ID: 1059697748

View in Genome Browser
Species Human (GRCh38)
Location 9:116744880-116744902
Sequence CTGTGAGACCCACAGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059697745_1059697748 -2 Left 1059697745 9:116744859-116744881 CCACCTCAGCTTAACTGCTAACT 0: 1
1: 0
2: 3
3: 10
4: 187
Right 1059697748 9:116744880-116744902 CTGTGAGACCCACAGGAAGATGG No data
1059697744_1059697748 16 Left 1059697744 9:116744841-116744863 CCTCTGCTAGCTGTCAGTCCACC 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1059697748 9:116744880-116744902 CTGTGAGACCCACAGGAAGATGG No data
1059697742_1059697748 27 Left 1059697742 9:116744830-116744852 CCTCCTTTCTGCCTCTGCTAGCT 0: 1
1: 0
2: 0
3: 43
4: 399
Right 1059697748 9:116744880-116744902 CTGTGAGACCCACAGGAAGATGG No data
1059697746_1059697748 -5 Left 1059697746 9:116744862-116744884 CCTCAGCTTAACTGCTAACTGTG 0: 1
1: 0
2: 0
3: 5
4: 116
Right 1059697748 9:116744880-116744902 CTGTGAGACCCACAGGAAGATGG No data
1059697743_1059697748 24 Left 1059697743 9:116744833-116744855 CCTTTCTGCCTCTGCTAGCTGTC 0: 1
1: 0
2: 1
3: 24
4: 308
Right 1059697748 9:116744880-116744902 CTGTGAGACCCACAGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059697748 Original CRISPR CTGTGAGACCCACAGGAAGA TGG Intronic
No off target data available for this crispr