723431-186723453 GACAGATACCAGAGGCTGAGCGG - Intronic
967330722 3:188286716-188286738 GACAGCAAGCAAAAACAGAATGG - Intronic
967537479 3:190623630-190623652 GACGGCTAGCAGAGGGAGAAGGG - Intronic
968751248 4:2390216-2390238 GGCAGCTACCAGAGGCTGCAGGG + Intronic
968898198 4:3417442-3417464 GACAGCGAGAAGAAGCGGAAAGG + Exonic
971016557 4:22495168-22495190 GGCAGGTAGCAGAGACAGCATGG + Intronic
971810141 4:31414362-31414384 GACAGCAAGAACAGGCAGGAAGG - Intergenic
972452484 4:39216474-39216496 CTTAGCTAACAGAGGCAGAAGGG - Intronic
973671260 4:53220124-53220146 GAAAGCTATCAGATACAGAATGG - Intronic
978311408 4:107388156-107388178 GGCATGTAGCAAAGGCAGAAAGG - Intergenic
979485196 4:121262811-121262833 ACCAGCTGGCAGAGGCACAAGGG + Intergenic
981657650 4:147130321-147130343 GATAGTTAGTAGAGGCAGCAAGG + Intergenic
981663454 4:147194777-147194799 CAAAGCCAGCAGAGGCAGAAAGG - Intergenic
982926182 4:161339622-161339644 GACAGGAAGTAGAGGGAGAAAGG - Intergenic
983179366 4:164630281-164630303 GAGGGCTAGCAGAAGCAGAGTGG + Intergenic
984949635 4:184997361-184997383 GAGAGGAAGCACAGGCAGAAAGG + Intergenic
985641404 5:1065035-1065057 GACAGCGAGGGGAGGCAGAGGGG + Intronic
985695104 5:1335685-1335707 CAAAGCTAGCAGGGGCAGTAGGG + Intronic
987071142 5:14338146-14338168 AAGAGCTAGCAGAGGCTGGAGGG - Intronic
987075664 5:14379845-14379867 GACAGTGAACAGAAGCAGAACGG - Intronic
987865360 5:23528927-23528949 GGCATCTAACAAAGGCAGAAAGG + Intergenic
989081976 5:37631920-37631942 GAGAGCCAGGAGAGGCAGAGGGG + Intronic
990380456 5:55217717-55217739 GACAAGAAGCAGAGGCCGAAAGG + Intergenic
992055213 5:72982205-72982227 GAGAGCGAGCAGAAGCAGGACGG - Intronic
992439309 5:76784264-76784286 GACAGATAGCAGATCCTGAAAGG - Intergenic
992442412 5:76808500-76808522 GAGAGGAAGCAGAGGCAGAGGGG - Intergenic
994302722 5:98165079-98165101 GAAAGGAAGCAGAAGCAGAAGGG - Intergenic
994467350 5:100154771-100154793 GACTGCTAGAAGTGGCAAAAAGG + Intergenic
994844769 5:104974527-104974549 GAAAAATAGCAGAGGAAGAAAGG + Intergenic
995014974 5:107299709-107299731 GCCAGGAAGCAGAGGAAGAAGGG + Intergenic
996511573 5:124322493-124322515 GAAAAATAGCAGAAGCAGAAAGG + Intergenic
997639397 5:135438798-135438820 GACAGCTGGCTGAGGGAGACAGG + Intergenic
997836539 5:137198444-137198466 AACAGCTATCAAAGGGAGAAAGG + Intronic
997941023 5:138157587-138157609 GAAAGGTAGGAGAGTCAGAATGG + Intronic
997977654 5:138449735-138449757 GAGAGCTGGCAGAGGCTGGATGG - Intergenic
998155404 5:139783923-139783945 AAGAGCTAGCAGAAGGAGAAAGG - Intergenic
998209200 5:140181393-140181415 CAAAGTTAGCAGAGCCAGAAGGG - Intronic
1001634430 5:173199551-173199573 GGCAGGTGGCAGAGGCAGGATGG + Intergenic
1003072635 6:2957103-2957125 GGCAGCTGGCAGAGGCTGGACGG + Intronic
1003794630 6:9587150-9587172 GTTTGATAGCAGAGGCAGAAAGG + Intergenic
1003890062 6:10556125-10556147 AACAGCTAGCAGATGCAAACGGG + Intronic
1004020660 6:11773368-11773390 GACATCTATGAGAGGCAAAAAGG + Intronic
1004068969 6:12279274-12279296 TACAGGTAGCAGAGGCAGAGAGG + Intergenic
1005212213 6:23479820-23479842 GAAAGCTAGGAAAGGAAGAAGGG - Intergenic
1005839286 6:29730916-29730938 GGCAGGTAGCAGAGACAGGATGG - Intronic
1007150742 6:39688288-39688310 GACAGACAGCAGATGGAGAAGGG + Intronic
1007415423 6:41688733-41688755 TACAGCTAGCAGGGGCAGCGAGG - Intronic
1007720495 6:43882350-43882372 GAATTCAAGCAGAGGCAGAAAGG + Intergenic
1007815916 6:44525497-44525519 GGAAGCAAGCAGAGCCAGAAAGG - Intergenic
1007829706 6:44629057-44629079 AACAGCTCTGAGAGGCAGAAAGG - Intergenic
1007855826 6:44855849-44855871 GACAGCTTGAGGAGGCATAATGG - Intronic
1007926255 6:45651906-45651928 GACAGCTAGGATAGGCAGGCAGG - Intronic
1008173945 6:48243121-48243143 GACAGTTACCAAAGGAAGAAAGG - Intergenic
1009669036 6:66721535-66721557 GAAATTCAGCAGAGGCAGAAAGG + Intergenic
1009669040 6:66721586-66721608 GAAATTCAGCAGAGGCAGAAAGG + Intergenic
1009749656 6:67867725-67867747 GACAGCCAGCAAAGGGAGATAGG + Intergenic
1010025921 6:71216627-71216649 GATAGTTGGCAGAGACAGAAAGG - Intergenic
1010289891 6:74123196-74123218 GATAGGAAGCAGAGGCACAAGGG - Intergenic
1015550596 6:134408639-134408661 TCCAGCTAGCATAAGCAGAATGG + Intergenic
1015855046 6:137615337-137615359 AACAGCTAGTAAAGGCAGAAAGG - Intergenic
1016074043 6:139775362-139775384 CACACATAGCAGAGGCAGAGTGG + Intergenic
1018096882 6:160395365-160395387 GTTAGCTAGCAGAGGCAAACAGG - Intronic
1019065523 6:169292817-169292839 GTCACCTAGCAGAGGGAGATTGG - Intergenic
1019239222 6:170650654-170650676 AACAGCTGAGAGAGGCAGAAAGG + Intergenic
1020707688 7:11566304-11566326 GAGAGGTAGGAGAGACAGAAAGG + Intronic
1022537220 7:31105713-31105735 GACAGACAAGAGAGGCAGAAAGG + Intronic
1022704272 7:32788089-32788111 GACACCCAGAAGAGGCAGCAGGG + Intergenic
1022908452 7:34877831-34877853 GACACCCAGAAGAGGCAGCAGGG + Intronic
1026546493 7:71327618-71327640 GACAGGTAGCACACTCAGAAGGG + Intronic
1026569473 7:71516758-71516780 GACAGGGAGCATGGGCAGAATGG - Intronic
1029197953 7:98819607-98819629 GACATCTAACAAAGGCAAAAAGG + Intergenic
1029728985 7:102426917-102426939 GTGAGCTGGCAGAGGCAGGAAGG - Intergenic
1029993513 7:104984188-104984210 GGCCGCTAGGAGGGGCAGAAGGG - Intergenic
1031824917 7:126552075-126552097 GACAGCTAGGAATGGAAGAATGG - Intronic
1032204118 7:129846834-129846856 GACAGGTAGTAGAAGGAGAAAGG - Intronic
1032308707 7:130761228-130761250 GACAGCCATCAGAGGCCGGAAGG - Intergenic
1032512178 7:132480940-132480962 GGCAGCCAGCTGAGGCTGAATGG + Intronic
1033733355 7:144199247-144199269 GGCAAAAAGCAGAGGCAGAAAGG - Intergenic
1033749697 7:144351726-144351748 GGCAAAAAGCAGAGGCAGAAAGG + Intergenic
1033799310 7:144881419-144881441 GACAGAGGGGAGAGGCAGAATGG - Intergenic
1034604304 7:152296541-152296563 GATAGCATTCAGAGGCAGAAAGG - Intronic
1035214829 7:157357749-157357771 TAGAGCTGGCAGAAGCAGAATGG + Intronic
1037032600 8:14127234-14127256 CACAGCTATCAGTGGCAGAACGG - Intronic
1037745420 8:21640182-21640204 CACAGCTAGCAGCAGCAGAACGG - Intergenic
1039101115 8:33943101-33943123 GAAAACTAGCTGTGGCAGAAAGG + Intergenic
1040622814 8:49108587-49108609 GACAGATAGCAGACCCTGAAGGG + Intergenic
1041584044 8:59495387-59495409 GACAGTTAGCAGAAGCAGGGTGG - Intergenic
1042110836 8:65379781-65379803 GAGAGCAAGCAGAAGCAGAGTGG + Intergenic
1045476765 8:102559633-102559655 GACAGCTAGCACTAGCAGAAAGG - Intronic
1047161019 8:122379430-122379452 GTCAGCTTGGAGAGGGAGAACGG + Intergenic
1048230759 8:132638620-132638642 GTCACCTAGCAGAGAGAGAATGG + Intronic
1049054482 8:140224782-140224804 GACAGCTAGGGGAGGCATTATGG - Intronic
1049243049 8:141548498-141548520 GACAGCTGGCAGAGGGAGAGTGG - Intergenic
1049244814 8:141556644-141556666 GGCAGCTGGAAGAGGCAGGAAGG - Intergenic
1049539509 8:143201533-143201555 TGCAGCTAGCACTGGCAGAAGGG + Intergenic
1049584191 8:143425424-143425446 GACAGCAGGGAGAGGCTGAAGGG - Intronic
1049729633 8:144169381-144169403 GACAGCTGACAGAGGAAGAAAGG - Intronic
1049931070 9:457262-457284 CACATCTAGTTGAGGCAGAATGG - Intronic
1050616800 9:7409688-7409710 GACAACTAGCAGAGGAACAAAGG - Intergenic
1050814948 9:9798579-9798601 GAAAAATAGCAGAAGCAGAAAGG - Intronic
1052276613 9:26683621-26683643 GACAACTAGCAGAGGGAGGAAGG - Intergenic
1052999721 9:34571306-34571328 GACAGATGGCAGAGGCAGTGGGG - Intronic
1053342925 9:37353866-37353888 GCAAGATGGCAGAGGCAGAAAGG + Intronic
1054880711 9:70142000-70142022 GAGAAATAGCAGAGGCAGGAAGG - Intronic
1054971751 9:71095884-71095906 GATAGCTACCAGAGACAGAGTGG + Intronic
1056094074 9:83233003-83233025 GAGCCCTAACAGAGGCAGAATGG - Intergenic
1058041929 9:100312203-100312225 GGCAGCAAGGGGAGGCAGAAGGG - Intronic
1058219563 9:102280546-102280568 GACAAATAGCAGATGCAGGAAGG + Intergenic
1059697743 9:116744833-116744855 GACAGCTAGCAGAGGCAGAAAGG - Intronic
1059800085 9:117741458-117741480 GAGAGGTAGCAGAGGCAGGCTGG - Intergenic
1061023911 9:128035111-128035133 CACAGCTTGCCCAGGCAGAATGG + Intergenic
1061875715 9:133542692-133542714 CACAGCCACAAGAGGCAGAACGG + Intronic
1203732407 Un_GL000216v2:102691-102713 GGCAGCAAGCAGAGGAAGACAGG + Intergenic
1203599877 Un_KI270748v1:1717-1739 AACAGCTGAGAGAGGCAGAAAGG + Intergenic
1185680393 X:1884242-1884264 AGGAGCTGGCAGAGGCAGAAAGG - Intergenic
1186842946 X:13503451-13503473 AATGGCTACCAGAGGCAGAAGGG - Intergenic
1188177420 X:27008745-27008767 GACAGTGAGCAGAAGCAGCAGGG + Intergenic
1188820432 X:34768209-34768231 GACTGCTAGTAGAAGTAGAATGG + Intergenic
1189206943 X:39249046-39249068 GACAGAAAGAAGAGGCAGAGAGG - Intergenic
1190657337 X:52623784-52623806 CAAAACTAGCAGGGGCAGAATGG - Intergenic
1192030171 X:67502331-67502353 GACTACTAGAAGAGGGAGAAAGG - Intergenic
1193699213 X:84742376-84742398 GACATCAAACAGAGACAGAAAGG + Intergenic
1194236685 X:91392984-91393006 GAGAGATAGAAGAGGCTGAAGGG - Intergenic
1194258306 X:91662401-91662423 GAAAGGTGGAAGAGGCAGAAGGG + Intergenic
1194691022 X:96984805-96984827 CACAGATAGCATAGACAGAAAGG + Intronic
1195435996 X:104843688-104843710 GAGAGCAAGCAGAAGCAGGATGG - Intronic
1195565393 X:106333855-106333877 GAGAAATAGCAGAGGCAGAAAGG - Intergenic
1195706836 X:107743326-107743348 AACAGACAGCAGAGCCAGAAGGG + Intronic
1195766057 X:108298108-108298130 AACAGTTGGCAGAGCCAGAAGGG - Intronic
1196049028 X:111285523-111285545 GGCAGCTATCAGAGGCTGAAGGG - Intergenic
1197319027 X:125005727-125005749 GAGAGCGAGCAGAAGCAGGATGG + Intergenic
1197487282 X:127068726-127068748 GATAGTTACCAGAGGCAGGAAGG - Intergenic
1197494202 X:127157054-127157076 TTCAGCTTCCAGAGGCAGAATGG - Intergenic
1198100945 X:133421243-133421265 GCCAGCAATCAGAGGCTGAAGGG - Intergenic
1198724470 X:139662811-139662833 GACAGATAACAGAGACTGAAAGG - Intronic
1199004206 X:142675665-142675687 GACGGCTAGCAGAAGCAGGGTGG - Intergenic
1199605990 X:149580036-149580058 GTCAGGTCGCAGAGTCAGAAGGG + Intergenic
1199633131 X:149789332-149789354 GTCAGGTCGCAGAGTCAGAAGGG - Intergenic
1199818511 X:151421744-151421766 GACAGCTAGAAGACACAGATGGG - Intergenic
1199830608 X:151545915-151545937 GAGAGCAAGCAGAAGCAGAGTGG + Intergenic
1199860199 X:151794560-151794582 TAGAGCCAGCAGAGCCAGAAAGG - Intergenic
1200577076 Y:4901907-4901929 GAAAGGTGGAAGAGGCAGAAGGG + Intergenic
1200797129 Y:7351145-7351167 AGGAGCTGGCAGAGGCAGAAAGG - Intergenic