ID: 1059703698

View in Genome Browser
Species Human (GRCh38)
Location 9:116800400-116800422
Sequence CTGTGTGCAAAAATTAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 237}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059703698_1059703700 0 Left 1059703698 9:116800400-116800422 CCATGCTTAATTTTTGCACACAG 0: 1
1: 0
2: 1
3: 28
4: 237
Right 1059703700 9:116800423-116800445 TGCAAACCCTTGGACTGTTCAGG No data
1059703698_1059703699 -10 Left 1059703698 9:116800400-116800422 CCATGCTTAATTTTTGCACACAG 0: 1
1: 0
2: 1
3: 28
4: 237
Right 1059703699 9:116800413-116800435 TTGCACACAGTGCAAACCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059703698 Original CRISPR CTGTGTGCAAAAATTAAGCA TGG (reversed) Intronic
901348735 1:8572341-8572363 CTGTGTGCTAAAATGGAGGAAGG - Intronic
902345208 1:15811588-15811610 CCGTGTGCAGAATTTGAGCATGG + Intergenic
905260760 1:36716600-36716622 CTGTGGGCAAAAGTAAGGCAGGG - Intergenic
907698693 1:56760980-56761002 CTCTGTGCAGAAAGTAAGCGAGG - Intronic
908435430 1:64101160-64101182 CTCTGTGCAGAAAGTAAACAGGG + Intronic
909086367 1:71173783-71173805 CTGTGAAGAAAAATAAAGCAGGG - Intergenic
909333307 1:74441401-74441423 CTGTATGCATAAATAAATCATGG - Intronic
909696211 1:78470743-78470765 CTGAGGTAAAAAATTAAGCATGG + Intronic
909958696 1:81808821-81808843 CTGGGTGCCAGAATTAATCAAGG - Intronic
910219064 1:84871943-84871965 CTGTGGAGAAAAATAAAGCAGGG - Intronic
915691034 1:157690952-157690974 CTATGTAGAAAAATAAAGCAAGG - Intronic
916267793 1:162908547-162908569 CTTTGTGCAAAAGAGAAGCAAGG - Intergenic
916898845 1:169198883-169198905 CTTTGTGTAAAAATTGAGCAAGG - Intronic
918197530 1:182236136-182236158 CTGTGTGCACACATCAAGCAAGG + Intergenic
923126094 1:231035818-231035840 CAGTTTGCAAAAATGGAGCAAGG - Intronic
924118558 1:240772498-240772520 CTGTGTCCAAAAATAAATGAAGG - Intergenic
924566909 1:245206355-245206377 CTTTGTGCAAAGATAAAGGAGGG - Intronic
1065685637 10:28281912-28281934 CAGTGTACACCAATTAAGCAAGG + Intronic
1065997396 10:31071619-31071641 GGGTGTGGAAAAATTAAGCGGGG - Intergenic
1066269497 10:33808494-33808516 CCGGGTGCTAAAATTAAGCTTGG - Intergenic
1066276268 10:33871513-33871535 CTGGGTGCAACAATAAAGAAGGG + Intergenic
1067013862 10:42740836-42740858 CTCTGGGAAAAAATTGAGCATGG + Intergenic
1067222591 10:44354773-44354795 CTGTGTGTAAAAATTCCCCAAGG - Intergenic
1068278074 10:54829079-54829101 CTGTGTACAAAAACTAACCTTGG - Intronic
1068618119 10:59143917-59143939 CTGTGTGTAAAAATAAAGTAAGG + Intergenic
1070536146 10:77378754-77378776 CTGTATGCAAACATAAAGCATGG + Intronic
1071249160 10:83798814-83798836 CTATGTGCAAAAATTAACTCAGG - Intergenic
1072129525 10:92480439-92480461 CTATGGGGTAAAATTAAGCAGGG + Intronic
1072812533 10:98474279-98474301 CTGTGTCCAGAAACTAAACATGG + Intronic
1073125077 10:101144150-101144172 GTGTGTGCAAAAATCATCCAAGG + Intergenic
1077216975 11:1399001-1399023 CTGTGTGCAAGAAGTCACCACGG - Intronic
1078084936 11:8228287-8228309 CTGTGTGCAGGAAAGAAGCAAGG - Intronic
1078209748 11:9261152-9261174 CTGTCTGCAACAAATAAACATGG - Intronic
1078289742 11:9996831-9996853 TTGTTTGCCAAAATGAAGCATGG - Intronic
1078808417 11:14731933-14731955 CTGTGGAGGAAAATTAAGCAAGG + Intronic
1078825972 11:14930654-14930676 CTGGGGGAGAAAATTAAGCAGGG + Intronic
1081061538 11:38484195-38484217 CAGGGTGCAAGAATTAATCATGG + Intergenic
1081281348 11:41212282-41212304 CTGTGTTAAGAAATTAATCAAGG + Intronic
1084765365 11:71304870-71304892 CTGTGTTCAAAAAATAAAAAAGG + Intergenic
1085764764 11:79273180-79273202 CTCAGTGCAACAATTATGCATGG - Intronic
1087641175 11:100755521-100755543 CTGTGTGCAATATTTTGGCAAGG - Intronic
1090057124 11:123432884-123432906 CTGTTTGCAACAACTGAGCATGG + Intronic
1092794942 12:12100976-12100998 CTGTGTGCCAAAACTATGCCAGG - Intronic
1093827970 12:23718396-23718418 CTGTATGCAAAGATTAAGATAGG - Intronic
1094438932 12:30453447-30453469 GTGTGTGCAAGATTTACGCAAGG + Intergenic
1094564563 12:31588344-31588366 CTATGAGGAAAAATAAAGCAGGG - Intronic
1094675624 12:32617339-32617361 CTGTGTTCAAAGATTAAATAAGG - Intronic
1094675850 12:32619718-32619740 CTGTGTGCCCAAATTCAGCTTGG + Exonic
1095937655 12:47703560-47703582 CTGACTGCAAAAAATAGGCATGG + Intronic
1098935100 12:76469706-76469728 CTGTGACGAAAAATAAAGCAGGG - Intronic
1103554300 12:121756764-121756786 CTGTGAGCAAAGGTTCAGCAAGG - Intronic
1105301523 13:19139685-19139707 CTCTGTGCAAACATTAAGGTGGG + Intergenic
1106239440 13:27899129-27899151 CTGTGTGCTAAATCTAAACAGGG - Intergenic
1106532218 13:30604054-30604076 CTGTGATGAAAAATAAAGCAGGG + Intronic
1107854844 13:44604495-44604517 CTGTGTGAGAAAATTTAGCTTGG - Intergenic
1108891159 13:55261549-55261571 CTGTGTAAATAAATGAAGCATGG + Intergenic
1109532134 13:63664062-63664084 CTGTATGCTAAACTTAAGCAGGG - Intergenic
1109692641 13:65913210-65913232 CTATGTGCAAAGAGTAAGGAAGG + Intergenic
1111324860 13:86681291-86681313 GTGTGTGCATAAATTGATCATGG - Intergenic
1111681530 13:91447631-91447653 CTGTGTGGAAAAAGTAGGAAGGG + Intronic
1112516800 13:100060183-100060205 CTGTAAGCAGAAATTAAGCCAGG - Intergenic
1112753378 13:102604346-102604368 CTATGGAGAAAAATTAAGCAGGG - Intronic
1113314008 13:109159650-109159672 CTGTGTAGAAAACTAAAGCAAGG + Intronic
1114489159 14:23086353-23086375 CTTTTTGAAAAAATTAAGGACGG + Intronic
1116262019 14:42642233-42642255 CTGTGAGCAAAAATAAATGAGGG + Intergenic
1116279147 14:42879803-42879825 CTGTGTGCATATGCTAAGCAGGG - Intergenic
1116344900 14:43780440-43780462 CTTTGGGAAAAAAATAAGCAGGG + Intergenic
1116487792 14:45471916-45471938 CAGTGAGCAAAGATTAAGAAAGG + Intergenic
1117060935 14:51962773-51962795 CTGTGTGCAAAATGTTAGCAGGG + Intronic
1118542215 14:66841198-66841220 CTATGTTTAAAAATTAACCAGGG + Intronic
1126816976 15:52463311-52463333 CTGTCTGTAAAAACTAAGAAAGG + Intronic
1127320254 15:57837719-57837741 CTCTGTAGAAAAAATAAGCAAGG + Intergenic
1128759964 15:70209837-70209859 CTGTGGAGAAAAATAAAGCAGGG - Intergenic
1129852471 15:78801548-78801570 CTGTGGGGAAAAATAAAGCAAGG - Intronic
1130250516 15:82297528-82297550 CTATGGGGAAAAATAAAGCAAGG + Intergenic
1131538414 15:93256067-93256089 CTTTGTTCAAAAAAAAAGCAGGG - Intergenic
1131649318 15:94381703-94381725 CTGGGTGGAGAAATCAAGCATGG + Intronic
1131842209 15:96449521-96449543 CTGTGTTGACAAAATAAGCAGGG - Intergenic
1131949406 15:97664718-97664740 CTCAGTGCCAAAATTATGCAAGG + Intergenic
1132439677 15:101847740-101847762 CTGTGGATAACAATTAAGCAAGG - Intergenic
1133468813 16:6053898-6053920 AAGTGCACAAAAATTAAGCATGG + Intronic
1135196594 16:20399791-20399813 ATTTGTTCAAAAATTAAACAGGG - Intronic
1135241735 16:20813171-20813193 CTTTCTGCAAAGATTAATCAGGG - Exonic
1135533193 16:23272261-23272283 CTGAGTGGAAAAATTAAGAAAGG - Intergenic
1136392204 16:29972866-29972888 ATGTGTGCAGAAATTGAGGAAGG - Intronic
1138146590 16:54618199-54618221 CTTTGTGCCAGAATAAAGCAGGG - Intergenic
1140762146 16:78119333-78119355 CTGTGTCTAAAAACGAAGCAGGG - Intronic
1141386323 16:83625299-83625321 CAGCGTGGAAGAATTAAGCATGG - Intronic
1146675232 17:34768737-34768759 CAGTGTGTAAAAAGGAAGCAAGG - Intergenic
1148959829 17:51384221-51384243 CTGTGTGCAAAAAGGAAACAGGG - Intergenic
1149421749 17:56518483-56518505 CTTTATGGAGAAATTAAGCAAGG - Intergenic
1151704864 17:75762014-75762036 CTGTGTCCAAAAAAAAAACACGG + Intronic
1151853926 17:76708713-76708735 CTGCCTGCAAACATTAAGCCAGG - Intronic
1151934288 17:77252645-77252667 CTGGGTGCTAAACCTAAGCAGGG - Intergenic
1153368134 18:4282684-4282706 TTATGTGCATAAATTTAGCAAGG - Intronic
1153439537 18:5101367-5101389 ATGTGCACAAAAATTAATCATGG + Intergenic
1156603817 18:38642055-38642077 TTCTGTGCACAAATCAAGCAGGG + Intergenic
1158154063 18:54405616-54405638 CTATAAGAAAAAATTAAGCAGGG - Intergenic
1158379592 18:56914301-56914323 CTGTGAAGAAAAATAAAGCAGGG - Intronic
1158806824 18:60983650-60983672 CTGTGTGCAACAAGGAAGCATGG + Intergenic
1163959892 19:20679495-20679517 TTGTGAGAAAAAATTAACCAAGG - Intronic
1166614764 19:44233558-44233580 CTGTGGGGAAAAGTCAAGCAGGG + Intronic
1166668663 19:44697017-44697039 CTGTGGAGAAAAATAAAGCAGGG - Intergenic
1167531972 19:50023521-50023543 CTGTGAAGAAAAATAAAGCAAGG - Intronic
925468907 2:4137761-4137783 CTGTGTGCAAAAATTAGAGCAGG - Intergenic
925814841 2:7737345-7737367 CTCTGTGCAAAAGTTAGGGAAGG + Intergenic
926439002 2:12867870-12867892 GTGTCTCCAAAAAGTAAGCAAGG - Intergenic
926716848 2:15931192-15931214 TTGTGTGCTACAATTAAGGATGG - Intergenic
926741655 2:16116261-16116283 CTGTGTGGAGAAATTTTGCAAGG + Intergenic
926859481 2:17293098-17293120 CTTTTTGCAAAAATTAAGGGAGG - Intergenic
927011677 2:18910825-18910847 CTGCGTGCAAAAATTCATCGAGG - Intergenic
927631776 2:24780753-24780775 CTGTGGAGAAAAATTAAGTAGGG + Intergenic
928439261 2:31278124-31278146 CTGTGAGCATTAATTAAGCAAGG + Intergenic
928856508 2:35808916-35808938 CTGTGTGCAAAGAGGAAGCAGGG - Intergenic
929243035 2:39672205-39672227 CTGTGTGCAGATAGTAAGAATGG - Intronic
931856057 2:66302908-66302930 CTATGAAGAAAAATTAAGCAGGG + Intergenic
932910040 2:75796821-75796843 CTGTGAACAAAAATGAAGCTGGG + Intergenic
933878218 2:86641536-86641558 CCGTTTGCAGAAATTCAGCAAGG - Intronic
936370833 2:111900820-111900842 CTGTATGAAGAAATTAAACATGG + Intronic
936443150 2:112573631-112573653 CTCTCTGAAAAAATTAAACAAGG + Exonic
938025151 2:127941134-127941156 ATGTGTGAAAAACTGAAGCAGGG + Intergenic
940020626 2:149152807-149152829 CTGTTTCCTAAAAATAAGCAGGG + Intronic
940162978 2:150733658-150733680 CTGTTTGAAAATAATAAGCATGG - Intergenic
940698767 2:157015269-157015291 CTGTGGGTGATAATTAAGCAAGG - Intergenic
941389384 2:164892669-164892691 CTGTCTGCTGAAGTTAAGCAAGG + Intergenic
942129610 2:172865280-172865302 CTGTTTGCAAAAAGTGACCAAGG - Intronic
945379574 2:209123701-209123723 CAGTCTGCACAAATTCAGCAAGG - Intergenic
945952143 2:216049374-216049396 CTGTGTTTAAAAATAAAACAGGG + Intronic
947577628 2:231288955-231288977 CAGTGTGCAAAAAGTAAATAAGG - Intronic
947649858 2:231777290-231777312 CTGTATGCATAAATTAGGCATGG - Intronic
948339254 2:237235978-237236000 CTGTGACAAAAAAGTAAGCAGGG - Intergenic
1169187298 20:3629475-3629497 TTGTCTGGAAAAATCAAGCAAGG - Intronic
1169952919 20:11066593-11066615 CTGTTTGCAAGAATAAAGGAGGG - Intergenic
1170167642 20:13378896-13378918 CTGAAAGCAAAAATAAAGCAGGG - Intergenic
1172503545 20:35444269-35444291 CTGTGAAGAAAAATTAAGCAGGG + Intronic
1173045235 20:39503430-39503452 CTGAGAGCAAAAAATAACCAGGG - Intergenic
1173162366 20:40662484-40662506 CTGTGTGCACAAATTTGGCCTGG - Intergenic
1175194864 20:57236075-57236097 CTGGGTGCCAGAATTAAGAAAGG - Intronic
1181132158 22:20738323-20738345 CTGTGTGCCCAACTTAAGCAGGG - Intronic
1184790784 22:46698532-46698554 CTTTGTGCAGAAATTCAGCCTGG - Intronic
950068088 3:10129656-10129678 CTGTCTTTAAAAATTAAGCTTGG + Intergenic
951262752 3:20530769-20530791 CTGTGTGAAGAAAAAAAGCAGGG + Intergenic
952224447 3:31360741-31360763 CTATGGAAAAAAATTAAGCAGGG + Intergenic
952422345 3:33143664-33143686 CTGTGGAGAAAAATAAAGCAGGG + Exonic
955295243 3:57728970-57728992 CTGTGGAGAAAAATGAAGCAGGG + Intergenic
957765438 3:84619015-84619037 TTGTGTGCAAAAATTAAGGCTGG - Intergenic
958425851 3:93978051-93978073 CTGTGTGGAGAAACTCAGCAAGG - Intergenic
958576325 3:95953376-95953398 CTGTGTTCAAAACTGAAGCAAGG + Intergenic
958658381 3:97032907-97032929 TTGTGAGCAAAAACTAGGCAGGG + Intronic
958703790 3:97627324-97627346 CTGTGGAGAAAAATAAAGCAGGG + Intronic
959320100 3:104862244-104862266 AAGTGTGCAAAAATGAGGCATGG + Intergenic
959551188 3:107659958-107659980 ATGTGTGGAAACATTAATCAAGG - Intronic
959602519 3:108203794-108203816 CTGTGAGGAAAAATAAAGTAGGG + Intronic
959775576 3:110157769-110157791 CTGTGTTCATAAATTTTGCATGG + Intergenic
959864539 3:111251307-111251329 CTGTGGGTCAAAATAAAGCAAGG - Intronic
960739954 3:120822188-120822210 CTGTGGAGAAAAATAAAGCAGGG + Intergenic
961069747 3:123911573-123911595 CTGTGAAGAAAAATAAAGCAGGG - Intronic
962388228 3:134950318-134950340 TTGTGTGCAAATTTCAAGCAAGG - Intronic
963119674 3:141765406-141765428 CTGTGAAGAAAAATCAAGCAGGG - Intergenic
963882532 3:150545486-150545508 CTGTGAGTACAAATTAAGCTGGG + Intronic
964262931 3:154860543-154860565 GTGGGTGCAAACATAAAGCAGGG - Intergenic
966046255 3:175553985-175554007 CTATGTAGAAAATTTAAGCAAGG + Intronic
969129441 4:4980800-4980822 CAATGTGCATAAATTAAGCACGG + Intergenic
970431618 4:15994165-15994187 CTGTGTTCACAGATTAAACAAGG - Intronic
970881245 4:20934745-20934767 CTATGTAGAAAAATAAAGCAAGG + Intronic
971467272 4:26976997-26977019 TTATGTGAAAAAATAAAGCAGGG + Intronic
972979689 4:44680908-44680930 CTCAGTTCAAAAATTAAACAAGG - Intronic
973007227 4:45028206-45028228 CTGTGGTGAAAAATAAAGCAAGG + Intergenic
973226276 4:47788683-47788705 CTTTATGCCAAAAATAAGCAAGG - Intronic
973979452 4:56295536-56295558 CTATGTGGAAAAATAAATCAGGG + Intronic
975191503 4:71468273-71468295 CTTTGTGGAAAGATTAAACAAGG + Intronic
975547174 4:75571558-75571580 CTGGGTGTAAAAATAAAGCTGGG - Intergenic
976038450 4:80853392-80853414 CTGTGAACAAAAATAAAACAAGG + Intronic
977382250 4:96290625-96290647 CTGTGTGGAAAAGTGAAGGAGGG - Intergenic
978159416 4:105527648-105527670 CAGTTTCCAAAATTTAAGCAGGG + Intergenic
978914986 4:114113645-114113667 CTGTGTACATAAATTGTGCAAGG - Intergenic
980602872 4:135047572-135047594 CTGTGTGGAGAGATAAAGCATGG - Intergenic
983128396 4:163983165-163983187 TTGTGTGCCAAAGTGAAGCATGG + Intronic
983874294 4:172858359-172858381 CTGTGAGTAAATATAAAGCAAGG + Intronic
984383198 4:179021420-179021442 CTGTGTGGAGAAATTAATTAGGG - Intergenic
985142922 4:186861662-186861684 CTGGCTGCAAAAATTAAAAAGGG + Intergenic
986905231 5:12487865-12487887 TTGTGTTCAAAAAATAACCATGG + Intergenic
987161938 5:15153878-15153900 CCATGTACAACAATTAAGCAGGG + Intergenic
988942735 5:36162466-36162488 CTGTGCAGAAAAATTAAACAGGG - Intronic
990124787 5:52500949-52500971 CTGTCAGCAAAAATTAGTCAAGG + Intergenic
991896822 5:71410714-71410736 CTGTGTGAAAAAAATAGGTAGGG - Intergenic
993626572 5:90232182-90232204 CTAAGAGGAAAAATTAAGCAAGG + Intergenic
994225774 5:97250155-97250177 CTAGGTGCAAAACCTAAGCAGGG - Intergenic
994261602 5:97665774-97665796 CTGTGAGCAGAAATGAAGCTTGG - Intergenic
994893851 5:105675192-105675214 CTGAGTGGAAAAATAAAGCTTGG + Intergenic
997132852 5:131294586-131294608 CTATGAGGAAAAATAAAGCATGG + Intronic
997658269 5:135571221-135571243 GGGTGTGTAAAAATTAACCAGGG + Exonic
997877671 5:137563873-137563895 CTGTGTGGAAAAGGTCAGCATGG - Intronic
998491858 5:142553915-142553937 CTGAGGGCAAAAATTAGACATGG - Intergenic
998796850 5:145829471-145829493 CTGTGTGCTGAAATTAAGCTAGG + Intronic
999628342 5:153543926-153543948 CTGTGGGAAAAAATAAAGCATGG + Intronic
999723051 5:154412910-154412932 CTGTGTGCAGACACAAAGCACGG + Exonic
1000078668 5:157822021-157822043 ATGTGTGCAAAACTTGAGGATGG - Intronic
1001171401 5:169422808-169422830 CTATGGAGAAAAATTAAGCAGGG + Intergenic
1001196867 5:169680982-169681004 TTCAGTGCAAAAATCAAGCATGG - Intronic
1001496278 5:172189401-172189423 CAGTGTGCAAACACCAAGCATGG + Intergenic
1003537377 6:6987388-6987410 ATGTGTGCAAAAACCAAGCCTGG + Intergenic
1003963947 6:11235551-11235573 CTATGAAGAAAAATTAAGCAGGG + Intronic
1004551671 6:16653957-16653979 CAGTGTGCAAAAGTTAACTAAGG + Intronic
1004615400 6:17283122-17283144 CTGTGTGCAAAAATGGATCTTGG + Intronic
1005415581 6:25597133-25597155 GTGTGTGCAAAAAGAAAGGAGGG + Intronic
1006958673 6:37903016-37903038 CTGTGTGCAGTAATTTAGGATGG + Intronic
1007471022 6:42090499-42090521 CTGAGGGAAAAAATTAAGCAGGG + Intergenic
1009843533 6:69107420-69107442 ATATGTGCAAATATTATGCAAGG + Intronic
1012073528 6:94654538-94654560 CTGTCTCAAAAAATTAAGCATGG + Intergenic
1012997813 6:105991290-105991312 CTGTATATAAAAATAAAGCATGG + Intergenic
1013552561 6:111222668-111222690 CTTTTTGCAAAATTTAAGCCTGG + Exonic
1015647651 6:135411919-135411941 GTGTGTGTAAAAATTAAGAAGGG - Intronic
1017002433 6:150005478-150005500 CTGTGTTGAAAAATTAAACGAGG - Intergenic
1017805478 6:157941983-157942005 CTGTGTGAGAAAATAATGCAAGG + Intronic
1018854652 6:167666808-167666830 TTGTGTGGAAAAATAAAACATGG + Intergenic
1019830623 7:3324884-3324906 CTGTTAGGAAAAATGAAGCATGG - Intronic
1019949047 7:4356071-4356093 CTGGGGAGAAAAATTAAGCATGG - Intergenic
1021416340 7:20389595-20389617 ATGTTTCCAAAAATTAAGAAGGG + Intronic
1021821195 7:24499126-24499148 CTGTTTCCAAATAATAAGCAAGG - Intergenic
1022965630 7:35468710-35468732 CTGCGTGCAAAAATTCCCCAAGG + Intergenic
1023610920 7:41969555-41969577 CTGAGGCCAAAAATTAAGCAAGG - Intronic
1024155314 7:46616660-46616682 ATGTGTGCAAAAATTAGGCTTGG - Intergenic
1024229257 7:47351717-47351739 CTGTGTGCAAGAAAGAACCAAGG + Intronic
1024369700 7:48567001-48567023 CTGTGTGCAAAAGTTGAGTGAGG + Intronic
1026851772 7:73728650-73728672 CTGTGGAGAAGAATTAAGCAGGG - Intergenic
1027616092 7:80426039-80426061 ATGTGTGCCAAATTTAAGAAAGG + Intronic
1028325223 7:89515836-89515858 GTGTGTGCAAGAATAATGCATGG + Intergenic
1029644411 7:101844474-101844496 CTCTGTGCAAAAAGAAAACAGGG - Intronic
1030562103 7:111101448-111101470 CTTTGTGCAGAAAATAAGTATGG - Intronic
1032303616 7:130712462-130712484 ATGTGAGCAGAGATTAAGCAAGG - Intergenic
1032559272 7:132871777-132871799 GTGTGTGCAGATATTATGCATGG - Intronic
1032819022 7:135507544-135507566 CTGCGGGCAAAAATTATGGAGGG + Intronic
1039237108 8:35513595-35513617 CTGTAGGGAAAAATAAAGCAGGG - Intronic
1039595906 8:38789570-38789592 CTGTGGAGAAAAATAAAGCAGGG + Intronic
1040931505 8:52739819-52739841 CTGTGCTCACAAATAAAGCAAGG + Intronic
1042327775 8:67546444-67546466 CTGTCTGGAAAAATTAAGGAAGG - Intronic
1043545586 8:81312162-81312184 CAAAGTGCAAAAATGAAGCAGGG + Intergenic
1043791834 8:84478730-84478752 CTCTGTGCAAAAACTATGCAAGG - Intronic
1046889146 8:119401877-119401899 CTATATGCAAAAATTAAGTTGGG + Intergenic
1047260309 8:123252136-123252158 CTGTGTTCAAACAGTAAGGAAGG - Intronic
1048335455 8:133498953-133498975 CTGGGTCCAAAAATTCAGAAGGG - Intronic
1050443697 9:5695053-5695075 CTATGGAGAAAAATTAAGCAGGG + Intronic
1050466399 9:5928772-5928794 CTGTGAAGAAAAATAAAGCAAGG - Intronic
1051872046 9:21749290-21749312 CTCTGGCCAAAAATTGAGCAAGG - Intergenic
1052573905 9:30265912-30265934 CAGTGTGCAAACATTAAGATGGG - Intergenic
1052697119 9:31891920-31891942 CTGCATCCAAAAATGAAGCATGG + Intergenic
1055599910 9:77905046-77905068 CTGTGTTCAGAAGTTAAGAATGG + Intronic
1057238375 9:93385984-93386006 CTAAGTCCAAAAATAAAGCAAGG + Intergenic
1057345211 9:94244364-94244386 CTGTGTGCTATACCTAAGCAAGG + Intergenic
1058101195 9:100919287-100919309 CTATGGGGAAAAATGAAGCAGGG - Intergenic
1058748544 9:108016023-108016045 CTGTGGATAAAAATAAAGCAAGG - Intergenic
1059703698 9:116800400-116800422 CTGTGTGCAAAAATTAAGCATGG - Intronic
1060283774 9:122230940-122230962 GTGTGTGCAGAAAGTAAACATGG - Intergenic
1061546448 9:131307628-131307650 CTGTATGAAAAAATTAAACAAGG + Intronic
1186588623 X:10903965-10903987 CTGGGTGCAAAAATTATTCCTGG - Intergenic
1187553659 X:20330948-20330970 CTGTGTGCCAAAGTTTGGCAAGG - Intergenic
1188309750 X:28601610-28601632 CTTTGTGCTTGAATTAAGCATGG - Intronic
1191840237 X:65508523-65508545 CTGCGTACAAAAATTAAGTCTGG - Intergenic
1193729664 X:85087395-85087417 CTATGTGAAAAAATGAAACAAGG - Intronic
1194530429 X:95041596-95041618 ATGTGAGAAGAAATTAAGCATGG + Intergenic
1196545262 X:116956356-116956378 CTGAGTGAAAAAATTATGCTGGG - Intergenic
1197163310 X:123347677-123347699 TTGTGTGCAAAATTTAAGCATGG - Intronic
1198137480 X:133768483-133768505 CTTTATCCAAAAATTAAGGAGGG - Intronic
1198183194 X:134230027-134230049 GTGTATGCACAAATTAAGGAGGG - Intergenic
1198438399 X:136638827-136638849 CTGTGGGCAAAAATTAACATGGG + Intergenic
1198984482 X:142433757-142433779 CTCTGTTCAGCAATTAAGCAGGG - Intergenic