ID: 1059697745

View in Genome Browser
Species Human (GRCh38)
Location 9:116744859-116744881
Sequence AGTTAGCAGTTAAGCTGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 187}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059697745_1059697748 -2 Left 1059697745 9:116744859-116744881 CCACCTCAGCTTAACTGCTAACT 0: 1
1: 0
2: 3
3: 10
4: 187
Right 1059697748 9:116744880-116744902 CTGTGAGACCCACAGGAAGATGG No data
1059697745_1059697747 -9 Left 1059697745 9:116744859-116744881 CCACCTCAGCTTAACTGCTAACT 0: 1
1: 0
2: 3
3: 10
4: 187
Right 1059697747 9:116744873-116744895 CTGCTAACTGTGAGACCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059697745 Original CRISPR AGTTAGCAGTTAAGCTGAGG TGG (reversed) Intronic
903253426 1:22073764-22073786 AGTTACCAGGGAGGCTGAGGTGG - Intronic
903893928 1:26589990-26590012 AGTTAGTTGGAAAGCTGAGGTGG + Intergenic
911639616 1:100273724-100273746 AGTGAGCACTTAAGCTGTGCTGG - Intronic
913401834 1:118443697-118443719 AGTTACCTGGGAAGCTGAGGAGG + Intergenic
916931212 1:169579752-169579774 AGATAGCAGAGAAGCTGAGATGG - Intronic
917491030 1:175498653-175498675 AGTTTGAAGTTAAGCAGAGAAGG + Intronic
920747529 1:208643192-208643214 AGTCAGCAGTGAAGCTGAGGTGG - Intergenic
922166213 1:223117426-223117448 AGTGGGCAGTGAGGCTGAGGAGG + Intronic
924673532 1:246152471-246152493 AGTGAGCAGCTAGACTGAGGTGG - Intronic
1063914851 10:10871114-10871136 GGTTCGCAGTCAAGCTGAGCTGG + Intergenic
1065306173 10:24371114-24371136 AGAGAGCAGTCAATCTGAGGTGG + Intronic
1066518332 10:36188428-36188450 AGTGAGAAATGAAGCTGAGGAGG - Intergenic
1066642649 10:37571511-37571533 AGCTAGGAGTACAGCTGAGGGGG + Intergenic
1067088744 10:43256001-43256023 AGAGAGCAGTCAAGCTGAGAGGG - Intronic
1068186763 10:53594827-53594849 AGTTACTAGTGAGGCTGAGGTGG + Intergenic
1070200050 10:74195787-74195809 AGTTACTAGGGAAGCTGAGGTGG - Intronic
1070449760 10:76546306-76546328 AGTTAGGAGATTAGCTGGGGTGG - Intronic
1073117270 10:101098316-101098338 AATGGGCAGATAAGCTGAGGTGG - Intronic
1073296266 10:102440912-102440934 AGTTACTAGGGAAGCTGAGGAGG + Intergenic
1077538999 11:3137930-3137952 AGATAGCTGTGGAGCTGAGGGGG + Intronic
1078138512 11:8672742-8672764 AGTTACCTGTGAGGCTGAGGTGG - Intergenic
1078434379 11:11312267-11312289 TGTTAGCAGTTAAGTTTTGGGGG - Intronic
1078881041 11:15449101-15449123 AGCTAGCAGGTAAGCTGAGGTGG - Intergenic
1085563532 11:77492516-77492538 AGATGGCATTTGAGCTGAGGTGG + Intergenic
1086487988 11:87329013-87329035 AGCTACCAGGGAAGCTGAGGTGG - Intergenic
1087561899 11:99801295-99801317 AGTCTGCAGTTAATCTGATGAGG + Intronic
1087600870 11:100313766-100313788 ATTTAGAAGTTGAGCTGAAGAGG + Intronic
1088217201 11:107524169-107524191 AGTTACTAGGAAAGCTGAGGCGG - Intronic
1089208032 11:116780700-116780722 ACTTAGCTGTTTTGCTGAGGTGG - Intronic
1091238819 11:134039140-134039162 ATTTAGCAGCTAAGCTGTGGAGG - Intergenic
1093532075 12:20177471-20177493 AGAAAGCAGTTACACTGAGGAGG - Intergenic
1094107598 12:26831044-26831066 ATGTAGTAGTTAAGCAGAGGGGG - Intronic
1094480115 12:30874893-30874915 AGATGGCAGTTAAGCTGGAGGGG + Intergenic
1098129262 12:67331659-67331681 AGCTAGTAGGGAAGCTGAGGTGG - Intergenic
1098155764 12:67596791-67596813 AGCTACCAGGGAAGCTGAGGTGG - Intergenic
1100411096 12:94320755-94320777 AGTCAGCTGTTATCCTGAGGGGG + Intronic
1101078446 12:101155597-101155619 AGTTATTAGGGAAGCTGAGGTGG - Exonic
1101707838 12:107237114-107237136 AGTTAGCACTGAAGCTGATAGGG + Intergenic
1102704842 12:114871937-114871959 TGTTAGCAGTTAAGTTTTGGGGG - Intergenic
1103320927 12:120092560-120092582 GGGGAGCTGTTAAGCTGAGGTGG + Intronic
1104123252 12:125819349-125819371 AGTTAGAAGTTAGGATGGGGAGG + Intergenic
1104891432 12:132142062-132142084 ACTCAGCAGGGAAGCTGAGGCGG + Intronic
1106549984 13:30762739-30762761 AGTTAGCTGTTGGGCTGAGCTGG + Intronic
1107301648 13:38972222-38972244 AGTTAGCAGGGAAGCTGGGATGG - Intronic
1108741138 13:53339494-53339516 AGTAGGCAGTGAAGCTGAGGAGG - Intergenic
1110409585 13:75189508-75189530 AGTTGGAAGTTAAGTGGAGGCGG - Intergenic
1110636805 13:77776000-77776022 ACTTAGCAGTTAAGCAGGGCAGG - Intergenic
1112119459 13:96393819-96393841 AGTTAGAAGTAAAGCTGTAGGGG + Intronic
1113859098 13:113469566-113469588 AGTTAGCTGGGAGGCTGAGGTGG + Intronic
1114064451 14:19049597-19049619 AGTTACCTGGGAAGCTGAGGTGG + Intergenic
1114097809 14:19350404-19350426 AGTTACCTGGGAAGCTGAGGTGG - Intergenic
1121557956 14:94852445-94852467 AGTCAGGAGGGAAGCTGAGGTGG + Intergenic
1122604066 14:102936733-102936755 AGCTACTAGTGAAGCTGAGGTGG - Intronic
1126931522 15:53657539-53657561 AGTTATCAGTTAATTTGAAGGGG - Intronic
1127485810 15:59416616-59416638 TGTTAGCAGTAAATCTTAGGAGG - Intronic
1133588915 16:7223591-7223613 AAGAGGCAGTTAAGCTGAGGTGG - Intronic
1137822672 16:51460656-51460678 CTTTAGCAGTTAAGCTGAGGTGG - Intergenic
1140116442 16:72045805-72045827 AGTTACCTGTGAGGCTGAGGTGG + Intronic
1147019090 17:37516752-37516774 AGCTACTAGGTAAGCTGAGGCGG - Exonic
1147789791 17:43006625-43006647 AGTTTGCAGTTGGGGTGAGGTGG + Intergenic
1147982936 17:44286076-44286098 AGCTACCAGGGAAGCTGAGGTGG + Intergenic
1149757879 17:59202919-59202941 AGTTACTTGTGAAGCTGAGGTGG + Intronic
1150518508 17:65840344-65840366 AGTTAGCTGTAAAGGTGTGGTGG - Intronic
1151025976 17:70677634-70677656 TGTGAGCATTTAAGATGAGGAGG + Intergenic
1152124846 17:78440367-78440389 AGTTACCTGTGAGGCTGAGGTGG - Intronic
1152435875 17:80275724-80275746 AGGTTGCAGTTGAGCTGAGATGG - Intronic
1152508893 17:80771930-80771952 AGTTACCAGGGAGGCTGAGGTGG - Intronic
1152689344 17:81710962-81710984 AGTGAGCAGCTAACCAGAGGCGG - Intergenic
1155101029 18:22609903-22609925 GTTTAGCAGTTAATCTCAGGTGG + Intergenic
1155398363 18:25410948-25410970 AGCTACCTGGTAAGCTGAGGCGG - Intergenic
1156568580 18:38224567-38224589 AGCTACCAGGGAAGCTGAGGTGG - Intergenic
1158349671 18:56552190-56552212 AATTAACAGATAAGGTGAGGTGG - Intergenic
1162857518 19:13480506-13480528 TGTTAGTAGTTAAGCTTTGGGGG + Intronic
1166979673 19:46625136-46625158 GGTGAGCAGGCAAGCTGAGGAGG - Intergenic
1167131909 19:47592402-47592424 AGTCAGCAGTTTGGCTGAGATGG - Intergenic
1168330715 19:55566351-55566373 AGCTATCTGGTAAGCTGAGGAGG - Intergenic
925833076 2:7915425-7915447 AGTTCTCAGTAAAGCGGAGGTGG - Intergenic
927581787 2:24257205-24257227 AGCTAGCCGGGAAGCTGAGGTGG + Intronic
930196228 2:48513315-48513337 AGTTACTAGGTAGGCTGAGGTGG - Intronic
930612274 2:53555679-53555701 GGGTAGCAGGTGAGCTGAGGGGG - Intronic
931339118 2:61381449-61381471 AGCTACCAGGGAAGCTGAGGTGG - Intronic
931409642 2:62017093-62017115 ATTTGGCAGTTAATCTGAGCTGG - Intronic
932630882 2:73342332-73342354 ATTTAGCAGTTGATCAGAGGAGG + Intergenic
933062978 2:77760636-77760658 AGCTACCAGGGAAGCTGAGGTGG - Intergenic
935824576 2:106932045-106932067 AGTGAACAGAAAAGCTGAGGAGG - Intergenic
936955158 2:118015165-118015187 AGCTAGCCGGTAGGCTGAGGTGG + Intergenic
938026582 2:127954498-127954520 AGTTTGGAGTTAAGATGAAGTGG + Intronic
938393377 2:130922670-130922692 AGGTAGCTATTTAGCTGAGGGGG + Intronic
941804102 2:169693230-169693252 ATTTAGCAGTGAGGCTCAGGTGG + Intronic
942642676 2:178075956-178075978 AATTAGCAGATAAGCAGAAGAGG - Intronic
944222738 2:197318335-197318357 AGTTACTAGGGAAGCTGAGGCGG + Intergenic
944707480 2:202305735-202305757 TGTTAGCAGTTAAGTTTTGGGGG - Intergenic
946904784 2:224405800-224405822 AGTTAGGAGTGAGGATGAGGAGG + Intergenic
948017167 2:234700157-234700179 GTTGAGGAGTTAAGCTGAGGAGG + Intergenic
1171265106 20:23765291-23765313 ACTTTGCAGTTAAACTGATGGGG - Intergenic
1172062208 20:32194206-32194228 AGGTGGCAGTTAAGGTGAGAAGG + Exonic
1173768350 20:45634784-45634806 AGCTACCAGGGAAGCTGAGGTGG - Intergenic
1177402815 21:20627712-20627734 AGTTACTAGATAGGCTGAGGTGG + Intergenic
1178787986 21:35672201-35672223 AGATAGCCGTTAAGATGAGAAGG - Intronic
1179384265 21:40927677-40927699 AGTTAACAGAAACGCTGAGGTGG - Intergenic
1179596260 21:42444937-42444959 AGTAAGCAGTTTAGATGAGGAGG + Intronic
1180482940 22:15772219-15772241 AGTTACCTGGGAAGCTGAGGTGG + Intergenic
1182745756 22:32604360-32604382 AGTTAGGGGTTGGGCTGAGGAGG - Intronic
1184020550 22:41818415-41818437 AGTTAGCAGTTAAGGTGGTGGGG + Intronic
950715514 3:14845007-14845029 AGTTAGAAGCTGAGCTGAGGTGG - Intronic
953691466 3:45123534-45123556 ATTTATCAGTTAGGATGAGGGGG - Intronic
955212536 3:56955306-56955328 AGCTACCAGGGAAGCTGAGGTGG - Intronic
959685980 3:109146964-109146986 AGTTAACATTTAAACTTAGGAGG - Intergenic
960181966 3:114590385-114590407 AGGTTGCAGTGAAGCTGAGATGG + Intronic
960460397 3:117927557-117927579 AGTCTCCAGTGAAGCTGAGGTGG + Intergenic
961261029 3:125601983-125602005 AGCTACTAGGTAAGCTGAGGAGG + Intergenic
961837231 3:129672485-129672507 AGCTAGTAGGGAAGCTGAGGTGG + Intronic
962938677 3:140105797-140105819 AGCTAGCACATATGCTGAGGAGG - Intronic
963222228 3:142825345-142825367 AGATGACAGTTAAGATGAGGAGG - Intronic
964728196 3:159837354-159837376 AGGTAGCAGATAAGATGAAGTGG - Intronic
970515009 4:16820376-16820398 AGTTTACAGCTTAGCTGAGGGGG + Intronic
970754411 4:19407840-19407862 AGTAAGTAGTTCAACTGAGGAGG + Intergenic
974525585 4:63046403-63046425 TGTTAGGAGTTCAGCTGAGCTGG + Intergenic
974832699 4:67209291-67209313 AGTGAACAGTGAAGCTGAGAAGG - Intergenic
975111413 4:70631872-70631894 ATTTAGCAGTAAAAGTGAGGAGG + Exonic
975554271 4:75645277-75645299 GGTTATCAGTTAAATTGAGGTGG - Exonic
975915493 4:79320718-79320740 AGTTAGAAGTGATGCTGAGCAGG - Intronic
976367422 4:84246460-84246482 AGGTGGCAGTTAAGGTGAGAAGG - Intergenic
980099696 4:128529352-128529374 AGCTCTCATTTAAGCTGAGGGGG - Intergenic
980962812 4:139493189-139493211 AGACAGCAGATAAGTTGAGGAGG + Intergenic
985303501 4:188514253-188514275 AGCAAGCAGTGAAGCTGAAGGGG - Intergenic
988130800 5:27102789-27102811 AGTGAGCATTGAAGCTGAGGTGG + Intronic
989443574 5:41502322-41502344 AGTAATCAGTTTAGGTGAGGTGG + Intronic
989452126 5:41598657-41598679 AGTTAGCATTTAAATTGGGGGGG + Intergenic
989534832 5:42551323-42551345 AGTTAACAGCTAAGTTGCGGTGG + Intronic
990025859 5:51187812-51187834 ACTTAGTAGTTAAGCTGAGCAGG + Intergenic
991440053 5:66637821-66637843 AGCTACCAGGGAAGCTGAGGTGG - Intronic
991488201 5:67159685-67159707 AGTCAGCAGTCAGGCCGAGGGGG - Intronic
992959359 5:81942728-81942750 AGTTGGGAGTTGAGCTGAGGTGG - Intergenic
993463978 5:88222179-88222201 AGTTACTAGGAAAGCTGAGGTGG - Intronic
994139389 5:96325090-96325112 AGTTACCTGAGAAGCTGAGGTGG + Intergenic
997124215 5:131209660-131209682 AGCTAGCACTTAAGCTTAAGGGG + Intergenic
1000854643 5:166382724-166382746 AGTTTTCACTTAAGATGAGGTGG - Intergenic
1002208071 5:177577938-177577960 AGTTAGCAACAGAGCTGAGGGGG + Intergenic
1002631291 5:180581215-180581237 AGTTGACAGCTAAGCTGAGGAGG + Intergenic
1005175511 6:23040242-23040264 AGCTACCTGTGAAGCTGAGGTGG - Intergenic
1008712802 6:54249058-54249080 AGGTAGAAGTTATGCTGATGGGG - Intronic
1009577331 6:65482653-65482675 AGTTAGCAGTTTAGATCAGAGGG - Intronic
1012474570 6:99605397-99605419 ACTCAGCAGTTTATCTGAGGAGG - Intergenic
1012691856 6:102324249-102324271 AGTTGTCTGTTGAGCTGAGGTGG + Intergenic
1016301576 6:142637463-142637485 ATTTACCACTTAAGCAGAGGAGG + Intergenic
1016347438 6:143129384-143129406 TCTTAGCAGTTCAGGTGAGGTGG + Intronic
1016637785 6:146314751-146314773 AGATGGCAGTTAAGGTGAAGGGG + Intronic
1017721096 6:157243690-157243712 ACTTAGCAGTTAGGGAGAGGTGG - Intergenic
1018750165 6:166797419-166797441 TGTTAGTAGTTAAGCTTTGGGGG - Intronic
1020093997 7:5357593-5357615 AGCTACCAGAAAAGCTGAGGCGG - Intronic
1021684626 7:23171560-23171582 AGTTCTCTGTTAAGGTGAGGTGG - Intronic
1022297184 7:29067170-29067192 AATCAGCAGCTAAGATGAGGAGG + Intronic
1023546199 7:41319901-41319923 AGCTTGCAGTTCAGCTGTGGAGG - Intergenic
1024532594 7:50406087-50406109 AGGTAGCAATTAAACTTAGGAGG + Intergenic
1025068552 7:55878926-55878948 GGTTAGCCCTTAAGCGGAGGAGG + Intergenic
1025296725 7:57781293-57781315 AGCCAGTAGGTAAGCTGAGGTGG + Intergenic
1025753893 7:64315623-64315645 AGCTAGCAATTAGGCTGAAGTGG - Intronic
1025978465 7:66388277-66388299 AGTTACTAGGGAAGCTGAGGTGG - Intronic
1026499736 7:70934243-70934265 AGCTACCAGGGAAGCTGAGGTGG + Intergenic
1027204044 7:76082925-76082947 AGTTACTAGGGAAGCTGAGGTGG - Intergenic
1027649650 7:80850928-80850950 AGTTAACACTGAAGTTGAGGTGG + Intronic
1030165550 7:106551609-106551631 AGCTATCAGTTAATCTGATGGGG - Intergenic
1030273362 7:107693638-107693660 AGTTAGGAGAGAGGCTGAGGGGG - Intronic
1032304407 7:130719097-130719119 AGTGAATAGTTAAGGTGAGGTGG - Intergenic
1032543164 7:132721116-132721138 AGTTGGCAGCTAAGCTGACATGG - Intronic
1032949740 7:136893716-136893738 ACTTAGAAATTAAGCTGAGCTGG - Intronic
1036505001 8:9347284-9347306 AGTGAGAAGTTAAGTGGAGGTGG - Intergenic
1036728060 8:11237982-11238004 AGTGATCAGTTCAGCTTAGGAGG + Intergenic
1037226326 8:16595716-16595738 AGTTACCAGGAAGGCTGAGGTGG + Intergenic
1037921691 8:22810834-22810856 AGTTAACAGTGGAGCTGTGGTGG + Intronic
1038216430 8:25565871-25565893 AGCTACCAGGAAAGCTGAGGTGG - Intergenic
1040618708 8:49065254-49065276 AGTTAACATTGAGGCTGAGGTGG + Intronic
1043741832 8:83824098-83824120 AATTAAAAATTAAGCTGAGGCGG + Intergenic
1044806633 8:96015056-96015078 AGTTATCTGTTAAGCTGTGGTGG - Intergenic
1046842992 8:118881724-118881746 AGTAAGCAGTTAAGTTGACTTGG - Intergenic
1047313245 8:123709820-123709842 AGATTGCAGTTGAGCTGAGATGG - Intronic
1048239280 8:132725148-132725170 AGCTAGCTGGGAAGCTGAGGTGG - Intronic
1049706047 8:144042935-144042957 AGTTAGCAGAGAGGCTGAGATGG - Intronic
1050295372 9:4198840-4198862 AGTTTGCTGTTAAACTGATGGGG - Intronic
1050737972 9:8786472-8786494 AGGTTGCAGTTGAGCTGAGATGG - Intronic
1050812219 9:9762550-9762572 AATTAGATGTTTAGCTGAGGAGG - Intronic
1051155563 9:14140819-14140841 AGCTACCTGTGAAGCTGAGGTGG + Intronic
1051951565 9:22640489-22640511 AATCAGCAGTTGAGTTGAGGTGG + Intergenic
1055011954 9:71576967-71576989 AGTTAGCAAGTAATCTGAGATGG + Intergenic
1058478042 9:105360843-105360865 CCTCAGCATTTAAGCTGAGGAGG - Intronic
1059022374 9:110590470-110590492 AGTTTACAGTTAACCTGGGGAGG + Intergenic
1059697745 9:116744859-116744881 AGTTAGCAGTTAAGCTGAGGTGG - Intronic
1060394709 9:123307437-123307459 AGTTAGCTTTTAAGGAGAGGTGG + Intergenic
1061591188 9:131598618-131598640 AGTTAGCATTTAGGGAGAGGAGG + Intronic
1062188340 9:135230490-135230512 AGTGAACAGTTAAGGTGAGACGG - Intergenic
1186742101 X:12529281-12529303 AGTAAACAGTTATGCTGGGGAGG - Intronic
1187126608 X:16460364-16460386 AGATGGGAGTTCAGCTGAGGTGG - Intergenic
1189426410 X:40905421-40905443 AGCTACTAGGTAAGCTGAGGTGG + Intergenic
1193150374 X:78118464-78118486 AGTTACCAGAGAGGCTGAGGTGG + Intronic
1193961737 X:87934353-87934375 ACTTACCACATAAGCTGAGGAGG + Intergenic
1194652890 X:96536609-96536631 ACTTAGCATTTCAGCTCAGGAGG + Intergenic
1198496642 X:137199971-137199993 AGTTAGAGGTTGAGCAGAGGAGG - Intergenic
1199108880 X:143906918-143906940 AGCTACCAGGTAGGCTGAGGTGG - Intergenic
1199643464 X:149883898-149883920 TAGTAGCAGTCAAGCTGAGGTGG + Intronic
1200164687 X:154027805-154027827 AGTCAGAAGTGAAGCTGGGGGGG + Intronic