ID: 1059704609

View in Genome Browser
Species Human (GRCh38)
Location 9:116809803-116809825
Sequence TCCTGGACTTGCATTGCATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059704606_1059704609 -7 Left 1059704606 9:116809787-116809809 CCACACTGTGTCCTCTTCCTGGA 0: 1
1: 0
2: 7
3: 65
4: 471
Right 1059704609 9:116809803-116809825 TCCTGGACTTGCATTGCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059704609 Original CRISPR TCCTGGACTTGCATTGCATT GGG Intronic
No off target data available for this crispr