ID: 1059697744

View in Genome Browser
Species Human (GRCh38)
Location 9:116744841-116744863
Sequence GGTGGACTGACAGCTAGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059697744_1059697748 16 Left 1059697744 9:116744841-116744863 CCTCTGCTAGCTGTCAGTCCACC 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1059697748 9:116744880-116744902 CTGTGAGACCCACAGGAAGATGG No data
1059697744_1059697747 9 Left 1059697744 9:116744841-116744863 CCTCTGCTAGCTGTCAGTCCACC 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1059697747 9:116744873-116744895 CTGCTAACTGTGAGACCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059697744 Original CRISPR GGTGGACTGACAGCTAGCAG AGG (reversed) Intronic
900534783 1:3171484-3171506 GGTGCTCTGGCAGCTGGCAGAGG + Intronic
900603673 1:3514568-3514590 CGTGGGCTATCAGCTAGCAGCGG - Exonic
900949945 1:5852944-5852966 CGTGGACTGTCAGGCAGCAGAGG + Intergenic
901002273 1:6154713-6154735 GGGGGGCTGACGGCTAGCGGAGG + Exonic
902481747 1:16715687-16715709 GGTGAACTGACAGACACCAGGGG + Intergenic
902619031 1:17639890-17639912 GGTGGAGTCACAGCCTGCAGAGG + Intronic
902983860 1:20143582-20143604 GGTGGACTGGTAGGTACCAGAGG + Exonic
907620827 1:55977540-55977562 AGTGGAATGACAGATATCAGAGG + Intergenic
910119723 1:83773399-83773421 GTTGGAACGACAGCTAGCAGCGG + Intergenic
910701000 1:90074063-90074085 GGTGTACTGACTGATAGCACAGG - Intergenic
911328073 1:96492816-96492838 GGTGGACTGTGAGCTCACAGAGG - Intergenic
911945885 1:104108370-104108392 GATGGAGTGAGAGCGAGCAGGGG - Intergenic
918919191 1:190684827-190684849 AGTGGCATGACAGCTAGCATGGG - Intergenic
923457443 1:234176626-234176648 GGTGGGCTGACAGGGAGCTGAGG + Intronic
1063667130 10:8069498-8069520 GGTGGTCTGACAGTTCGCACAGG - Exonic
1065170170 10:23019042-23019064 TGTGGGCTCTCAGCTAGCAGTGG + Intronic
1065661215 10:28005803-28005825 GGTGGACTGGAAACTATCAGTGG - Intergenic
1068523685 10:58105004-58105026 GATGAACTGATCGCTAGCAGTGG - Intergenic
1069580312 10:69561381-69561403 GGTTGACTGACAGAGACCAGAGG - Intergenic
1070843925 10:79506855-79506877 GGAGGACTGACAGCTACAGGAGG + Intergenic
1071667523 10:87575408-87575430 TGTGGAATAACAGCTAACAGTGG + Intergenic
1072036273 10:91565746-91565768 GGTGGGCTCCCAGCCAGCAGGGG + Intergenic
1073542710 10:104326212-104326234 GGTGGTCTGCCAGCCAGCAGAGG + Intronic
1077041828 11:528213-528235 GGCGGACTCTCAGCTATCAGAGG + Intergenic
1078572729 11:12473532-12473554 AGTGAAGTGACAGCTGGCAGAGG + Intronic
1079138170 11:17788246-17788268 GGTGAGCTGGCAGCTGGCAGAGG + Exonic
1079319496 11:19440204-19440226 GGAGGACAGACAATTAGCAGGGG + Intronic
1082001031 11:47393847-47393869 GGTGGACTGGCCACTACCAGGGG + Intergenic
1087369314 11:97261646-97261668 GTTTAATTGACAGCTAGCAGAGG - Intergenic
1087955877 11:104287551-104287573 GGTGGACTGAGAGGCAGCATTGG + Intergenic
1089055092 11:115578856-115578878 ATGGGACTGAAAGCTAGCAGGGG + Intergenic
1091055386 11:132413373-132413395 GATGGACTGACAGCTGGGAAAGG + Intergenic
1092892464 12:12981443-12981465 GGATAACTGACAGCTATCAGGGG + Intronic
1095313276 12:40726468-40726490 GATGGACTGAGTGCAAGCAGGGG + Intronic
1099917197 12:88909230-88909252 GGTGGAATGAAAGATACCAGAGG - Intergenic
1102247780 12:111366103-111366125 GGTGGCCTGAGAGGTAGGAGCGG - Exonic
1103579549 12:121904118-121904140 GATGGCCTGACCACTAGCAGGGG - Intronic
1103781058 12:123399099-123399121 GGTGGGGTGGCAGCCAGCAGCGG + Intronic
1104419482 12:128623261-128623283 GGGGGACTGAGGGCTAGCACTGG + Intronic
1106562539 13:30859131-30859153 GGAGGTCTGACAGCTAGTACTGG + Intergenic
1108380122 13:49847165-49847187 GGTGGAAAGACATCTAGCTGGGG + Intergenic
1108635674 13:52332424-52332446 GGTGGACAGATAGATACCAGAGG + Intergenic
1108652133 13:52490824-52490846 GGTGGACAGATAGATACCAGAGG - Intergenic
1119199428 14:72741921-72741943 GGTGGGCTGGCAGCAGGCAGTGG - Intronic
1122357782 14:101134325-101134347 GGTGCCCAGACAGCTGGCAGCGG + Intergenic
1123905622 15:24917624-24917646 GGCGCAGTGACCGCTAGCAGGGG + Intronic
1129605671 15:77023867-77023889 GGTGAACTGACAGGAAGCAGAGG + Intronic
1129794527 15:78366101-78366123 AGAGGACTGCCAGCTAGCTGAGG - Intergenic
1131225550 15:90622019-90622041 GGTGGACAGGCAGCCACCAGCGG + Intronic
1131939075 15:97540822-97540844 GGAGGACTGGCAGCTAAGAGTGG + Intergenic
1135759060 16:25121676-25121698 GGTGGAGTGAGTGCTAGGAGGGG + Intronic
1136125324 16:28175292-28175314 GGTGGAATGATGGCTAGCTGGGG - Intronic
1137716370 16:50600848-50600870 GGTGGACAGCCAGCAAGGAGTGG - Intronic
1138092861 16:54190902-54190924 GGAGGACTCACATTTAGCAGGGG + Intergenic
1139668178 16:68472764-68472786 GGTGGCCTGAGAGGTGGCAGAGG - Intergenic
1139876155 16:70147784-70147806 GGTCCACTGATAGCTAACAGTGG - Intronic
1146070583 17:29677324-29677346 TGTAGGCTGACAGCTGGCAGAGG + Intronic
1147621117 17:41867730-41867752 AGTGTACAGACAGCTGGCAGTGG - Exonic
1147980332 17:44270028-44270050 GAAGGACTGACAGCTGGCTGGGG + Intergenic
1149056986 17:52378486-52378508 GGAAGACTGACAGCTATCACAGG - Intergenic
1151191737 17:72403581-72403603 GAGAGACTGACAGCTATCAGGGG - Intergenic
1152064718 17:78104574-78104596 GCTGGACTGCCAGCTGGAAGTGG - Exonic
1157447453 18:47756035-47756057 GGAGAACAGACAGGTAGCAGGGG + Intergenic
1159027323 18:63195837-63195859 GGTGGTCTCACACCTAGAAGTGG + Intronic
1160476738 18:79196930-79196952 GGTGGACAGAAAGGTAGGAGAGG + Intronic
1160586079 18:79914454-79914476 GGTGGTCTGACAGCAGGAAGTGG + Intronic
1162480494 19:10924343-10924365 GATGAACTGACAGCCAGCACTGG - Intronic
1163737063 19:18988073-18988095 GGAGGACTGACTGTGAGCAGAGG + Intergenic
1164857946 19:31539575-31539597 GGAGGACTGTGAGCTGGCAGAGG - Intergenic
1166529771 19:43535255-43535277 GGTGGGCTGCCAGCTTGGAGGGG - Exonic
1166918851 19:46214436-46214458 GGTGGACAGACGGCCACCAGAGG + Intergenic
1168640575 19:58028969-58028991 GGTGTGCTGACAGCCAGCAACGG + Intergenic
1202715786 1_KI270714v1_random:41599-41621 GGTGAACTGACAGACACCAGGGG + Intergenic
928701376 2:33902706-33902728 GTTGTAGTGACAGCTATCAGAGG + Intergenic
933996504 2:87673956-87673978 TGTGGCCTGACACTTAGCAGAGG - Intergenic
935495987 2:103782471-103782493 GGTGGGCAGAGAGATAGCAGAGG + Intergenic
936271981 2:111055884-111055906 GGTGGAGGGAAAGCTAGAAGGGG - Intronic
936297348 2:111276954-111276976 TGTGGCCTGACACTTAGCAGAGG + Intergenic
938173655 2:129104666-129104688 GGTTGACTGACAGGCAGCTGAGG + Intergenic
941683751 2:168426750-168426772 GGTGGACTCAGACCTGGCAGTGG + Intergenic
945732446 2:213555418-213555440 GATGGACTGAGTGCAAGCAGGGG - Intronic
947826305 2:233108037-233108059 GGTGGACTGAGAGGTGGGAGGGG - Intronic
1172174148 20:32962041-32962063 GGAAGACTGACAGACAGCAGGGG - Intergenic
1174862531 20:54104422-54104444 GGGGGAATGCCAGCTGGCAGGGG + Intergenic
1175284680 20:57830215-57830237 AGCGGAGTGACAGGTAGCAGGGG - Intergenic
1179651170 21:42810064-42810086 GGGGGACTGACAGCTCGCTCAGG - Intergenic
1180024009 21:45148287-45148309 GGTGGAGTCACAGCTACCAGTGG + Intronic
1180342240 22:11628406-11628428 GGTGGAGAGACGGCTCGCAGCGG - Intergenic
1181014778 22:20062563-20062585 TGTGGACTTACAGCTGGGAGGGG - Intronic
1181938455 22:26456155-26456177 GGTGGACTGACAGGGAGCCTGGG - Intronic
1182353679 22:29712632-29712654 GGAGGACAGACAGATGGCAGAGG - Intergenic
1182530253 22:30950057-30950079 TGTGGTAAGACAGCTAGCAGAGG + Intronic
1183486022 22:38088204-38088226 GCAGGGCTGGCAGCTAGCAGAGG - Intronic
950134852 3:10573854-10573876 GCTGGGCTGACAGCTCCCAGAGG - Intronic
950176803 3:10880692-10880714 GGTGGACTGAGGGCCAGGAGGGG + Intronic
950390942 3:12696427-12696449 AGAGGACTGCCAGCTAGCACAGG - Intergenic
950679685 3:14576206-14576228 GGTGGGCTGACAGTGAGCACAGG + Intergenic
951488044 3:23236067-23236089 GGTGAACTAGCAGCTAGCAGAGG + Intronic
954843711 3:53535356-53535378 AGTGGAGTGACAGGAAGCAGAGG + Intronic
956799011 3:72740001-72740023 GGTGAAGTGACAGCTTCCAGCGG - Intergenic
957336918 3:78842081-78842103 GATGGCCTGACAGGCAGCAGAGG - Intronic
959984939 3:112561853-112561875 CGAGGACAGACAGCTCGCAGAGG - Exonic
961134054 3:124493938-124493960 GGTGGACTAAAGTCTAGCAGTGG + Intronic
962210969 3:133477242-133477264 GGTTCACTGACAGGTGGCAGGGG + Intergenic
962437218 3:135378274-135378296 GGTGGACTGAGAGGGAACAGAGG - Intergenic
965052201 3:163664842-163664864 GGTGGAGTGAGTGCCAGCAGGGG + Intergenic
965185273 3:165454893-165454915 GGTGGACTGGGAGCCAGAAGGGG + Intergenic
965936674 3:174122455-174122477 GGTGGATTTTCAGCTAGCAGAGG - Intronic
966687166 3:182708632-182708654 ACTGGACTGAGATCTAGCAGAGG - Intergenic
969344387 4:6562208-6562230 GGGGCACTGACAGCTGACAGAGG + Intronic
969535916 4:7756022-7756044 CGGGGCCTGACAGCTAGAAGGGG + Intergenic
975344856 4:73282076-73282098 TCTGGCCTGACAGTTAGCAGTGG + Intergenic
975583799 4:75930382-75930404 GATGAAATGACAGCTAGTAGTGG - Intronic
977033294 4:91915969-91915991 GGTAGAATGATGGCTAGCAGGGG + Intergenic
977794876 4:101152425-101152447 GGTGTACTGACAGCTTTTAGAGG - Intronic
980280209 4:130708485-130708507 GATGGACTGAGTGCAAGCAGGGG + Intergenic
982987903 4:162233444-162233466 GATGGAGTGAAAGCAAGCAGGGG + Intergenic
985491454 5:182097-182119 GGAGGACTGGCTGCTAGAAGAGG - Exonic
986256521 5:6105468-6105490 GGTAGACTCACAGCTAGCAACGG - Intergenic
992396827 5:76376356-76376378 GGTGGACTGAAAGTGTGCAGAGG - Intergenic
995506856 5:112869762-112869784 GATGGAGTGACTGCAAGCAGGGG - Exonic
997839855 5:137229427-137229449 GGGGGCCTGAGAGCTACCAGAGG - Intronic
998808165 5:145938864-145938886 GGTGGACTGATTGATAGCAAAGG + Intronic
1002794875 6:464144-464166 TGGGGGCTGACAGCTGGCAGTGG + Intergenic
1004053384 6:12110537-12110559 GAAAGGCTGACAGCTAGCAGAGG - Intronic
1005430864 6:25755499-25755521 AGTGGACTGATAACTAGCAGAGG + Intronic
1010327226 6:74578351-74578373 TGTGGACAGACAGCAAACAGGGG - Intergenic
1013047921 6:106506268-106506290 GGGGGACTGACAGCTAGAGGTGG - Intergenic
1014781937 6:125574660-125574682 GGTGGACAGACGGCAAACAGCGG + Intergenic
1017384257 6:153864722-153864744 GGTAGAATGACAGATACCAGAGG + Intergenic
1022890006 7:34687514-34687536 GGTGGAGTGAGGGCAAGCAGGGG + Intronic
1029690089 7:102175528-102175550 GGAGGAGTGACAGCTGCCAGGGG - Intronic
1031553813 7:123147198-123147220 GGTGGACTGACAACAATCACTGG - Exonic
1032668536 7:134062754-134062776 AGTAGACTGAGAGATAGCAGTGG + Intronic
1040362138 8:46676051-46676073 AGTAGAATGACAGCTACCAGAGG + Intergenic
1043491825 8:80756851-80756873 GCTGGACTGTAAGCTCGCAGAGG - Intronic
1049243051 8:141548506-141548528 GATGGGGTGACAGCTGGCAGAGG - Intergenic
1050150142 9:2611654-2611676 AGTAGAATGACAGATAGCAGAGG - Intergenic
1050161184 9:2719729-2719751 TGTGGACTCACAGCTAGAGGTGG + Intronic
1051169460 9:14304949-14304971 GATGCACTGGCAGGTAGCAGAGG + Intronic
1057882503 9:98803070-98803092 GGTTGACTGCCAGCTCCCAGTGG - Intergenic
1059697744 9:116744841-116744863 GGTGGACTGACAGCTAGCAGAGG - Intronic
1062160021 9:135075062-135075084 GGGGGAATGACAGCTGGGAGTGG - Intergenic
1062186399 9:135220864-135220886 GGTGGCCTCACAGCTCGTAGAGG - Intergenic
1192340917 X:70262636-70262658 GGTGGAATAAAAGGTAGCAGTGG + Intergenic