ID: 1059708334

View in Genome Browser
Species Human (GRCh38)
Location 9:116844265-116844287
Sequence TAGGAGAAGAATAATGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 401}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059708334_1059708340 14 Left 1059708334 9:116844265-116844287 CCATGTTCATTATTCTTCTCCTA 0: 1
1: 0
2: 1
3: 44
4: 401
Right 1059708340 9:116844302-116844324 CTGCCAGGTGGGACGGTTTCTGG No data
1059708334_1059708338 3 Left 1059708334 9:116844265-116844287 CCATGTTCATTATTCTTCTCCTA 0: 1
1: 0
2: 1
3: 44
4: 401
Right 1059708338 9:116844291-116844313 CAAGCTTTATTCTGCCAGGTGGG No data
1059708334_1059708339 7 Left 1059708334 9:116844265-116844287 CCATGTTCATTATTCTTCTCCTA 0: 1
1: 0
2: 1
3: 44
4: 401
Right 1059708339 9:116844295-116844317 CTTTATTCTGCCAGGTGGGACGG No data
1059708334_1059708336 -1 Left 1059708334 9:116844265-116844287 CCATGTTCATTATTCTTCTCCTA 0: 1
1: 0
2: 1
3: 44
4: 401
Right 1059708336 9:116844287-116844309 AGCACAAGCTTTATTCTGCCAGG No data
1059708334_1059708337 2 Left 1059708334 9:116844265-116844287 CCATGTTCATTATTCTTCTCCTA 0: 1
1: 0
2: 1
3: 44
4: 401
Right 1059708337 9:116844290-116844312 ACAAGCTTTATTCTGCCAGGTGG No data
1059708334_1059708341 15 Left 1059708334 9:116844265-116844287 CCATGTTCATTATTCTTCTCCTA 0: 1
1: 0
2: 1
3: 44
4: 401
Right 1059708341 9:116844303-116844325 TGCCAGGTGGGACGGTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059708334 Original CRISPR TAGGAGAAGAATAATGAACA TGG (reversed) Intronic
900668571 1:3834037-3834059 TAAGAGAAAAGTGATGAACACGG + Intronic
901945033 1:12694895-12694917 AAGAAAAAGAATAATGAACAGGG + Intergenic
903295338 1:22339828-22339850 AAGGAGAAGACAAATCAACAAGG - Intergenic
905837832 1:41143678-41143700 CACGATAAAAATAATGAACATGG + Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
908047677 1:60188285-60188307 AAAAAGAAGAACAATGAACAAGG + Intergenic
909341000 1:74530984-74531006 TAGGCAAAGAATTATGAATAAGG - Intronic
910098988 1:83556520-83556542 GAGGAAAAGAATAAGGACCAGGG - Intergenic
911058266 1:93726024-93726046 AAGAAGAAGAATAAGGAAGAGGG - Intronic
911251994 1:95586941-95586963 GAGGAGAAGAATAAGGAACCTGG + Intergenic
911341504 1:96644262-96644284 TAGGACAGGAAGAATGAAAAGGG - Intergenic
912075338 1:105867555-105867577 TAGAAAAAGTATCATGAACAGGG + Intergenic
913034036 1:114943627-114943649 TAGGGGAAAACTAATGAAGAGGG + Intronic
914684047 1:149962364-149962386 TAGGAGGAGGATAATGAACTGGG - Intronic
914909737 1:151775166-151775188 TCTGAGAAGAAAAATGAAAAGGG + Exonic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916034762 1:160911942-160911964 TAAGAGCAGAATAAGAAACAAGG - Intergenic
918758537 1:188370514-188370536 TAGGAGTAAAATAATTAACCTGG - Intergenic
919530529 1:198713486-198713508 TGGGTGAATAAAAATGAACATGG + Intronic
920608426 1:207413112-207413134 TAGGAGAAGGAAAATAAACAAGG + Intergenic
921168809 1:212527212-212527234 TAAGAGAAGAAGAACCAACATGG + Intergenic
921719251 1:218452281-218452303 AGGGAGAAGAAGAATGGACACGG - Intergenic
921979092 1:221235707-221235729 TAGGAGAAGAATGAAGAACTGGG - Intergenic
922029961 1:221788331-221788353 TAGGAGATTAATAAAGAAGACGG + Intergenic
922855708 1:228773499-228773521 TAGGAGACGAATAATACACAAGG - Intergenic
923345860 1:233052072-233052094 TTGGAGAAGGTTATTGAACAGGG - Intronic
923434622 1:233956517-233956539 TAGGGGAAGAAGAAAGAACCAGG - Intronic
924107157 1:240660474-240660496 TAGGAAAACAAAAATGAATAAGG + Intergenic
924715773 1:246572392-246572414 GAAGAGAAAAATAATGAACAAGG - Intronic
1062991999 10:1828105-1828127 TAGGAGAAGTAAAATCAAAATGG + Intergenic
1063710906 10:8477425-8477447 TAAGACAAGAAAAATGAATATGG - Intergenic
1064024773 10:11838816-11838838 TCAGAAAAAAATAATGAACAAGG - Intronic
1064557775 10:16564737-16564759 TGGGGGAAGTATAAAGAACAGGG + Intergenic
1066984977 10:42456817-42456839 TAAAAGAAGAATAATGATAAAGG + Intergenic
1067264524 10:44726859-44726881 TTGGAGAAGAACAAAGAAGAAGG - Intergenic
1068899337 10:62249339-62249361 TAGGTCAAGAAGAATGAACTGGG + Intronic
1069419057 10:68230076-68230098 TGGGAGCAAAATAATAAACATGG - Intergenic
1069636257 10:69926707-69926729 TGGGAGAAGAGGAAAGAACAAGG + Intronic
1070958120 10:80478322-80478344 GAGGAGATGAATAATAAATAAGG + Intronic
1071124953 10:82323012-82323034 AAGGAGAAGAAAAAGGAAAAAGG + Intronic
1073515409 10:104071388-104071410 AAGGAGTAGAAGAAAGAACATGG - Intronic
1073748233 10:106494270-106494292 GAGGAGAAGAAAAAAGAAAAAGG - Intergenic
1074384871 10:113008827-113008849 TAGGAACAGAAAGATGAACAAGG - Intronic
1074437042 10:113442927-113442949 TGGCAGAAAATTAATGAACAAGG + Intergenic
1074650654 10:115520795-115520817 GAGAAGTAGAAAAATGAACAAGG - Intronic
1075066089 10:119289808-119289830 TAGGAGCTGAACAAAGAACATGG - Intronic
1076073500 10:127513092-127513114 TAGGAAAAGAAAAAAGAATATGG + Intergenic
1076427031 10:130374150-130374172 CAGGAACAGAATGATGAACAAGG + Intergenic
1078001410 11:7499680-7499702 TAGGAGAAGCAGAAGGAACATGG + Intronic
1078327142 11:10389853-10389875 AAGGAGAAGAACAAAGAAAATGG - Intronic
1078537135 11:12184333-12184355 CAGGAGGAGAATGGTGAACAGGG - Intronic
1079404108 11:20130030-20130052 TAGCAGAAGAAAAAGGAAAAAGG + Intergenic
1079832542 11:25286925-25286947 TAGGAGAAGTAACATTAACAGGG + Intergenic
1080007899 11:27429133-27429155 GAGGAGAAAAATAAAGAAAATGG + Intronic
1080136551 11:28861422-28861444 TAGGAAAATAATAATAAACACGG + Intergenic
1080202041 11:29683348-29683370 TAGGTTAAAAATAATCAACATGG - Intergenic
1080557365 11:33429900-33429922 TAGGAGAAGAAGCAGGAAGAGGG - Intergenic
1081102805 11:39026042-39026064 TAGAAGAATAAAAATGAACTGGG - Intergenic
1081645903 11:44790648-44790670 TAGGAGAACACAAAAGAACATGG + Intronic
1084975155 11:72793009-72793031 TAGGAGAAGAATTGGGAACAGGG + Exonic
1085916043 11:80889223-80889245 TTGGAGGAAAATAATGCACAGGG + Intergenic
1086146970 11:83562566-83562588 AATGAGAAGAATAAAGAACAGGG + Intronic
1087258934 11:95989123-95989145 TAGGAGAATAATAGAGAATAAGG + Intronic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1090898848 11:131006970-131006992 TAGGAGAAAAATGAAGAACGAGG - Intergenic
1091096050 11:132823192-132823214 TAGGAGAAAAAAATGGAACAGGG - Intronic
1091238270 11:134036058-134036080 TAAGAGAAGAATTATACACACGG + Intergenic
1091972610 12:4800379-4800401 TAGAAGAAGAGAATTGAACATGG - Intronic
1092448537 12:8581032-8581054 TAGGAAAAAAATAATAAAGAAGG + Intergenic
1092685389 12:11038518-11038540 TATGAGAAGAATTATCAAGATGG - Intronic
1093739819 12:22671872-22671894 TAGGAGAAAAATAATGATTGTGG + Intronic
1093775225 12:23065770-23065792 TAGGAGAACAATATGGGACAGGG + Intergenic
1093859056 12:24141200-24141222 TAGGAGAAGAAAGATGTAAAAGG - Intergenic
1095425665 12:42072145-42072167 TAAGAGAAAGATAATAAACATGG + Intergenic
1095545625 12:43364685-43364707 AAGAAGAAGAAAAATGAATAGGG + Intronic
1095631406 12:44381267-44381289 TAGGAGGAGAACAATGAACTTGG - Intronic
1096442901 12:51660918-51660940 TAGGAGAAGAATGAAGGAAAAGG + Intronic
1097006910 12:55926648-55926670 TTCGAGAAAAATAATGAAAACGG + Intronic
1097014713 12:55977348-55977370 TAGGAGTAGAATTATCAATAAGG + Intronic
1097091390 12:56508153-56508175 GAGGAGAAGAAGAAGGAAGAAGG - Intergenic
1098696494 12:73563778-73563800 TTGGAGAAAAATAATGTAAATGG - Intergenic
1100415436 12:94368639-94368661 TAGCAGAAGTATAAATAACATGG + Intronic
1100417944 12:94398104-94398126 TAGGAGTACAACATTGAACATGG + Intronic
1101075991 12:101130404-101130426 TAGGTGAGGAATACTGCACAGGG - Intergenic
1101726037 12:107388817-107388839 TCAAAGACGAATAATGAACATGG + Intronic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1103290248 12:119839782-119839804 TAGGAGAAGAAAAATAAACTTGG + Intronic
1105300406 13:19129040-19129062 AAGGTGAATAATTATGAACATGG + Intergenic
1105620352 13:22060609-22060631 AAGGAAAAGAATAATGACCTAGG + Intergenic
1107182617 13:37479204-37479226 TAGGAGAAGAATAGAGGAGATGG - Intergenic
1107189967 13:37569823-37569845 TATGAGAAGGACAATGAAAAAGG + Intronic
1108691807 13:52865843-52865865 GAGCAAAAGAAAAATGAACAAGG - Intergenic
1109843345 13:67949930-67949952 AATGAGAAGACTAAAGAACAAGG - Intergenic
1109861807 13:68209439-68209461 TTTGAGAAGAATAAAGAAAAGGG - Intergenic
1110403203 13:75118434-75118456 TAGGGAAAAAATAATGGACATGG + Intergenic
1110468715 13:75832852-75832874 TAGCAGAAAAATAATAAACTTGG + Intronic
1111434109 13:88184044-88184066 TAAGAGAAGAATAATGGAAAAGG + Intergenic
1111965544 13:94858013-94858035 AAGAAGAAGAATAATGAATGTGG - Intergenic
1112560297 13:100506772-100506794 TAGGAGGAGAAAAAGGAAGAGGG + Intronic
1115448058 14:33514486-33514508 TAGGAGAAGAATATTCACCAAGG - Intronic
1115886569 14:37978302-37978324 TAGGAAAAGAATAAGGAAAAGGG + Intronic
1116680526 14:47963794-47963816 TAAAAGAAAAATAATTAACAAGG - Intergenic
1118264646 14:64283422-64283444 TAAGAGAAGATCAATGAGCAAGG + Intronic
1118333668 14:64833740-64833762 TGGGATAAGAAGAATGAATATGG - Intronic
1119437548 14:74607672-74607694 TTGCAGAAGAATAATGAAATAGG + Intronic
1120380895 14:83778064-83778086 GATGAAAAGAATAATGTACATGG - Intergenic
1120815675 14:88855274-88855296 AAGGAGATGAAAAATGAAGAAGG - Intronic
1122449742 14:101796226-101796248 TAGTTGAAGAATAATAAAAATGG + Intronic
1123775702 15:23577788-23577810 TAGGAGAAAAATAATAAATGTGG + Intronic
1123785964 15:23673806-23673828 TAGGGAATGAATAATGAAGATGG - Intergenic
1123889144 15:24757852-24757874 TAGGAGAATATCAAAGAACATGG - Intergenic
1124033806 15:26034874-26034896 AAGGAGAGAAATGATGAACAAGG - Intergenic
1124237252 15:28001610-28001632 GAGGAAAAAAATAAAGAACAAGG + Intronic
1125420745 15:39501583-39501605 GAGGAGATGACTAATGAAAAAGG + Intergenic
1126652193 15:50935847-50935869 TACAAGAAAAATAATGCACATGG + Intronic
1126822789 15:52521326-52521348 TAGGAGAAGTAAAATGATCAGGG - Intronic
1127048704 15:55056765-55056787 TAGGAGAAAAATAATTGACTAGG + Intergenic
1127178509 15:56388006-56388028 TAGGCATAGAATATTGAACAAGG + Intronic
1127574595 15:60278747-60278769 TATGAGAAGAAAGATGAGCAGGG - Intergenic
1127944110 15:63732639-63732661 AGAGAGAAGAATAATGAGCAAGG - Intronic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128561115 15:68668370-68668392 CAGGAGACAAACAATGAACAAGG + Intronic
1129249666 15:74301981-74302003 CAGGAGATGAATAATTGACAAGG + Intronic
1130532374 15:84757297-84757319 AAAGAAAAGAATAATGATCAGGG - Intronic
1132004092 15:98210628-98210650 AAGGAGAAAAAGAAGGAACAAGG + Intergenic
1132922333 16:2403941-2403963 TAGGATAAGAATAATGGGCCAGG - Intergenic
1133974211 16:10588905-10588927 TAGGAGAAGAATAATCCAAAGGG + Intergenic
1134161633 16:11895109-11895131 AAGGAGAAGGGTAATGAACTAGG - Intronic
1134816802 16:17212578-17212600 TGGGAGAAAAATAATGAATGAGG - Intronic
1135012140 16:18891400-18891422 CAGGAGAAAATTAATGAAAATGG - Intronic
1135074941 16:19384979-19385001 CAGGAGCAGAAGAATGAACCAGG + Intergenic
1135182158 16:20284833-20284855 GGGGGGAAGAATAGTGAACAGGG + Intergenic
1135318996 16:21478624-21478646 CAGGAGAAAATTAATGAAAATGG - Intergenic
1135371894 16:21910417-21910439 CAGGAGAAAATTAATGAAAATGG - Intergenic
1135439894 16:22460287-22460309 CAGGAGAAAATTAATGAAAATGG + Intergenic
1135706239 16:24677463-24677485 GAGCAAAAGAAAAATGAACATGG - Intergenic
1136329301 16:29560694-29560716 CAGGAGAAAATTAATGAAAATGG - Intergenic
1136443930 16:30300405-30300427 CAGGAGAAAATTAATGAAAATGG - Intergenic
1138301939 16:55937735-55937757 AAAGAGAAGAATTATGAAGAAGG - Intronic
1138821526 16:60265966-60265988 TAGGATAATAATGATGAACATGG - Intergenic
1139500138 16:67356463-67356485 TAAGGGAGGAATAATGAATATGG + Intronic
1139873232 16:70124445-70124467 TATGAGAACAATAGTGAAGATGG - Intronic
1140157202 16:72443526-72443548 TATGGGAAGAATATTGATCAAGG - Intergenic
1140536217 16:75712208-75712230 TAAGAGAAGAATCATGGAAAAGG + Intronic
1141060927 16:80868916-80868938 TCTCAGAAAAATAATGAACAAGG + Intergenic
1144134467 17:12280072-12280094 TAAGAAAAGAATAATAAATAAGG + Intergenic
1144421254 17:15101267-15101289 TAGATGAATAATAATGAACTGGG - Intergenic
1148508818 17:48150576-48150598 TAGGAAATAAATAATGAAAATGG - Intronic
1149412033 17:56418756-56418778 TAGGGGAAATATAATGAACTGGG - Intronic
1149426479 17:56559287-56559309 TAGGATAAGAAGAATGCACTTGG - Intergenic
1149982607 17:61323274-61323296 GAGGAGAAGAATAATCAGAACGG - Intronic
1151383734 17:73742787-73742809 TGGGAGAAGAGCAAGGAACACGG + Intergenic
1152692752 17:81727683-81727705 CAGGAAAAGTATAATGAACCCGG - Intergenic
1153015208 18:576952-576974 TAAGAGAAGAATAAGGGAAAGGG - Intergenic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1155046441 18:22107600-22107622 AAAGAGGAGAATAATGAACATGG + Intergenic
1155179642 18:23333180-23333202 GAGGAAAATAATAATAAACATGG + Intronic
1155361648 18:25009148-25009170 TAGGTTAAGAATACTGAGCAAGG + Intergenic
1155614384 18:27704133-27704155 TAGTAGATGAATTATGAACAAGG + Intergenic
1155631908 18:27904332-27904354 TAGGAGAAGAATAATTGCTACGG - Intergenic
1155736718 18:29233269-29233291 CATGAAAAGAATAGTGAACAAGG + Intergenic
1155891532 18:31276647-31276669 TAAGAGAAGAATAAAGAATGTGG - Intergenic
1158399459 18:57108370-57108392 TAGCTGAAGATTAATGAACCAGG + Intergenic
1158832701 18:61297580-61297602 GAGGAGAAGATGAATGAACTTGG + Intergenic
1158999464 18:62958384-62958406 TATAGGAAGAATAAAGAACATGG + Intronic
1159973577 18:74682435-74682457 TAGAAAAAGAATGATGGACATGG - Intronic
1159989853 18:74891946-74891968 TAGGAGAATAATTATTGACATGG - Intronic
1160090150 18:75819205-75819227 ATGGAGAGGAAGAATGAACATGG + Intergenic
1160478774 18:79219027-79219049 CAGGATAAGAATAATGAATGAGG + Intronic
1163269656 19:16244557-16244579 TGGGAGGAGAATAAATAACATGG + Intronic
1163694159 19:18754770-18754792 TAGGATAAGAATATTGGAAAAGG + Intronic
1166258247 19:41620678-41620700 TAGGGGCAGAATAAAGGACAAGG + Intronic
1166858850 19:45797913-45797935 GAGGAGACTGATAATGAACAAGG + Intronic
1166920465 19:46225994-46226016 TAAAAGAAGAAGAATGAAGAAGG + Intergenic
1167255179 19:48423322-48423344 GAGGATAAGAAAAATGCACACGG - Intronic
925778171 2:7355459-7355481 TAACAGAAGAAAAATAAACAAGG - Intergenic
926946219 2:18190236-18190258 TTGGAGCAGAATAAAGAAGATGG + Intronic
927803467 2:26122934-26122956 TAGGAAAAGAAGAAAGCACAGGG + Intronic
929781667 2:44961192-44961214 GAGGAGGAGACTAATGAGCAGGG - Intergenic
929943843 2:46355698-46355720 TTGGAGATAAATAATGAACTAGG + Intronic
930213020 2:48662878-48662900 TAGGAGGGGAACAATGAACACGG + Intronic
930225890 2:48792658-48792680 TAGGAGAAGAAAGATGATGATGG - Intergenic
930331540 2:49991630-49991652 TTTGACAATAATAATGAACATGG - Intronic
931545286 2:63377103-63377125 TAAGGGAAGAGTAAGGAACAGGG + Intronic
932592049 2:73073532-73073554 TAGGAGAAGAAACATCAACAAGG + Exonic
933553410 2:83803209-83803231 TAGCTGAAGAATCATGAAAAGGG - Intergenic
933770706 2:85742157-85742179 TAGAGGAAGAAAAATAAACATGG - Intergenic
935019201 2:99214095-99214117 TACCAGAAGAAGAATGAACTGGG - Intronic
937195234 2:120149034-120149056 TAGGATGAGTATAATAAACAAGG - Intronic
938831236 2:135052198-135052220 TAGGGCAAGACTCATGAACAGGG + Intergenic
939106833 2:137958677-137958699 CAGAAGAAGAAAAATGAAAAAGG + Intergenic
939160925 2:138587907-138587929 AGGGAGAATAATAAAGAACAGGG - Intergenic
939409652 2:141808099-141808121 CCGGTGAAGAATGATGAACAAGG - Intronic
939667352 2:144967915-144967937 TTAGAGCAGAAGAATGAACATGG + Intergenic
939856638 2:147366534-147366556 TGGGAGAATAATATTGAACAGGG - Intergenic
940761234 2:157741678-157741700 GAGGAGCAGAATAATGAGAAAGG + Intronic
940812428 2:158260131-158260153 TAGGAATAGAATAGTGAATAAGG - Intronic
941609781 2:167646417-167646439 TAGGAGAAGGAAGAGGAACAGGG - Intergenic
942464237 2:176190236-176190258 TGGGAGAACAAAAATGAATAGGG + Exonic
942930365 2:181484928-181484950 TTTGAGAAGAATAAAGGACATGG + Intronic
943146382 2:184050739-184050761 TAGTAGCAAAATAATGGACATGG + Intergenic
944996581 2:205301589-205301611 AAGGAGAAGAAAAAGGAAAAGGG + Exonic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946673380 2:222130421-222130443 TATGAGACGAATAATGAATGTGG - Intergenic
946983885 2:225249562-225249584 CAGGAGAAGGAGAATGAACTGGG + Intergenic
947251775 2:228114763-228114785 TAGGAGAAGAAAAATGAGAATGG - Intronic
948086048 2:235249273-235249295 TAGGAGAAGAATAAAGCCAAGGG + Intergenic
1169247674 20:4036569-4036591 TTGGAGAGGACCAATGAACAAGG + Intergenic
1169826044 20:9769909-9769931 TAGTAGAAGAATATAGAACTAGG + Intronic
1169826294 20:9772337-9772359 TAGGAGAAGGATGATCAGCAAGG + Intronic
1170898201 20:20435538-20435560 AAGGAGAAGAGTAGGGAACAGGG + Intronic
1171377846 20:24706411-24706433 AAGGAGAGGAATAATAAATAGGG - Intergenic
1171529757 20:25845248-25845270 TAGGTGATAAATAATAAACAGGG - Intronic
1173111391 20:40193715-40193737 TAGAATAAGAAGCATGAACAAGG - Intergenic
1173388434 20:42609697-42609719 TAGGAGAAGGGCAAGGAACAGGG + Intronic
1173468724 20:43305676-43305698 TTGGAGAAGAGTAAGGAAGAGGG + Intergenic
1177533143 21:22389193-22389215 TGGAAGAAGAAATATGAACAAGG - Intergenic
1177898794 21:26887813-26887835 TAGAATAAGCACAATGAACATGG + Intergenic
1178014011 21:28321420-28321442 TAGGAAAAGAATAAATAAAATGG - Intergenic
1178078974 21:29042669-29042691 TAGGATTTGAATAAAGAACAGGG + Intronic
1178140393 21:29676289-29676311 TGGGGGAAGAACAAAGAACAGGG + Intronic
1178151995 21:29805672-29805694 TAGGAGAGTACTAATGCACAGGG + Intronic
1178201058 21:30405756-30405778 GAGGAGAAGAATAAGAAAGAGGG - Intronic
1179076384 21:38126248-38126270 TTGCTGAATAATAATGAACATGG + Intronic
1179334208 21:40434935-40434957 TAGGAAACGAAGAAAGAACATGG + Intronic
1179383888 21:40924154-40924176 TAGAAGAAGAGTAATTAACATGG + Intergenic
1180745144 22:18083349-18083371 TAGGAGAAGCATAGTGGTCATGG + Intronic
1183141466 22:35945018-35945040 AAGGGGAAGAATAATGAAAATGG + Intronic
1183387182 22:37521526-37521548 CAAGAGGACAATAATGAACATGG - Intergenic
1184906899 22:47494184-47494206 TAGGAGAAGGTTACAGAACAAGG - Intergenic
949983937 3:9523769-9523791 TAAGGGAAGAATATTGAAGAAGG - Intronic
951305875 3:21061395-21061417 TAGGAGAAGGAAAAAGAACATGG - Intergenic
951544118 3:23808225-23808247 GAGGAAAAGAATAAAGAAAAAGG - Intronic
951614664 3:24528838-24528860 GAGAAGACGAACAATGAACACGG + Intergenic
952121354 3:30248708-30248730 TAGGAGAAGAAGAATGAGATAGG - Intergenic
952658579 3:35817653-35817675 AAGGAGAAAAAAAATCAACATGG - Intergenic
953328441 3:42032236-42032258 TATGGTAAGAATAATCAACACGG + Intronic
954772397 3:52983534-52983556 TAGGAGAAAAAAACTGAACAAGG + Intronic
954852130 3:53611735-53611757 GAAGAAAAGATTAATGAACATGG - Intronic
954927482 3:54249077-54249099 AAGGAGAAGAATAAACAGCATGG + Intronic
955307393 3:57848145-57848167 GAGGAGAAGAAGAAGGAAGAAGG - Intronic
955489901 3:59471542-59471564 TAAGAGAAAAATAAAGAATAAGG + Intergenic
955585986 3:60478546-60478568 TATGAGAAGAGTAACGATCATGG + Intronic
957696949 3:83650812-83650834 AAGGAGAAGAATAAAAGACATGG + Intergenic
957781641 3:84825540-84825562 CAAAAGAAGAATAATGAAAAAGG + Intergenic
957847587 3:85758081-85758103 TAGAAAAACAATAATGGACAGGG + Intronic
959067347 3:101671536-101671558 TAGGTGAGGTAGAATGAACATGG - Intronic
959101899 3:102020134-102020156 TAGGACAATAAAAAAGAACAAGG - Intergenic
960427825 3:117530790-117530812 AAGGAGAAGAAAGATGAAGAGGG - Intergenic
960930891 3:122848514-122848536 GAGGAGAAATATAATGATCATGG - Intronic
962823820 3:139080767-139080789 AAGGAGAAGTATAATCATCAGGG + Intronic
963655822 3:148049077-148049099 TAGGACAGGAAAAAAGAACAGGG - Intergenic
964018643 3:151979264-151979286 TTAGAGAAGAAAAATGAAAAAGG - Intergenic
964161240 3:153648258-153648280 AATGAGAAAAATAATGAAAATGG + Intergenic
964298379 3:155259525-155259547 TGGGAGAAAAATAATCATCAGGG - Intergenic
964535440 3:157716272-157716294 GAGGGGAGGAATAATGAAGATGG + Intergenic
966038283 3:175447420-175447442 TAGGAGATTAAAAATGATCATGG - Intronic
966666135 3:182472993-182473015 TAGAAGAAGAAGACTGAAGAGGG - Intergenic
966767405 3:183475674-183475696 AAGGAGAAGAAAAATGTAGATGG + Intergenic
966831786 3:184016715-184016737 TAGAAGCAGAATAATCAACGTGG + Intronic
967539481 3:190648701-190648723 TATGAAAGGAATAATGAAAAGGG + Intronic
967560220 3:190908722-190908744 TAAGAGGAGAATAATGGACCTGG - Intergenic
968276667 3:197445632-197445654 AAGGAGCAGAAGAAGGAACAGGG - Intergenic
970142846 4:13001293-13001315 TAGGAGAAGAAAAATGACCTAGG - Intergenic
970285973 4:14515624-14515646 TAGGAAAACAAAAATTAACAGGG - Intergenic
970871874 4:20825713-20825735 TGGGAGATGAGTCATGAACATGG + Intronic
970881710 4:20939939-20939961 TATGAGAAGAATAAGGCTCAAGG - Intronic
970882997 4:20953863-20953885 TAGGAGAAGAAGAAGAATCAGGG - Intronic
971743310 4:30547480-30547502 AAGGAGAAGAATAATTATGAAGG + Intergenic
972039680 4:34577234-34577256 CAGGAGAAGAATAATGGGCCGGG - Intergenic
972300980 4:37785390-37785412 TAGGAGAGGAAGAATTAGCAGGG + Intergenic
972620090 4:40738954-40738976 TAAGAGAAGAATATTAAACCAGG - Intergenic
972771850 4:42204655-42204677 TAGGCAAAGAATAAGGAAAAAGG - Intergenic
973252065 4:48070990-48071012 CAGGAGAAGAATCTTGAACCTGG - Intronic
973753633 4:54049760-54049782 GAGGGGAAGAATAAGGAAAAAGG + Intronic
973983840 4:56330734-56330756 TTAGAGAAAAATAATGAACGGGG + Intergenic
974106513 4:57475539-57475561 TGGGAGATGAATACTGAGCAAGG + Intergenic
974498715 4:62667936-62667958 TAGAAGAGGAAGAATGAATAGGG + Intergenic
974809504 4:66927827-66927849 AAGGAGAAGAAAAAAGAAAAGGG + Intergenic
974898217 4:67965234-67965256 TAGGAGAAAAATTATGCTCAAGG - Intergenic
975053364 4:69894669-69894691 TAAGAGATGAAAAATGAATATGG + Intergenic
975514257 4:75227572-75227594 TAGGAGAATAATACAGTACAGGG + Intergenic
976127333 4:81847966-81847988 TAAGATAAGATTAATGCACATGG - Intronic
976323092 4:83738162-83738184 TAGAAAATGAATAATGAAGACGG + Intergenic
976491550 4:85676548-85676570 TGGGAAAAGAACACTGAACAAGG + Intronic
976692866 4:87887204-87887226 CAGGAGAAGAAATATGAACTTGG - Intergenic
977036920 4:91965627-91965649 CAGGAGCAGAAGAATGATCATGG - Intergenic
977714758 4:100169686-100169708 AAGTAGAAGAGCAATGAACAAGG - Intergenic
977915129 4:102583737-102583759 TAGGAGAATAATAATTAAGGTGG - Intronic
979153719 4:117355478-117355500 TAGGAGAAGAAATGTGAAAAAGG + Intergenic
979884229 4:126004296-126004318 TAGAAGAACAATAATATACATGG - Intergenic
980281122 4:130721114-130721136 TTTGAGAAGAATAATGGAAATGG - Intergenic
980706256 4:136499562-136499584 TTGGAGAAGAAAAGAGAACAAGG + Intergenic
981321522 4:143396975-143396997 TAAGAGAAGAATAACCAGCAGGG + Intronic
981860713 4:149352968-149352990 TATAAGAAGAATAATCAACATGG + Intergenic
983057324 4:163113330-163113352 TAGGAGAGGAATTATGAAAGTGG - Intronic
983563047 4:169120526-169120548 TAGTAGAAAAATACTGAAAATGG + Intronic
983686437 4:170414797-170414819 TAAGTTAAAAATAATGAACATGG - Intergenic
983866311 4:172771389-172771411 TAGGAGAGAAATAATAAACTCGG - Intronic
985115489 4:186585932-186585954 TAGGCCACGAATAATGAACTGGG + Intergenic
988169896 5:27639871-27639893 TAGGAGAAGAAGAAAGAAAAGGG - Intergenic
989476487 5:41880240-41880262 GAGGAGATGAAGACTGAACAAGG + Intergenic
989734731 5:44690088-44690110 TAGGAGAAGGCTACTGAATATGG + Intergenic
989990865 5:50764159-50764181 CATGAGACGAATAATAAACAAGG - Intronic
992177187 5:74161488-74161510 TAGAAGAGAAATCATGAACATGG + Intergenic
992918345 5:81483021-81483043 AAGGAGAGGAATAGTGATCAGGG + Intronic
993598269 5:89886988-89887010 TAGGACAAAAATAGTGAAAACGG + Intergenic
993798049 5:92294910-92294932 TACGTGATGAATAATGAAGATGG - Intergenic
993942287 5:94074002-94074024 TAGGTTAAGAATCAGGAACAAGG - Intronic
994389711 5:99177302-99177324 TAGGAAAATAATAATCCACAAGG - Intergenic
995023763 5:107396162-107396184 AAGGAGAATAATAATGAAAGGGG - Intronic
995088963 5:108149827-108149849 TAGGAGCAGAAAAATAATCAAGG - Intronic
995160336 5:108972432-108972454 AAGGAGACTAATAATGAAGATGG - Intronic
995918705 5:117284142-117284164 CAGGAGAAGCAGATTGAACACGG - Intergenic
995962270 5:117856684-117856706 GAGGAGAAAGATATTGAACATGG - Intergenic
996767475 5:127048914-127048936 TAGGAGAAGAATCAGCAACCTGG + Intronic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997154148 5:131533950-131533972 TAGCAGAAGCATGAAGAACAAGG - Intronic
997215947 5:132110770-132110792 TAGAGGAAGAATAATGATCTGGG + Intergenic
997222026 5:132177270-132177292 TAAGGGAAGTATAATGAACCTGG + Intergenic
997807497 5:136933629-136933651 TAGGAGACGTATAATGAACATGG + Intergenic
1000294444 5:159900928-159900950 TTTGAGAAGAATAATGAAAGAGG + Intergenic
1000387799 5:160691712-160691734 TATGAGAAGAATTATGATGAGGG - Intronic
1000753129 5:165121940-165121962 TAAGAGAAGAACAATGAATCTGG - Intergenic
1002930179 6:1628741-1628763 TAGGAGAAGATGTATGGACAGGG + Intronic
1003096990 6:3149957-3149979 TAGAAGAAGCAGAATGAAAAAGG + Intronic
1003614051 6:7639360-7639382 TAGGTCAAGAATTATTAACAAGG + Intergenic
1003631860 6:7794620-7794642 AAGGAGAAGAAGAATGTAAAGGG + Intronic
1005238201 6:23790909-23790931 TAGGGGAGCAATCATGAACAAGG + Intergenic
1005433035 6:25778710-25778732 TAAGAGGAGAATAAAGCACAAGG + Intronic
1005563662 6:27067362-27067384 TAAAAGAAGCATCATGAACATGG + Intergenic
1005819470 6:29585770-29585792 TAGGAGAAAAATAATGAGAGTGG + Intronic
1007242753 6:40438965-40438987 GAGTGGAAAAATAATGAACATGG + Intronic
1007647508 6:43394370-43394392 TGGGAGAAAAATAATGTAAAAGG + Intergenic
1007662913 6:43497336-43497358 TAGGAGAAGAAATCTGAAAAGGG - Intronic
1008689957 6:53966929-53966951 TATAAGAAGAATAATATACAAGG - Intronic
1010062433 6:71638879-71638901 TAGGAAAAGAATATTTAAAAAGG + Intergenic
1010635709 6:78256902-78256924 TAGGAGACATATAATGAACTTGG - Intergenic
1012308164 6:97685957-97685979 GAGGAGAAGAGTAATGGAGAAGG - Intergenic
1012317835 6:97801743-97801765 TTGGAGAATAATTATGAAGAGGG - Intergenic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1015016313 6:128417826-128417848 TATGAGAAGAAAAAGGAACGTGG + Intronic
1015464805 6:133536993-133537015 AAGGATAAGAAGAAGGAACATGG - Intergenic
1015741200 6:136455981-136456003 CAGGAAAAGTATAATAAACAGGG - Intronic
1016081139 6:139858266-139858288 TAGCATAAGAAAAATGAACTTGG - Intergenic
1016521214 6:144949158-144949180 CAGTAGAATAATAATAAACATGG - Intergenic
1016813308 6:148281580-148281602 TCGGAGCAGAATAATGGACAGGG + Intronic
1017346481 6:153388737-153388759 TAAGAGAACAGTAATGAATATGG + Intergenic
1017783401 6:157734074-157734096 TAGGATAAGAATATTGAACTAGG + Intronic
1018524147 6:164689044-164689066 TAGAAGAATAAATATGAACAAGG - Intergenic
1020231311 7:6321126-6321148 TATTAGAAGAATAGTGAATATGG + Intergenic
1021151439 7:17155954-17155976 AAGGAGAAGAAAAATAAACTGGG + Intergenic
1021768408 7:23972116-23972138 TCAGAGAAAAAGAATGAACAGGG - Intergenic
1022853999 7:34297779-34297801 GAGAAGAAGAATAATGGACAAGG + Intergenic
1023097155 7:36672976-36672998 AAGCAGAAGAAGGATGAACACGG + Intronic
1023663882 7:42499616-42499638 TGGTAGGAGAATAATGGACATGG + Intergenic
1023808376 7:43891284-43891306 TAGGAAAACAATTCTGAACAAGG + Intronic
1024303865 7:47909853-47909875 CTGGGGAAGAATAGTGAACATGG + Intronic
1024825590 7:53386325-53386347 TAGAAGATGAATTATGAACATGG - Intergenic
1026373050 7:69721088-69721110 AAGGAGATGAAGAATGACCAGGG + Intronic
1029323815 7:99788526-99788548 TAAGAGGAGAATAGAGAACAGGG - Intergenic
1030184032 7:106741920-106741942 TAGCAGAAGGATAAAGGACACGG - Intergenic
1030893841 7:115031888-115031910 GAGGAGATGAAGAATGAACTTGG + Intergenic
1030983601 7:116214070-116214092 GAGGAGAGAAAAAATGAACACGG - Intronic
1031593492 7:123621587-123621609 TAGGGTAAGAAAAATTAACATGG - Intronic
1031897496 7:127368185-127368207 TAGGAGAAGAGAAATGAATTTGG + Intronic
1033353536 7:140581668-140581690 GATGAGCAGAATAATGAGCACGG + Intronic
1033678246 7:143566201-143566223 TAGGAGAGGGACAATGAACTTGG + Intergenic
1033691051 7:143737601-143737623 TAGGAGAGGGACAATGAACTTGG - Intergenic
1033693595 7:143763245-143763267 TAGGAGAGGGACAATGAACTTGG - Intergenic
1033957810 7:146873636-146873658 TATGAGAAGAATAATAAGCATGG + Intronic
1033968325 7:147006246-147006268 TAGGAGAAGTATACTAAACAAGG + Intronic
1034467215 7:151237205-151237227 GAGGTGAAGAATAACGTACAAGG + Intronic
1035050299 7:155994824-155994846 TAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1035419682 7:158717224-158717246 TAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1035779887 8:2219768-2219790 TGGGAGAAGAAAAGTGATCAAGG - Intergenic
1037495018 8:19430797-19430819 TTGAAGAATATTAATGAACATGG + Intronic
1037650283 8:20831039-20831061 TATGAGAATGAAAATGAACAAGG + Intergenic
1038115264 8:24546700-24546722 TAGGAGAAAAATAATAATGAGGG + Intergenic
1039026008 8:33258850-33258872 TAAGAGAAGAAAAATAAACCAGG - Intergenic
1040754615 8:50757737-50757759 TAAAATAAGAATAAAGAACAAGG - Intronic
1041255141 8:55973520-55973542 TCAGAGAAGAAAAATGAACTTGG + Intronic
1041733844 8:61089471-61089493 TAGGAAAAAAATAATAAACCAGG - Intronic
1042416717 8:68528428-68528450 AAGGAGAAAAATTAAGAACAAGG - Intronic
1042975212 8:74461115-74461137 TAAGAGCAGAAAAATGAAGAGGG - Intronic
1043270291 8:78324832-78324854 TTGGAGAAGAATCCTGAACAAGG + Intergenic
1043572789 8:81624101-81624123 TAAGAAAAGAATGGTGAACAGGG + Intergenic
1043632583 8:82354857-82354879 AAGGAGATGAATACTGAAGAAGG + Intergenic
1044240570 8:89883791-89883813 TAGGAGAATAATTATTAACTTGG - Intergenic
1044340160 8:91037598-91037620 TAGGAGAAGAAAAATAGTCATGG - Intronic
1045370147 8:101514913-101514935 AAGGAGAAGAAGAAAGAACAAGG - Intronic
1046669835 8:117045182-117045204 TAGGAGAAGAATAAGGCTAATGG - Intronic
1046673583 8:117084212-117084234 GAGGAGAAGAATAAAGAAATTGG + Intronic
1047343101 8:124001633-124001655 TAAGGTAAGAATAATGAAGAAGG + Intronic
1049133062 8:140866456-140866478 TTAGAGAAGCATAAGGAACATGG + Intronic
1049954797 9:682646-682668 AAGGAGGAGAAAAATGACCAGGG - Intronic
1049968955 9:804478-804500 CCGGAGAAGAAAATTGAACAAGG - Intergenic
1050683913 9:8145934-8145956 AAGGAGAAGGATAAAGGACATGG + Intergenic
1051024330 9:12588795-12588817 TGGGAGAAAAATAATTAACTGGG + Intergenic
1051395651 9:16617397-16617419 TATGAAAAGAATTATGAAAATGG + Intronic
1051546148 9:18278044-18278066 TAGGGGAAGAATAATTAAAGTGG - Intergenic
1052364851 9:27600650-27600672 TAGGAAAAGAATACTGTAGAAGG + Intergenic
1052823464 9:33158261-33158283 TAGAAAAAGAATAAAGACCAGGG + Intronic
1053260386 9:36658312-36658334 TAGATAAAGAAAAATGAACAGGG - Intronic
1054929604 9:70622317-70622339 TAGACGAAGACAAATGAACAAGG + Intronic
1058409337 9:104713757-104713779 TTGGAGAAGAATAAGGAAAAGGG - Intergenic
1058601463 9:106675240-106675262 GAGGAGAAAAATAATAATCAGGG - Intergenic
1058794656 9:108486323-108486345 GAGGTGAAGAATAAGGAAGAAGG + Intergenic
1058814781 9:108672950-108672972 TTTAAGAAGATTAATGAACAGGG - Intergenic
1059427569 9:114230810-114230832 TAGGAGAGAAATATTGAATATGG + Intronic
1059549384 9:115213570-115213592 TAGGAGATGAACAATTAATAAGG - Intronic
1059708334 9:116844265-116844287 TAGGAGAAGAATAATGAACATGG - Intronic
1060428876 9:123530555-123530577 TGGGAAAATAATAGTGAACATGG + Intronic
1061785369 9:133024698-133024720 TAGGAGATGAATACAGATCAGGG - Intergenic
1185815174 X:3148334-3148356 TTGGAGAAGAAAGATGAAGAGGG + Intergenic
1185967679 X:4625937-4625959 TATGAGAAGAACAATAATCAGGG + Intergenic
1186296224 X:8151432-8151454 TATGAGAAGTATAATCAATATGG + Intergenic
1186506693 X:10099269-10099291 GAGGAGAAGAATATTGAAAACGG - Intronic
1186956674 X:14689395-14689417 TAGAAGAAAAATAAGTAACATGG + Intronic
1187682668 X:21783389-21783411 CAGGAGAAAAATAATGAAATAGG - Intergenic
1189251455 X:39603393-39603415 TAGGAACAGAACAATAAACAAGG - Intergenic
1189702767 X:43729110-43729132 CAGGAGAAGAATAATTCACTTGG - Intronic
1190568428 X:51755625-51755647 AAAGAGAAGAAAAAGGAACAAGG - Intergenic
1191811913 X:65197944-65197966 TTGGAGAAAAAGAGTGAACAGGG - Intergenic
1191996050 X:67096101-67096123 TAATAGAAGAATAATAAAGATGG - Intergenic
1193414174 X:81201858-81201880 GAGGAGAAGAAGAAAGAAAAAGG - Exonic
1193583750 X:83295115-83295137 TAAGGGAAGAATCATGAAGAAGG + Intergenic
1193732749 X:85120978-85121000 TAGTAGAAGAACAATGAACTGGG + Intergenic
1194062260 X:89218002-89218024 TAGAAAAAGAATAAATAACAGGG + Intergenic
1194112374 X:89851016-89851038 TAGGAGAAGAATCATACACTAGG + Intergenic
1194553069 X:95325026-95325048 TAAGGGAAAAATAATGAAAAAGG - Intergenic
1195054455 X:101129996-101130018 AAGGTGAATAATTATGAACATGG + Exonic
1195108851 X:101625063-101625085 TAGGGGAAGAAAACAGAACAAGG + Exonic
1196086482 X:111688629-111688651 TTTGAGAAGAATAATCAAAAAGG + Intronic
1196188810 X:112773500-112773522 TTGGAGAAAAAAAATGTACATGG - Intergenic
1197071277 X:122300473-122300495 TAGGTGATGAGTAATGAAAATGG - Intergenic
1197140433 X:123111826-123111848 GAAGAGAAGAATAATGATGAGGG - Intergenic
1197288950 X:124631597-124631619 TAGGATAAAAATAATGAATCTGG + Intronic
1197381796 X:125752879-125752901 TTGAAAAAGAATAATGAACTTGG + Intergenic
1199112320 X:143949488-143949510 AAGGAGAAGAATAAGCAAAAGGG + Intergenic
1199345838 X:146738325-146738347 TAGTACAAAAATAATGGACATGG + Intergenic
1199585384 X:149410771-149410793 AAGATGAAGAAAAATGAACAAGG - Intergenic
1199609908 X:149604425-149604447 TATGAGAAGAAGGATGCACAAGG - Intronic
1200465028 Y:3505820-3505842 TAGGAGAAGAATCATACACTAGG + Intergenic
1200716128 Y:6546963-6546985 TAGAAAAAGAATAAATAACAGGG + Intergenic
1200923783 Y:8636306-8636328 TCACAGAAAAATAATGAACACGG - Intergenic
1202023085 Y:20488284-20488306 TAGAAGAACAACAATAAACATGG + Intergenic