ID: 1059708962

View in Genome Browser
Species Human (GRCh38)
Location 9:116849720-116849742
Sequence GCCTGTTAAACCTAGCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059708962_1059708967 29 Left 1059708962 9:116849720-116849742 CCATGCTGCTAGGTTTAACAGGC 0: 1
1: 0
2: 1
3: 6
4: 104
Right 1059708967 9:116849772-116849794 AAAACTCAATTAGCAGCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059708962 Original CRISPR GCCTGTTAAACCTAGCAGCA TGG (reversed) Intronic
901907622 1:12427950-12427972 GCCTCATAAAAATAGCAGCATGG - Intronic
904685001 1:32253408-32253430 GCCTGTTAATCCTAGCACTTGGG - Intronic
905511820 1:38527807-38527829 GCCTGTTCATCAGAGCAGCAGGG - Intergenic
912334328 1:108848052-108848074 GCTTCAGAAACCTAGCAGCATGG - Intronic
913629767 1:120697897-120697919 GCCTGTTAATCCCAGCAGTTTGG - Intergenic
914560328 1:148811894-148811916 GCCTGTTAATCCCAGCAGTTTGG + Intronic
914612505 1:149318321-149318343 GCCTGTTAATCCCAGCAGTTTGG - Intergenic
917180917 1:172296840-172296862 GCCTTTTAAACATAGCATCTTGG + Intronic
923848875 1:237770556-237770578 CTCTGTTAAAAGTAGCAGCATGG - Intronic
924721015 1:246623081-246623103 GCCTGTTAATCCTAGCACTTTGG - Intronic
1066000013 10:31095911-31095933 GCCTGTTGGAGCAAGCAGCATGG - Intergenic
1070173885 10:73954134-73954156 GCCACTTAATCCTGGCAGCAAGG - Intergenic
1070797817 10:79227263-79227285 GGGTGTTTAACCTACCAGCAAGG - Intronic
1071580223 10:86762482-86762504 GCCTGTTAAACCCAGCTACTCGG - Intronic
1075705231 10:124496659-124496681 CCCTGTTAATCATTGCAGCAGGG + Intronic
1075868974 10:125754088-125754110 GCCTGTTAATCCTAGCTACAGGG + Intronic
1077518694 11:3018253-3018275 GCCTGTTATACCCACTAGCATGG + Intronic
1079813667 11:25027743-25027765 GCCTGTTAATCCCAGCAACTCGG + Intronic
1080395077 11:31882657-31882679 GCTTGTCACACCTAGCCGCAAGG + Intronic
1081911653 11:46703990-46704012 ACCTGTTAAGCCTAGCATCTTGG - Intronic
1082049477 11:47759042-47759064 GCCTGTTAATCCTAGCTACTCGG - Intronic
1084807164 11:71587039-71587061 CCCTGCTAAACCTGGCAGAAGGG + Intronic
1085740928 11:79077871-79077893 GCCTCTGAAAACTAGCTGCAGGG - Intronic
1091251359 11:134146824-134146846 GCCTGTTAATCCCAGCACCTGGG - Intronic
1092202849 12:6597501-6597523 GCCTGTTAATCCTAGCACTTAGG + Intronic
1093253003 12:16831642-16831664 TCATGTTAAACCTAGCCTCAGGG + Intergenic
1098188256 12:67921447-67921469 GCATGTTAAAGCTAGCAGCAGGG + Intergenic
1099331496 12:81294672-81294694 ACCTATTAAAAGTAGCAGCAAGG + Intronic
1100314993 12:93437000-93437022 GCCTGTTAACCCTAGCACTTTGG + Intronic
1106715322 13:32382348-32382370 GCCTTTTATACTTAGAAGCAGGG + Intronic
1107066067 13:36215111-36215133 GCCTGTTAATCCTAGCACTTTGG + Intronic
1108530283 13:51321710-51321732 TCCTGTTTTACCTTGCAGCAAGG - Intergenic
1110526526 13:76544637-76544659 GCCTGCTAAACCTAACATCTAGG - Intergenic
1113150971 13:107263171-107263193 TCCTTTTTAACCCAGCAGCAGGG + Intronic
1113395004 13:109939292-109939314 GCCTTTTAAACAGAGAAGCATGG + Intergenic
1115648596 14:35387062-35387084 GCCTATAAAATCTAGCTGCAGGG - Intergenic
1119609789 14:76052059-76052081 GCCTGTTCTGCCTTGCAGCAGGG + Intronic
1122361409 14:101168957-101168979 GCCTGTTAATCCCAGCACTATGG + Intergenic
1122809977 14:104283066-104283088 GGCTGTTAAACACAGGAGCAGGG + Intergenic
1123165779 14:106323984-106324006 GACTGTTAAAACCTGCAGCAAGG + Intergenic
1130956357 15:88629989-88630011 GCCTGTTACCCCAAGAAGCAAGG - Intronic
1132183509 15:99781404-99781426 TCCAGTGAAACCTACCAGCAGGG - Intergenic
1132434871 15:101791762-101791784 TCCAGTGAAACCTACCAGCAGGG + Intergenic
1134109717 16:11507436-11507458 GGCTGTTAACCCAGGCAGCATGG - Intronic
1139728706 16:68923972-68923994 GCCTGTGAAAACAAGAAGCATGG - Intronic
1144856572 17:18271800-18271822 GCCTGTTAATCCTAGCACTTTGG + Intronic
1145775060 17:27521897-27521919 GCCTGGTCTCCCTAGCAGCATGG - Intronic
1149591442 17:57832627-57832649 TCCAGTGAAACCTACCAGCATGG + Intergenic
1151184447 17:72352972-72352994 GCTTTTAAATCCTAGCAGCAAGG - Intergenic
1153119873 18:1708990-1709012 GCCTATTTAAGCTAGCAGCAGGG + Intergenic
1154486012 18:14871630-14871652 GCCTGTAAATCCTAGCACCTGGG + Intergenic
1155119107 18:22800271-22800293 GCCTGCTTAACCTAGAAGTAAGG - Intronic
1163530533 19:17846309-17846331 GCCTGTTAAACCAAACAGGAAGG + Intronic
1166599947 19:44084691-44084713 GCCTGTTAGACCCAGCAGTATGG - Intronic
924984820 2:261317-261339 GCCTCTTAAACCTCACATCATGG + Intronic
931983797 2:67722199-67722221 GCCTGTTAAAGCAGGCAGGAGGG + Intergenic
937436354 2:121884993-121885015 GCCTTTTGAACCTATCAGCGGGG + Intergenic
938229608 2:129647188-129647210 ACCTGGTATCCCTAGCAGCAGGG + Intergenic
938687598 2:133755554-133755576 GGCTGTTAAACCTTTCAGCAGGG - Intergenic
939178950 2:138781849-138781871 GCCTTTGAAACCTAGGACCAAGG - Intergenic
943156822 2:184190312-184190334 GCCTGTTAATCCTAGCACTTTGG - Intergenic
944020724 2:195100495-195100517 GTGTCTTAAACCTAGCTGCAAGG - Intergenic
944411070 2:199442619-199442641 GCCTGTTAAACCCAGCTACTTGG + Intronic
948694676 2:239727202-239727224 GCCTGGTAAAACAAGCACCATGG - Intergenic
948915518 2:241033330-241033352 GACTGTTAAACGCTGCAGCACGG + Intronic
1169742991 20:8915473-8915495 TCATGTCAAACCTTGCAGCAAGG - Intronic
1173344109 20:42182885-42182907 GACTGTTAATCCTACAAGCAGGG + Intronic
1174344317 20:49918633-49918655 GCCCTTTAAACCTAACATCAGGG - Intergenic
1177410360 21:20721694-20721716 GACTCTTAACCCTGGCAGCACGG + Intergenic
1183121874 22:35736378-35736400 GCTTGTCAAACCCAGCAGGAAGG + Intergenic
1183150370 22:36032270-36032292 TCCTGTTCAACCAAGCAGTATGG + Intergenic
949110547 3:255292-255314 GCCTTTGAATCCTAGCAGCTGGG - Intronic
959722467 3:109508023-109508045 GCCTGTTAATCCTAGCACTTTGG + Intergenic
968328712 3:197844921-197844943 CCTTATTAAACCTATCAGCAGGG - Intronic
971043897 4:22783533-22783555 GCCTTTAAAACCTTGCAGAAGGG - Intergenic
976754981 4:88488490-88488512 GCCTGTTAATCCCAGCAGTTTGG - Intronic
978429483 4:108618831-108618853 GCCTGTTAATCCTAGCACTTCGG - Intergenic
979249141 4:118545773-118545795 GCCTGGTAATCCTAGCACCTTGG + Intergenic
982300134 4:153869842-153869864 ACCTGATAAACCTTGCATCAAGG + Intergenic
989995746 5:50828448-50828470 GCAAGTTAAACCTAACAACAGGG - Intronic
992027299 5:72682847-72682869 GCCTGTTAATCCTAGCACTTTGG + Intergenic
992448166 5:76852321-76852343 GCCTGTTTACACTAGCAGCCTGG + Intronic
996378220 5:122837893-122837915 GCCTGTTAATCCTAGCACTTTGG + Intergenic
1000355996 5:160396404-160396426 GTGTGTTACACTTAGCAGCAAGG - Intronic
1002104549 5:176873641-176873663 GCAGGTTCAACCTAGCAGCCAGG + Intronic
1004098697 6:12585929-12585951 GCTTGTTTAACCTAGCTTCAGGG - Intergenic
1008626672 6:53323990-53324012 GCCTGTTAATCCTAGCACTTTGG + Intronic
1009430863 6:63564148-63564170 GCCTGGTAATCCTAGCTGCTTGG + Intronic
1010486044 6:76415958-76415980 GCCTGTTAAATCAACCAGGATGG + Intergenic
1013368324 6:109450759-109450781 GCCTGGGACACCCAGCAGCAGGG - Intronic
1014500365 6:122181168-122181190 GCCTGTGCCATCTAGCAGCAGGG + Intergenic
1016905919 6:149150842-149150864 GCCTGTTCACCTGAGCAGCAAGG + Intergenic
1017771924 6:157650485-157650507 GCCTGTTTAATGTAGCAGCTGGG - Intronic
1020273701 7:6612527-6612549 GCCTGTTAATCCTAGCACTTTGG + Intergenic
1037446064 8:18967104-18967126 GGCTGTAAGACCTATCAGCATGG + Intronic
1040813835 8:51485479-51485501 ACTGGTTAAACTTAGCAGCAGGG - Intronic
1041024584 8:53670614-53670636 ACCTGTTGAATTTAGCAGCAAGG + Intergenic
1043468799 8:80540953-80540975 GCCTGTTAATCCTAGCACTTTGG - Intergenic
1045275772 8:100703927-100703949 GCCTGTTAATCCCAGCTGCTCGG + Intronic
1045942677 8:107756711-107756733 GCCTGTTAATCCTAGCACTTTGG + Intergenic
1046593222 8:116230177-116230199 GCTTGTTAAACCTGACAGAATGG - Intergenic
1047911024 8:129529310-129529332 TCCTGTTAAAACTTGCAGCATGG + Intergenic
1049848213 8:144815290-144815312 GCCTGTTAATCCCAGCAGTTTGG + Intergenic
1051902018 9:22053449-22053471 GCATGTTTCACCTAGCAGCTTGG + Intergenic
1053364467 9:37512685-37512707 GCCTGGTGAACCCACCAGCACGG - Exonic
1053886929 9:42650450-42650472 GCCTGTAAATCCTAGCAGTTGGG + Intergenic
1054225948 9:62457900-62457922 GCCTGTAAATCCTAGCAGTTGGG + Intergenic
1059708962 9:116849720-116849742 GCCTGTTAAACCTAGCAGCATGG - Intronic
1189842919 X:45100943-45100965 GCCTGTTAATCCTAGCACTTTGG - Intronic
1192478494 X:71464578-71464600 GCCTGTTAATCCTAGCTACTCGG + Exonic
1192527696 X:71861844-71861866 GCCCGTTAAACCTGCCAGGAGGG - Intergenic
1195084473 X:101401173-101401195 TCATGTTTAAACTAGCAGCAGGG + Intronic