ID: 1059711447

View in Genome Browser
Species Human (GRCh38)
Location 9:116871428-116871450
Sequence TAGAGGCAGGGTTTCTCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 590
Summary {0: 1, 1: 1, 2: 5, 3: 79, 4: 504}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059711447_1059711456 20 Left 1059711447 9:116871428-116871450 CCCAAAGAGAAACCCTGCCTCTA 0: 1
1: 1
2: 5
3: 79
4: 504
Right 1059711456 9:116871471-116871493 CCTCCCAATGACCCTTGTGTTGG No data
1059711447_1059711457 21 Left 1059711447 9:116871428-116871450 CCCAAAGAGAAACCCTGCCTCTA 0: 1
1: 1
2: 5
3: 79
4: 504
Right 1059711457 9:116871472-116871494 CTCCCAATGACCCTTGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059711447 Original CRISPR TAGAGGCAGGGTTTCTCTTT GGG (reversed) Intronic
901176570 1:7304092-7304114 AGGAGGCAGAGTTTCTGTTTGGG + Intronic
901541618 1:9921384-9921406 TAGAGACGGGGTTTCTTTTTTGG + Intergenic
901544502 1:9945512-9945534 TAGAGACAGGGTTTCACCATAGG - Intronic
902779351 1:18694273-18694295 TAGAGACAGGGTTTCTATGTTGG - Intronic
902790935 1:18767466-18767488 GAGATGCAGAATTTCTCTTTGGG - Intergenic
903774551 1:25784337-25784359 TTGAGGAGGGGTTTCCCTTTGGG + Exonic
904488472 1:30843547-30843569 TAGAGACAGGGTTTCCATGTTGG + Intergenic
904502919 1:30927183-30927205 TAGAAACAGGGTTTCTATGTTGG - Intergenic
904551215 1:31320437-31320459 TAGGTACAGGGTTTCTTTTTGGG - Intronic
904630020 1:31834011-31834033 TAGAGACAGGGTTTCTATGTTGG - Intergenic
905352851 1:37359492-37359514 TAGAGTCAGGGCTTATGTTTGGG - Intergenic
905447373 1:38035772-38035794 TAGAGACAGGGTCTCTCACTAGG - Intergenic
906022501 1:42642501-42642523 TAGAAGCAGGGTATCATTTTGGG - Exonic
906268078 1:44450023-44450045 TAGAGACAGGGTCTCTCTGTTGG - Intronic
906421177 1:45668681-45668703 TAGATGCAGGTGTTCTGTTTTGG - Intronic
907056203 1:51370803-51370825 TAGAGATAGGGTTTCGCTGTTGG + Intronic
907142203 1:52198064-52198086 TATAGGCAGAGATTTTCTTTGGG + Intronic
907148121 1:52255399-52255421 TAGAGTCAGGGTTTCTCCATAGG - Intronic
907273202 1:53302711-53302733 TGGAGACAGGGTTTCCCTGTTGG + Intronic
909413658 1:75381100-75381122 TTGGGGCAAGGTTTCCCTTTAGG - Intronic
910309937 1:85811954-85811976 TATAAGCAGGGTTTCTCTTATGG - Intronic
910504759 1:87937315-87937337 TGGAAACAGGGTTTCTCTTGGGG + Intergenic
911647969 1:100355867-100355889 TAGAGGTTGTATTTCTCTTTGGG - Intronic
911846812 1:102763410-102763432 TGGAGGCTGGGTTTCTTTGTTGG + Intergenic
912364002 1:109117941-109117963 TAGAGACAGGGTTTCAATGTTGG - Intronic
912816602 1:112833843-112833865 GAAAGGTAGGCTTTCTCTTTTGG + Intergenic
913160202 1:116138507-116138529 TAGAGACAGGGTCTCCCTTCCGG - Intergenic
914423535 1:147552419-147552441 TAGAGACAGGGTTTCCATGTTGG - Intronic
914812094 1:151036506-151036528 AGGAGGCAGGGTTTTTCTTTTGG + Intergenic
915401986 1:155629002-155629024 TTGGGGCAAGGTTTCCCTTTAGG + Intergenic
915870840 1:159557943-159557965 CTAAGGCAGGGTTTCTCTGTGGG + Intergenic
916462991 1:165046026-165046048 CAGAGGCAGGCTCTGTCTTTGGG - Intergenic
916632525 1:166631808-166631830 TAGAGACAGGGTTTCACCATGGG - Intergenic
916969309 1:169993698-169993720 TAGAGACAGGGTTTCCATGTTGG - Intronic
918051136 1:180973386-180973408 TAGAGCCAAGATTTTTCTTTTGG - Exonic
918334373 1:183493764-183493786 TAGAGACGGGGTTTCGCTGTTGG + Intronic
918543488 1:185657239-185657261 TTGAGGCAGGGTCTCACTCTCGG + Intergenic
919736408 1:200955050-200955072 TTGAGGCAGAGTTTCGCTCTTGG + Intergenic
919802849 1:201364068-201364090 TAGAGACAGGGTTTCTCCGTTGG + Intronic
920061324 1:203228883-203228905 TAGAGAGATAGTTTCTCTTTCGG + Intronic
920629450 1:207637435-207637457 TTGGGGCAAGGTTTCCCTTTAGG + Intronic
920858736 1:209687285-209687307 CAGAGCCAGTGTTTCTCTTTGGG + Intronic
920897092 1:210064390-210064412 AATAGGCAGAGTTTCTATTTGGG - Intronic
921214598 1:212926410-212926432 TAGAGACAGGATTTCACTGTTGG + Intergenic
921900376 1:220443979-220444001 TAGGGGCAGACTTTCTGTTTGGG - Intergenic
921900662 1:220447094-220447116 TGGGGGCAGGGCTTGTCTTTTGG + Intergenic
924234013 1:241985569-241985591 TTCAGGCAGTGTTTATCTTTTGG + Intergenic
1063492065 10:6473145-6473167 TACAGGCAGTGTTTCTTTTTGGG - Intronic
1063530513 10:6826513-6826535 TTGGGGCAAGGTTTCCCTTTAGG + Intergenic
1063550281 10:7026047-7026069 TAGAGACGGGGTTTCACTGTTGG - Intergenic
1063656610 10:7996674-7996696 TTGAGGCAGGGTCTCACTCTGGG + Intronic
1064215460 10:13396573-13396595 CAGAGACAGAGTTTCTGTTTGGG - Intergenic
1065250911 10:23812644-23812666 TGGGCACAGGGTTTCTCTTTGGG - Intronic
1065359139 10:24872826-24872848 TTGAGACAGGGTCTCACTTTTGG + Intronic
1065635398 10:27728254-27728276 CACACGCACGGTTTCTCTTTTGG - Intronic
1066000611 10:31101481-31101503 TAGTTGCAGGGTTTCAGTTTTGG + Intergenic
1066569643 10:36756803-36756825 TATATGCAGTGTTTCTCTTGAGG + Intergenic
1066682457 10:37947310-37947332 TAGAGACAGGGTTTCACTGTTGG + Intergenic
1067114840 10:43427089-43427111 TAGAGACAGGGTTTCACTATTGG - Intergenic
1068447897 10:57146752-57146774 TTAAGGCATGGGTTCTCTTTTGG - Intergenic
1068504922 10:57888388-57888410 TAAAGGCAGTATTTTTCTTTAGG - Intergenic
1068546264 10:58348926-58348948 TAGAGGCAGGGATTGTGTCTAGG + Intronic
1068660404 10:59617256-59617278 TTGAGACAGGGTCTCACTTTGGG - Intergenic
1068990877 10:63149300-63149322 TAGAGACAGGGTTTCTACCTTGG + Intronic
1069413644 10:68178526-68178548 TAGAGACGGGGTTTCACTGTTGG - Intronic
1070267277 10:74915976-74915998 TAGAGGCGGGGTTTCTCTGTTGG - Intronic
1070352969 10:75611120-75611142 AAGAGGCAGGGCTTCTCTCTAGG - Intronic
1070843478 10:79503943-79503965 CAGAAGCAGGGTTACCCTTTGGG - Intergenic
1070930187 10:80255657-80255679 CAGAAGCAGGGTTACCCTTTGGG + Intergenic
1071439379 10:85676963-85676985 TAGGGTCAGGTTTTCTCTTAAGG - Intronic
1071589136 10:86855115-86855137 TAGAGACAGGGTTTCACATCAGG + Intronic
1071892369 10:90024454-90024476 TAGAGACAGGGTTTCACCATGGG + Intergenic
1072712732 10:97727828-97727850 CAGGTACAGGGTTTCTCTTTGGG - Intergenic
1072822708 10:98574004-98574026 GGGATGCAGGGTTTCTTTTTGGG - Intronic
1073366556 10:102947564-102947586 TAGAGACAGGGTTTCACCATTGG - Intronic
1073953010 10:108832481-108832503 TAGAGATGGGGTTTCTCTTTGGG - Intergenic
1074198470 10:111209519-111209541 TAGAAGCAAGTTTTCTCTTTAGG - Intergenic
1074775953 10:116768374-116768396 TAGGTACAGGGTTTCTCTTTGGG + Intergenic
1075061035 10:119256852-119256874 TAGATCCAGGGTTTCTTTTTGGG - Intronic
1075262129 10:120972226-120972248 TAGACACAGGGTTTCTTTTGGGG - Intergenic
1075459160 10:122604598-122604620 AAGAGGCAGGGTTTGTGCTTGGG + Intronic
1075459792 10:122608657-122608679 AAGAGGCAGGGTTTGTGCTTGGG + Intronic
1075460424 10:122612716-122612738 AAGAGGCAGGGTTTGTGCTTGGG + Intronic
1075461056 10:122616775-122616797 AAGAGGCAGGGTTTGTGCTTGGG + Intronic
1077585615 11:3449817-3449839 TTGGGGCATGGTTTCCCTTTAGG + Intergenic
1077714445 11:4567620-4567642 TAGAGATGGGGTTTCTCTGTTGG + Intergenic
1078098351 11:8313875-8313897 CAGTGGCAGGGTGTCTCTGTGGG - Intergenic
1078118854 11:8484945-8484967 AAGAGAGAGGATTTCTCTTTTGG + Intronic
1078144236 11:8712169-8712191 TGGGTGCAGAGTTTCTCTTTGGG + Intronic
1079471823 11:20785861-20785883 TATTTGCAGGGTTTCTCTTTTGG + Intronic
1079487712 11:20952792-20952814 TAGTGTCAGGTTTTCTCTCTGGG - Intronic
1080063921 11:27987454-27987476 TTGAGGCAGTGTTTCTATATTGG + Intergenic
1082072956 11:47953837-47953859 TAGAGACAGGGTTTCACCATTGG - Intergenic
1084121165 11:67069875-67069897 TAGAGACAGGGTTTCACTGTTGG + Intronic
1084136343 11:67185442-67185464 TAGAGACAGGGTTTCATGTTGGG - Intronic
1085070386 11:73538733-73538755 GAGAAGCTTGGTTTCTCTTTTGG - Intronic
1085634782 11:78150235-78150257 TAGAGACAAGGTTTCTCTATTGG + Intergenic
1086372580 11:86169728-86169750 TAGAGGTAATCTTTCTCTTTGGG - Intergenic
1087199201 11:95328658-95328680 TAGAGACAGGGTTTCCATGTTGG - Intergenic
1087724475 11:101702170-101702192 TTGGGGCAAGGTTTCCCTTTAGG - Intronic
1087803951 11:102535284-102535306 TGGATACAGAGTTTCTCTTTGGG - Intergenic
1088703945 11:112443773-112443795 TAGACACAGAGTTTCTGTTTGGG - Intergenic
1091023495 11:132122166-132122188 AATAGACAGGGCTTCTCTTTGGG + Intronic
1092221212 12:6715265-6715287 TAGAGACAGGGTTTCACTGTTGG + Intergenic
1092362298 12:7847232-7847254 TTGAGACAGAGTTTCTCTCTTGG - Intronic
1092421970 12:8339165-8339187 TAGATACAGGGTTTCTTTTGGGG - Intergenic
1092452893 12:8619526-8619548 TATAGGCAGTGTTTCTTTTTGGG - Intergenic
1094482920 12:30899204-30899226 CAGAGGAAGGGTTTATCGTTTGG - Intergenic
1094557800 12:31519912-31519934 GAGGTGCAGGGTTTCTTTTTGGG - Intronic
1094607127 12:31958685-31958707 TCAAGGCAGTGTTTCTTTTTGGG + Intergenic
1094654751 12:32409471-32409493 TAGAGACGGGGTTTCACTGTTGG + Intronic
1094874171 12:34622325-34622347 TTGGGGCAAGGTTTCCCTTTAGG + Intergenic
1095941911 12:47732923-47732945 TAGAGACAGGGTGCCTTTTTAGG - Intergenic
1096763031 12:53859443-53859465 TAGATACAGGTTTTCTCTTTGGG + Intergenic
1096972199 12:55676057-55676079 TAGAGACAGGGTATCTCTCAGGG - Intergenic
1097127480 12:56786012-56786034 TAGGTACAGGGTTTCTTTTTGGG + Intronic
1097330702 12:58329795-58329817 TTGGGGCAAGGTTTCCCTTTAGG + Intergenic
1097899299 12:64857335-64857357 TTAAGGCAGGGGTTCTCTTTTGG + Intronic
1098244971 12:68507469-68507491 TAGAGACAGGGTTGCTATGTTGG - Intergenic
1098266438 12:68726019-68726041 TAGAGACGGGGTTTCGCTGTTGG + Intronic
1098938166 12:76504111-76504133 TGGAGGCAGAATTTCTTTTTAGG - Intronic
1099090809 12:78305372-78305394 TAGGGGCGGGGTTTATCTTAGGG + Intergenic
1100261596 12:92937252-92937274 TAGAGACAGGGTTTCTATGTTGG - Intergenic
1100843881 12:98640248-98640270 TAGAGACAGGGTTTCTCCATTGG - Intronic
1101293006 12:103390416-103390438 TGGATGCAGAGTTTCTGTTTGGG - Intronic
1101353934 12:103959019-103959041 TATACGCAGTGTTTCTTTTTGGG - Intronic
1101466706 12:104957401-104957423 GAGAGACAGGGTTTCTTTTGGGG + Intronic
1102433617 12:112902933-112902955 TAGAGACAGGGTCTCACTATGGG + Intergenic
1103467069 12:121150277-121150299 CAGAGACAGGTTTTCTGTTTAGG + Intronic
1104635383 12:130435228-130435250 TAGAGACAGAGTTTCACTGTTGG + Intronic
1104723767 12:131062179-131062201 TAGAGACGGGGTTTCACTGTTGG + Intronic
1104979200 12:132565925-132565947 AGGAGTCAGGGTTTCTTTTTGGG + Intronic
1105434744 13:20366684-20366706 TAGAGACAGGGTTTCTCCATTGG - Intergenic
1108484915 13:50913754-50913776 TAGAGGATGGGTTGCTTTTTGGG + Intronic
1108757190 13:53517968-53517990 TGGAGCCAGGGGTTCTCTTATGG - Intergenic
1109530826 13:63644150-63644172 TAGAGGGAGTATTTATCTTTTGG - Intergenic
1109552416 13:63920711-63920733 TAGAGACAGGGTTTCGCCATGGG - Intergenic
1109739432 13:66532713-66532735 TAGAGACGGGGTTTCACTTTCGG + Intronic
1110167071 13:72455587-72455609 TGGGTACAGGGTTTCTCTTTGGG + Intergenic
1110839301 13:80123471-80123493 TAGAGACGGGGTTTCTATGTTGG - Intergenic
1111781849 13:92737948-92737970 TAGAGACAGGGTCTCCATTTTGG + Intronic
1114485757 14:23060695-23060717 TAGAGACAGGGTTTCCATGTTGG + Intronic
1114608701 14:24020641-24020663 TAAACGCAGTGTTTCTTTTTGGG - Intergenic
1115137307 14:30126662-30126684 TAGAGTTAGGATTTGTCTTTAGG + Intronic
1115332120 14:32209269-32209291 TATAGACAGGCTATCTCTTTGGG + Intergenic
1115689877 14:35831678-35831700 TGGAGGCAGGGTTTTTTTGTGGG + Intronic
1116420988 14:44732085-44732107 TAGAGGCAGGGTGCTTCATTGGG + Intergenic
1116655560 14:47649498-47649520 TAGAGACGGGGTTTCACTGTTGG - Intronic
1116678394 14:47935465-47935487 TATAGGCAGCGTTTCCTTTTGGG + Intergenic
1117617461 14:57548253-57548275 CAGAGGGAGGGGTTCTATTTGGG - Intergenic
1117678456 14:58179200-58179222 TTGAGACAGGGTCTCTCTCTGGG + Intronic
1119365151 14:74084886-74084908 TGGGGATAGGGTTTCTCTTTGGG + Exonic
1119523068 14:75300538-75300560 TAGAGACAGGGTTTCACGGTTGG - Intergenic
1119803174 14:77463400-77463422 TAGAGATGGGGTTTCTCTATTGG - Intronic
1120006860 14:79368120-79368142 TAGGAGCAGGATTTCTGTTTGGG + Intronic
1121007833 14:90501544-90501566 TAGAGACAGGGTTTCACCATTGG - Intergenic
1121350266 14:93167899-93167921 TAGAGACACGGTTTCTCCTGTGG + Intergenic
1122308795 14:100781840-100781862 TGGGGGCAGAGTTTCTGTTTGGG - Intergenic
1202910052 14_GL000194v1_random:108272-108294 TAGAGGCGGGGTTTCACCATTGG - Intergenic
1202882552 14_KI270722v1_random:74514-74536 TAGAGGCGGGGTTTCACCATTGG + Intergenic
1123464077 15:20501287-20501309 TAGAGACAGGGTTTCACCATGGG + Intergenic
1123653988 15:22499135-22499157 TAGAGACAGGGTTTCACCATGGG - Intergenic
1123787960 15:23691112-23691134 CAGAGGCAGGGAGTCTCATTAGG + Intergenic
1124072626 15:26410111-26410133 TAGATGCAGGATTTCTATTTGGG - Intergenic
1124095553 15:26645525-26645547 TTGAGTTAGGGTTGCTCTTTAGG - Intronic
1124274810 15:28317271-28317293 TAGAGACAGGGTTTCACCATGGG + Intronic
1124307894 15:28594332-28594354 TAGAGACAGGGTTTCACCATGGG - Intergenic
1124514682 15:30356559-30356581 TAGAGACAGGGTTTCAATTTGGG + Intergenic
1124728239 15:32174203-32174225 TAGAGACAGGGTTTCAATTTGGG - Intergenic
1125298674 15:38231108-38231130 TAGAGACAGGGTTTCTATGTTGG + Intergenic
1125618994 15:41042198-41042220 TAGAGACAGGGTTTCACCATTGG + Intronic
1125731948 15:41897484-41897506 TGGGGGCAGGGTTGCTCTTCTGG - Exonic
1125918953 15:43513140-43513162 TAGAGGCGGGGTTTCTCCGTTGG - Intronic
1126198748 15:45961356-45961378 TTGAGGGAGGGTCTCTCATTAGG - Intergenic
1126873527 15:53013760-53013782 TAGAGACAGATTTGCTCTTTTGG + Intergenic
1127092635 15:55481794-55481816 GAGAGGTGGGGTTTTTCTTTTGG - Intronic
1127140119 15:55967069-55967091 TAGAGACAGGGTTTCACCATTGG + Intronic
1128031736 15:64486799-64486821 TAGAGGCAGGTTTTGCCATTTGG + Intronic
1128143678 15:65319851-65319873 TGGATACAGGGTTTCTTTTTGGG - Intergenic
1129384717 15:75189720-75189742 TAAAGGCAGTGTTTCTTTTTCGG + Intergenic
1129871232 15:78943058-78943080 TGGAGGCAGGGTTTGAGTTTAGG + Intronic
1130209141 15:81907358-81907380 TAGAGGCAATGGTTCTCTTTGGG - Intergenic
1130252646 15:82310321-82310343 TAGAGGCGGGATTTCTGTGTTGG + Intergenic
1130461621 15:84163440-84163462 TAGGGGCAAGGTTTTTTTTTAGG - Intergenic
1131143463 15:89996866-89996888 TGTAGACAGGGTTTCCCTTTGGG - Intergenic
1131249556 15:90821323-90821345 TAGAGACAGGGTTTCACCATGGG + Intergenic
1132268679 15:100503597-100503619 TAGAGGAAGGTATTCTCTCTAGG + Intronic
1132613652 16:829837-829859 TGGAGACAGGGTTTCCTTTTGGG - Intergenic
1132741501 16:1415441-1415463 TAGAGACGGGGTTTCACTGTTGG - Intergenic
1133064170 16:3194254-3194276 TGGAGGCTGGTTTTCTGTTTTGG + Intergenic
1133376322 16:5290412-5290434 TGGATACAGGGTTTCTTTTTGGG + Intergenic
1133959485 16:10480572-10480594 TAGAGGCAAATTTTCTCGTTAGG - Intronic
1134347797 16:13407367-13407389 AAGAGGCAAGGGATCTCTTTAGG + Intergenic
1134788995 16:16971491-16971513 GAGAGGCAGTGTTTCTCATTTGG + Intergenic
1134899810 16:17927270-17927292 AAGAGGAAGGGTTTCTAGTTGGG + Intergenic
1135760880 16:25137218-25137240 TAGAGACAGGGTTTCAGTGTTGG + Intronic
1135800937 16:25494698-25494720 TTGATGCTGGGTTTCTCATTTGG - Intergenic
1136930549 16:34414385-34414407 TTGGGGCAAGGTTTCCCTTTAGG + Intergenic
1136974025 16:34997423-34997445 TTGGGGCAAGGTTTCCCTTTAGG - Intergenic
1137426719 16:48385933-48385955 GAGAGGCTGGGACTCTCTTTAGG - Intronic
1137663101 16:50226844-50226866 TAAATGCAGGGTTTCTTCTTGGG - Intronic
1138702642 16:58880213-58880235 TAGAGGCAGGGCTGCTTGTTAGG + Intergenic
1138903532 16:61302810-61302832 TAGAGACAGGGTTTCGCCATTGG + Intergenic
1139851552 16:69953628-69953650 TAGAGACGGGGTTTCACTGTTGG - Intronic
1140225798 16:73075816-73075838 TGGAGACAGGGTTTCACTGTTGG + Intergenic
1140399360 16:74658079-74658101 CAGTGCTAGGGTTTCTCTTTGGG + Intronic
1140778086 16:78268552-78268574 TAGAGGCAGAATTTCTCTCCAGG + Intronic
1141326669 16:83066479-83066501 AAGAGGCAGTTCTTCTCTTTGGG - Intronic
1142207285 16:88789906-88789928 CAGTGGCAGAGTTTCTCTTTGGG + Intergenic
1142365753 16:89648702-89648724 TAGAGACAGGGTGTCTATGTTGG - Intronic
1142365775 16:89648837-89648859 TAGAGACAGGGTGTCTATGTTGG - Intronic
1142593902 17:1020446-1020468 CAGCGCCAGCGTTTCTCTTTGGG - Intronic
1142703946 17:1682431-1682453 GAGAGGCAGGGTTTCTGGTTAGG - Intronic
1143073961 17:4323731-4323753 TAGAGGCAGGGTTTCACCATGGG + Intronic
1143146760 17:4781699-4781721 TAGAGACGGGGTTTCACTGTTGG + Intronic
1144183418 17:12773645-12773667 TAGAGACAGGGTTTCACTTTGGG - Intergenic
1146045343 17:29500997-29501019 TGGATGCAGAGTTTCTGTTTGGG + Intronic
1146178876 17:30684700-30684722 TAGGGACAGGGTTTCACTATGGG - Intergenic
1146215224 17:30973650-30973672 TAGAGACGGGGTTTCACTGTGGG + Intronic
1146361938 17:32184200-32184222 TAGGTACAGGGTTTCTCTTTGGG - Intronic
1146955007 17:36932321-36932343 TCGTGGCAGGGTCTCTCTCTGGG + Intergenic
1147047849 17:37767966-37767988 CAAAGGCAGGGTTTCTCTTTTGG + Intergenic
1147249993 17:39147509-39147531 TGGAGGCAGGATTTCAGTTTAGG - Intronic
1147260095 17:39204949-39204971 TAGAGACTGGGTTTCACTGTTGG + Intergenic
1147432654 17:40382741-40382763 TAGAGACAGGGTTTCACTGTTGG + Intergenic
1147817086 17:43217895-43217917 ATGAGGCAGGGCTTCTCCTTTGG - Exonic
1148286223 17:46395298-46395320 TAGGGACAGAGTTTCTTTTTGGG + Intergenic
1148308389 17:46612889-46612911 TAGGGACAGAGTTTCTTTTTGGG + Intronic
1148843908 17:50517503-50517525 TGGAGACTGGGTTTCTCTTGAGG - Intronic
1149464788 17:56869008-56869030 TAGAGGCTGGGTTTCCATTCAGG - Intergenic
1150092194 17:62337099-62337121 TAGAGACAGGGTTTCAGTGTTGG + Intergenic
1150253584 17:63725040-63725062 TAGAGACAGGGTTTCACTTTGGG - Intronic
1150550813 17:66208157-66208179 TAGTGGAAGTGTTTCCCTTTTGG - Intergenic
1150904489 17:69323284-69323306 TATAGGCAGTGTTTCTTTTTGGG - Intronic
1151313247 17:73307190-73307212 CTGAGGAAGGGTCTCTCTTTTGG - Intronic
1151735871 17:75940128-75940150 TAGAGACGGGGTTTCACTGTTGG + Intronic
1152171490 17:78752615-78752637 TAGAGACAGGGTTTCATTATTGG + Intronic
1152265954 17:79294932-79294954 AAGAGGAAGAGATTCTCTTTTGG + Intronic
1152490255 17:80626914-80626936 TGGAGACAGAGTTTCTGTTTGGG - Intronic
1153307466 18:3645275-3645297 TAGAGACAGGGTTTCACATGTGG + Intronic
1154141829 18:11831005-11831027 ATGATGGAGGGTTTCTCTTTGGG + Intronic
1154347884 18:13558796-13558818 TGGTGGCAGAGGTTCTCTTTGGG - Intronic
1155434194 18:25794290-25794312 TAGAGGCAAGATTTTTCTCTTGG + Intergenic
1156000856 18:32382379-32382401 TTGGGGCAGGATTTCTCTATTGG + Intronic
1156847656 18:41687067-41687089 TAAATACAGGGTTTCTTTTTGGG + Intergenic
1157227835 18:45883643-45883665 TACAGACAGGGTTTCTGTGTTGG + Intronic
1157449985 18:47778830-47778852 TGGATACAGGGTTTCTTTTTAGG + Intergenic
1157528452 18:48403033-48403055 TGCAGGGAGGGTTTCTCTTTGGG - Intronic
1157686074 18:49643916-49643938 TGGAGGCAGAGTTTCAGTTTGGG - Intergenic
1157691392 18:49684939-49684961 TAGAGACGGGGTTTCACTATTGG + Intergenic
1157738931 18:50074982-50075004 TAGAGACAGGGTTTCACCATTGG + Intronic
1159093071 18:63871260-63871282 TTGAGACAGAGTTTCTCTCTTGG + Intergenic
1159139576 18:64376884-64376906 TAGAGACAGGGTTTCACCATGGG + Intergenic
1160034935 18:75291719-75291741 CAGAGGCAGGGTGTCTCCTACGG + Intergenic
1160479262 18:79223651-79223673 TAGACCCAGGGTGGCTCTTTGGG + Intronic
1161926143 19:7301642-7301664 TGGGGACAGGGTTTCTGTTTGGG - Intergenic
1162124476 19:8491860-8491882 TAAAGGCAGGATTTATCTGTAGG + Intronic
1162380689 19:10329936-10329958 TAGAGACAGGGTTTCTACCTGGG - Intronic
1162504153 19:11072885-11072907 TAGAGACGGGGTTTCACTGTTGG - Intergenic
1162811771 19:13168401-13168423 TAGAGACAGGGTTTCACCATGGG + Intergenic
1162979739 19:14230867-14230889 TAGAGACAGGGTTTCACTATGGG + Intergenic
1163085458 19:14976568-14976590 TAGAGACGGGGTTTCACTGTTGG + Intronic
1163672957 19:18639260-18639282 TAGAGACAGGGTTTCACTGTTGG + Intronic
1164370539 19:27639953-27639975 TTGGGGCAAGGTTTCCCTTTAGG + Intergenic
1165397503 19:35573804-35573826 TCGGGGCAAGGTTTCCCTTTAGG + Intergenic
1165546429 19:36540607-36540629 TAGAGACAGGGTTTCACCATGGG - Intronic
1165559414 19:36666566-36666588 AGGAAGTAGGGTTTCTCTTTGGG - Intronic
1165657378 19:37545618-37545640 TGGATACAGGGTTTCTTTTTGGG - Intronic
1166656681 19:44617277-44617299 GAGACGCAGGGATTCTTTTTGGG + Intronic
1166739958 19:45108392-45108414 TAGAGACGGGGTTTCACTGTTGG + Intronic
1166763778 19:45240494-45240516 TGGATGCAGGGTTTCCTTTTGGG + Intronic
1168286573 19:55337851-55337873 TAGAGACAGGGTCTCTCTAGGGG - Intergenic
1202658152 1_KI270708v1_random:43503-43525 TAGAGGCGGGGTTTCACCATTGG + Intergenic
925215245 2:2088716-2088738 TAGAAGCATGGCGTCTCTTTGGG - Intronic
925609189 2:5690638-5690660 TCGATGCAGTGTTTTTCTTTAGG + Intergenic
925648208 2:6060110-6060132 TAGAAGCAGGATTTCACTCTGGG + Intergenic
925993770 2:9275254-9275276 TAGAGACAGGGTGTCACTGTTGG + Intronic
926100853 2:10116639-10116661 TAGAGACAGGGTCTCACTATGGG - Intergenic
926287832 2:11504502-11504524 TAGATGCAGGATTTCTTTTTGGG - Intergenic
927194160 2:20536271-20536293 AAGGGGCAGAGTTTCTGTTTTGG + Intergenic
927767099 2:25820993-25821015 TAGAGACGGGGTTTCTCCATGGG - Intronic
927781067 2:25939764-25939786 TAGAGGCAGGGTTTCAATGTTGG - Intronic
927922535 2:26984336-26984358 TAGTGGCAGTGATTCTCTTTGGG - Intronic
928500502 2:31888779-31888801 GAAATGCAGGGTTTCTTTTTGGG + Intronic
928553314 2:32396351-32396373 TAGAGCCAGGGTTTGGTTTTAGG + Intronic
928741850 2:34363883-34363905 TATAGGCAGTGTTTCTTTTGGGG - Intergenic
931346458 2:61451496-61451518 TAGAGACGGGGTTTCTCTCTTGG - Intronic
932064295 2:68536978-68537000 TAGAGACGGGGTTTCACTGTTGG - Intronic
933348357 2:81120309-81120331 TAGGTACAGGGTTTCTTTTTGGG - Intergenic
934520317 2:95016166-95016188 TAGAGACAGGGTTTCACAGTTGG - Intergenic
935052406 2:99535001-99535023 TGGAGACAAGGTTTCTTTTTAGG - Intergenic
935209447 2:100925902-100925924 TGGATACAGGGTTTCTTTTTTGG - Intronic
938120979 2:128632854-128632876 GTGATGCAGGGTCTCTCTTTTGG + Intergenic
938270290 2:129964294-129964316 TTGGGGCAAGGTTTCCCTTTAGG + Intergenic
939589968 2:144052833-144052855 TAGAGACAGGGTTTCTCCATTGG + Intronic
939961848 2:148572220-148572242 TAGAGACAGGGTTCCTATGTTGG + Intergenic
940422152 2:153491803-153491825 TAGAGACAGGGTTTCACCATTGG + Intergenic
940941777 2:159570367-159570389 TAGAGACAAGGTTTCACTGTTGG + Intronic
940960678 2:159782225-159782247 TAGAGACGGGGTTTCACTGTTGG - Intronic
941074643 2:160992913-160992935 TAGAGATGGGGTTTCTCTATAGG + Intergenic
941550227 2:166906772-166906794 TAGAGACAGGGTTTTGCTATGGG - Intronic
942503128 2:176613175-176613197 TTGAGGCAGCATTTCTATTTTGG - Intergenic
944150045 2:196548141-196548163 TAGAGATAGGGTTTCTATATTGG - Intronic
944191115 2:197005278-197005300 TAGATGCATGGTTCATCTTTTGG - Intronic
944578945 2:201115874-201115896 TAGAGACGGGGTTTCACTGTTGG - Intergenic
944730434 2:202511116-202511138 TAGATACAGGGTTTCCCTTGTGG - Intronic
944766019 2:202864975-202864997 TAGAGGCAGGGTTTCTCTGTTGG - Intronic
945974359 2:216259027-216259049 TTGGGGCAGGGTTTTTCTGTTGG + Exonic
946151087 2:217771362-217771384 TAGGGGAAGAATTTCTCTTTTGG - Intergenic
946202473 2:218078731-218078753 TGGGTACAGGGTTTCTCTTTGGG - Intronic
946400029 2:219463595-219463617 TAGAGGCAGGGTTTCTGGTCAGG + Intronic
948011908 2:234655716-234655738 TTCAGGCAGGCTTGCTCTTTGGG + Intergenic
948029199 2:234802507-234802529 AAGAGGAAGAGTTTCTCTGTTGG - Intergenic
1168871097 20:1129196-1129218 TAGAGACAGGGTTTTGCTGTTGG + Intronic
1169455588 20:5749740-5749762 TAGAGACAGGGTTTCTCTGTTGG + Intergenic
1169578483 20:6992543-6992565 TAGGTACAGGGTTTCTTTTTGGG - Intergenic
1171983955 20:31646411-31646433 TAGAGACAGGGTTTCCATGTTGG - Intergenic
1172694084 20:36809758-36809780 TAGAGGCGGGGTTTCCATGTTGG + Intronic
1172975055 20:38899978-38900000 TAGAGACAGGGTTTCTATGTCGG + Intronic
1172979548 20:38930665-38930687 TGGAGACAGAGTTGCTCTTTTGG + Intronic
1173282863 20:41644843-41644865 TAGAGACAGGGTCTCACTGTCGG - Intergenic
1173654079 20:44687157-44687179 TAGAGGCAGAGTGTCAGTTTGGG - Intergenic
1173786167 20:45794331-45794353 TAGAGACGGGGTTTCACTGTTGG + Intronic
1173842234 20:46165382-46165404 TAGAGACAGGGTTTCGCTATTGG - Intergenic
1174708613 20:52682283-52682305 GAGAGAAAGGGCTTCTCTTTTGG - Intergenic
1174763209 20:53227129-53227151 GAGAGGCTGGCTTTCTCTTTTGG - Intronic
1175085273 20:56453042-56453064 TAGTGGAAGGGGTACTCTTTTGG - Exonic
1175155384 20:56967903-56967925 TAGAGGCAGGGTACCACTTGGGG - Intergenic
1175389942 20:58620615-58620637 CAGGGGCAGGGTTTCTGTGTGGG - Intergenic
1176644009 21:9332665-9332687 TAGAGGTGGGGTTTCACCTTTGG + Intergenic
1177036255 21:16046727-16046749 TAGAGGCAGTGTCTATGTTTGGG + Intergenic
1177248539 21:18562962-18562984 TTGGGGCAAGGTTTCTCTTTAGG + Intergenic
1178538313 21:33428676-33428698 AAGAGGCAGAGTCTCTCTTCTGG - Intronic
1178748714 21:35279965-35279987 TGGATACAGGGTTTCTTTTTGGG - Intronic
1179041373 21:37805134-37805156 TAAAGACAGAGTTTCTTTTTGGG + Intronic
1180368936 22:11966561-11966583 TAGAGGTGGGGTTTCACCTTTGG - Intergenic
1180687611 22:17681703-17681725 TAGAGGCAGGCTTGGACTTTGGG + Intronic
1180836676 22:18933177-18933199 TAGAGGCAGGGTCTCACTCCTGG + Intronic
1180838460 22:18945494-18945516 TTGGGGCAAGGTTTCCCTTTAGG - Intergenic
1180888314 22:19264804-19264826 TTGAGACAGAGTTTCGCTTTTGG + Intronic
1180930798 22:19589800-19589822 TAGGGACAGAGTTTCTCTTTAGG - Intergenic
1181287673 22:21766108-21766130 CAGAGGCAGGGTTGCTCCTGAGG - Intronic
1181722966 22:24790199-24790221 TAGAGACGGGGTTTCACTGTTGG - Intergenic
1182113195 22:27738898-27738920 TTGATACAGGGTTTCTTTTTGGG + Intergenic
1183026976 22:35072505-35072527 TACTGCCAGGGTTTGTCTTTAGG - Intronic
1183808401 22:40232961-40232983 TAGAGACAGGGTTTCACCATTGG - Intronic
1183992774 22:41609605-41609627 TAAAGACTGGGTTTCTCTGTTGG - Intronic
1184031305 22:41896543-41896565 TAGAGGCAGAGTTTCACCATTGG + Intronic
1203286768 22_KI270734v1_random:158476-158498 TAGAGGCAGGGTCTCACTCCTGG + Intergenic
950030576 3:9850011-9850033 TTGGGGCAAGGTTTCCCTTTAGG + Intronic
950068215 3:10130573-10130595 TAGAGACAGGGTTTTGCTGTTGG - Intergenic
950382867 3:12632137-12632159 TAGAGACAGGGTTTCACCATGGG - Intronic
950478962 3:13233002-13233024 TGGAGGCAGAGTTTGTATTTGGG + Intergenic
950564057 3:13754587-13754609 TAGGGACAGGGTTTCTTTTCGGG - Intergenic
951055080 3:18138256-18138278 TAGAGGCAGGGGCAATCTTTAGG - Intronic
951482765 3:23179236-23179258 TTGAGGCAGAGTTTCACTCTTGG + Intergenic
952457942 3:33491930-33491952 TAGGCACAGGGTTTCTGTTTGGG - Intergenic
953185983 3:40638873-40638895 TATAGGCATGGCTTCTGTTTGGG + Intergenic
953404120 3:42652135-42652157 CAGAGGCAGAATTTCTCTCTTGG - Intergenic
953692461 3:45131418-45131440 TGGATACAGGGTTTCTGTTTAGG - Intronic
953835621 3:46340500-46340522 TAGGTACAGGGTTTCTTTTTGGG + Intergenic
955486005 3:59435371-59435393 TAGGTGCAGGGTTTCTTTTAGGG + Intergenic
956206558 3:66761048-66761070 TAGAGGTAGGGTTTCCCCATTGG + Intergenic
957065776 3:75520781-75520803 TGGATACAGGGTTTCTTTTTGGG - Intergenic
957069706 3:75557569-75557591 TCGGGGCATGGTTTCCCTTTAGG - Intergenic
957095742 3:75775666-75775688 TAGAGGCGGGGTTTCACCATTGG - Intronic
959070597 3:101698660-101698682 TTGGGGCAAGGTTTCCCTTTAGG - Intergenic
960027615 3:113026606-113026628 TTGGGGCAAGGTTTCCCTTTAGG + Intergenic
961287374 3:125817280-125817302 TGGATACAGGGTTTCTTTTTGGG + Intergenic
961297414 3:125897407-125897429 TTGAGGCAAGGTTTCCTTTTAGG - Intergenic
961298457 3:125905651-125905673 TAGATACAGGGTTTCTCCTCGGG + Intergenic
961647526 3:128400494-128400516 CAGGGGCAGGGGATCTCTTTGGG - Intronic
961715693 3:128855999-128856021 TAGACCCAGGGATTCTGTTTAGG - Intergenic
962116827 3:132518810-132518832 TAGAAATAGGGTTTCTTTTTGGG - Intronic
962132600 3:132698165-132698187 TAGAGGCGGGGTTTCACTGTTGG + Intronic
962772103 3:138621966-138621988 TAGAGACGGGGTTTCACTGTTGG + Intronic
964787521 3:160414663-160414685 TAGAAGCAAGGTTTCCCTTGAGG - Intronic
964941384 3:162160381-162160403 TTGAGACAGAGTTTCTCTCTTGG + Intergenic
965793365 3:172412173-172412195 TAGACACAGGGTTTCTATTTCGG + Intergenic
966287737 3:178317350-178317372 TGCAGGAAGGGCTTCTCTTTTGG - Intergenic
966428845 3:179810191-179810213 TAGAGACAGGGTTTCCATGTTGG + Intronic
966713977 3:182997401-182997423 TAGAGACAGGGTTTCCATGTTGG + Intergenic
967026045 3:185564884-185564906 TTGGGGCAAGGTTTCCCTTTAGG + Intergenic
968020728 3:195386258-195386280 TAGATACAGGGTTTCTTTTTGGG + Intronic
1202742881 3_GL000221v1_random:72403-72425 TAGAGGTGGGGTTTCACCTTTGG - Intergenic
968777271 4:2550452-2550474 TTGAGGCAGAGTTTCGCTCTTGG + Intronic
969010374 4:4056843-4056865 TAGATATAGGGTTTCTTTTTGGG - Intergenic
969743679 4:9053052-9053074 TGGATACAGGGTTTCTTTTTGGG + Intergenic
970069288 4:12138359-12138381 AAGAGGCAAGGTTGCTCTCTAGG + Intergenic
970331357 4:14987900-14987922 TAGAGGCAGGATTTTTCTGGAGG - Intergenic
970538036 4:17049787-17049809 TAGAGACAGGGTTTCCATGTTGG + Intergenic
971547080 4:27899651-27899673 TGGATACAGGGTTTCTATTTGGG + Intergenic
972489130 4:39570343-39570365 TAGAGACAGGGTTTCCATGTTGG + Intronic
972497054 4:39643809-39643831 TGGAGACAGGGTTTCACTATGGG + Intergenic
972519561 4:39840746-39840768 CAGAGACAGGGTTTCACTTCAGG + Intronic
972605533 4:40610071-40610093 TTGAGACAGAGTTTCACTTTTGG - Intronic
973236939 4:47915191-47915213 TATAGACAGTGTTTCTTTTTGGG + Intronic
973338280 4:48978074-48978096 TAGAGACAGGGTCTCACTCTGGG - Intergenic
973919278 4:55668438-55668460 TAGAGACGGGGTTTCTATGTTGG + Intergenic
973952992 4:56036374-56036396 TTGAGACAGGGTTTTGCTTTTGG - Intergenic
974350957 4:60745220-60745242 TGGAAGTAGTGTTTCTCTTTTGG - Intergenic
974877296 4:67715516-67715538 TAGAGACAGGGTCTCACTCTGGG + Intergenic
975571151 4:75819012-75819034 TAGAGGCGGGGTTTCCATGTTGG - Intergenic
977912857 4:102557925-102557947 TGGAGGCAGGGTTTCTGGCTGGG - Intronic
978713001 4:111808318-111808340 TAGAGGAATGGATTCTCTGTTGG - Intergenic
979813530 4:125069266-125069288 TAGATACAGGGTTTATTTTTGGG + Intergenic
980044073 4:127969383-127969405 TAGAGACGGGGTTTCTCCATGGG + Intronic
980045729 4:127986136-127986158 TGGATACAGGGTTTCTTTTTAGG - Intronic
980122382 4:128741319-128741341 TAGAGACGGGGTTTCTCTGTTGG - Intergenic
980124212 4:128758064-128758086 TAGAGGTTGGCTTTTTCTTTTGG - Intergenic
980214449 4:129833615-129833637 TAGAGGCTGGGTTTCTAATCAGG - Intergenic
980945276 4:139313726-139313748 TAGAGACAGGGTTTCTCCATTGG + Intronic
980952752 4:139397601-139397623 TAGAGACAGGGTTTCACTCCAGG + Intronic
981074577 4:140578381-140578403 TTGAAGCATGATTTCTCTTTGGG - Intergenic
981107284 4:140895280-140895302 TAGAGACAGGGTTTCTCTAAGGG + Intronic
981173616 4:141654225-141654247 TAGAGGCAGGATGGCCCTTTGGG + Intronic
981298182 4:143156688-143156710 TAGAGGGAAGGGGTCTCTTTCGG + Intergenic
982143967 4:152361779-152361801 TAGAGTCGGGGTTTCACTCTTGG - Intronic
982473413 4:155821733-155821755 TGAAGGCAGGGTTTCTCTGGGGG - Intergenic
983215713 4:165000548-165000570 TTGCGGCAAGGTTTCCCTTTAGG - Intergenic
983514836 4:168644914-168644936 TAGAGACAGGGTTTCCATATTGG - Intronic
983671204 4:170239913-170239935 TAAAGGCAGTTTTTCTCTTAAGG + Intergenic
985529518 5:425502-425524 TAGAGACAGTGTTTCACTGTTGG + Intronic
986490921 5:8289292-8289314 TTGACGCAGGGTTTCTCTCCTGG - Intergenic
987320303 5:16762775-16762797 TAGAAACAGGGTTTCACTGTTGG - Intronic
988380168 5:30488981-30489003 TTGGGGCAAGGTTTCCCTTTAGG + Intergenic
990445979 5:55894901-55894923 TAGAGACAGGGTTTCACCATTGG + Intronic
990879043 5:60519643-60519665 TAGAGGCTGAGTGTCTCTGTTGG + Intronic
991256023 5:64615792-64615814 TATAGGCAGTGTTTCTTTCTGGG + Intergenic
991598786 5:68331925-68331947 TGGATACAGGGTTTCTGTTTAGG + Intergenic
991932764 5:71770599-71770621 TGGGTGCAGGATTTCTCTTTGGG - Intergenic
992083198 5:73254512-73254534 TAGATTCAGGGCTTCTCTTGGGG - Intergenic
993870049 5:93241980-93242002 TAGAGTAAGGGTTACTCTTATGG + Intergenic
994059199 5:95455521-95455543 TGAAGGCAGGGTTTGTGTTTAGG - Intergenic
994994819 5:107046837-107046859 TAGGTGCAGGGTTTCTTTTAGGG + Intergenic
995044630 5:107631943-107631965 TACAGCGAGGGTTTCTTTTTGGG - Intronic
995425408 5:112016117-112016139 TAGGGACAGGATTTCTATTTGGG + Intergenic
995532215 5:113102927-113102949 TAGAGACAGGGTTTCACCTGAGG - Intronic
995719343 5:115113722-115113744 TACAGGCAGTGTTTCTTTTTGGG + Intergenic
996419779 5:123249596-123249618 AAGAGGCAGCATTTTTCTTTAGG - Intergenic
997433892 5:133860248-133860270 TAGAGACAGGGTTTCACATGTGG + Intergenic
999189145 5:149733213-149733235 TAGAGGGAGGACTTCTGTTTAGG + Intronic
999951891 5:156660042-156660064 TTGGGGCAAGGTTTCCCTTTAGG + Intronic
999979977 5:156948775-156948797 AAGAGGCAGGATTTGTGTTTAGG + Intronic
1000431074 5:161153003-161153025 TAGAGGCAGAGATATTCTTTAGG - Intergenic
1001507060 5:172288136-172288158 TAGGTACAGGGTTTCTTTTTAGG - Intergenic
1002289253 5:178188556-178188578 GATAGGCAGGGATTCTCTGTGGG + Intergenic
1002788230 6:419825-419847 TGGAGACAGGGTTTCAATTTGGG - Intergenic
1003231051 6:4254121-4254143 TAGAGGCAGAGTCTTTCTTGTGG + Intergenic
1003372635 6:5543547-5543569 TAGAGACGGGGTTTCACTGTTGG + Intronic
1004702331 6:18091003-18091025 TAGACGCAGCTTTTTTCTTTTGG + Intergenic
1004974011 6:20944529-20944551 TAGAGACAGGGTTTCCATGTTGG + Intronic
1005041978 6:21608176-21608198 TAGAGACGGGGTTTCTCTGTTGG - Intergenic
1005328289 6:24722881-24722903 TAGGTACAGGGTTTCTTTTTGGG - Intergenic
1005730297 6:28690606-28690628 TTGGGGCAAGGTTTCCCTTTAGG - Intergenic
1005766170 6:29014521-29014543 TGTAGGCAGGGTTTAGCTTTGGG - Intergenic
1005967499 6:30737442-30737464 TAGAGACAGGGTTTCACTGTTGG + Intronic
1006413535 6:33890089-33890111 TAGGGGCAGGCTTGCTTTTTTGG - Intergenic
1006457268 6:34139035-34139057 TGGGAGCAGGGCTTCTCTTTAGG - Intronic
1006496425 6:34426611-34426633 TAGAGACAGGGTTTCACCATTGG - Intergenic
1006765214 6:36499018-36499040 CAGAGGCATGATTTCACTTTGGG - Intronic
1007014201 6:38446882-38446904 TGTATGCAGGGTTTCACTTTAGG - Intronic
1007042332 6:38734095-38734117 TAGAGACGGGGTTTCACTGTTGG - Intronic
1007416645 6:41694907-41694929 GAGAGGCAGGGATTCTCTGGGGG - Intronic
1007855044 6:44846814-44846836 TAGAGACGGGGTTTCTCTGCTGG + Intronic
1008166496 6:48145271-48145293 CTGAGGCAGGGTTTCTGTTGTGG + Intergenic
1008961977 6:57275299-57275321 TAGAGACAGGGTTTCACTCCTGG - Intergenic
1009652651 6:66495729-66495751 TACAGGCAGTGTTTCTTTTTGGG + Intergenic
1009717583 6:67419315-67419337 TATAGAAAGGGTTTCTCTTCTGG - Intergenic
1009782868 6:68293034-68293056 TAGAAGGAAGGGTTCTCTTTTGG - Intergenic
1009955860 6:70452284-70452306 TATATACTGGGTTTCTCTTTTGG + Intronic
1010591643 6:77719273-77719295 TTGGGGCAAGGTTTCCCTTTAGG + Intronic
1013334490 6:109141399-109141421 TAGTGACAGGGTTTCACTGTTGG + Intronic
1013713459 6:112929486-112929508 TAGAGTAAGGGCTTCTCTGTTGG + Intergenic
1014608963 6:123517312-123517334 TTGAAGCAGGATGTCTCTTTTGG + Intronic
1014745449 6:125195082-125195104 TATAGGCTGTGTTTCTTTTTGGG + Intronic
1017200999 6:151755023-151755045 TAGAGACAGCTTTTCTCTATTGG - Intronic
1017382110 6:153843151-153843173 TAGAGACAGGGTTTCACTGTTGG - Intergenic
1017899926 6:158710966-158710988 TAGAGACGGGGTTTCACTATTGG + Intronic
1018717859 6:166547847-166547869 TAGAAGCAGGCTTTCTGTTCAGG - Intronic
1019500806 7:1363964-1363986 CAGGGGCAGGGTTTCAGTTTGGG - Intergenic
1019767868 7:2864699-2864721 TAGAGACGGGGTTTCACTGTCGG + Intergenic
1019976318 7:4584762-4584784 TTGGGGCAAGGTTTCCCTTTAGG + Intergenic
1019977254 7:4593266-4593288 TTGGGGCAAGGTTTCCCTTTAGG + Intergenic
1021005357 7:15388090-15388112 TGGCGACAGGGTTTCTGTTTTGG + Intronic
1021544928 7:21802866-21802888 TGGATACATGGTTTCTCTTTGGG + Intronic
1022369493 7:29757410-29757432 GAGAGGCAGAGTTCCTCCTTTGG - Intergenic
1023036405 7:36135224-36135246 TAGGTGCAGAGTTTCTATTTGGG + Intergenic
1023304689 7:38813394-38813416 TAGGTGCAAGGTTTCTTTTTGGG + Intronic
1023335101 7:39160630-39160652 TAGAGGCAGGGTTTCTACCAAGG - Intronic
1023359893 7:39404959-39404981 ATAAGACAGGGTTTCTCTTTAGG + Intronic
1023956471 7:44890650-44890672 TAGAGACAGGGTTTCACTGTTGG + Intergenic
1025199451 7:56952765-56952787 TAGAGACAGGGTTTCACTGCTGG + Intergenic
1025806873 7:64841598-64841620 AAGAAACAGAGTTTCTCTTTAGG - Intergenic
1027197111 7:76038237-76038259 TAGAGACAGGGTCTCGCTTCCGG + Intronic
1027629049 7:80579591-80579613 TAGAGGAAGGTTTTCTTTTGGGG + Intronic
1028221513 7:88202493-88202515 TAGCAGCATGGTTTCACTTTTGG + Intronic
1029028325 7:97441993-97442015 TAGAAACAGAGTTTCTATTTGGG + Intergenic
1030048110 7:105515220-105515242 TATAGGCAGTGTTTCTTTTTGGG - Intronic
1031017026 7:116586150-116586172 TGCAGGCAGGGGTTATCTTTAGG + Intergenic
1032229485 7:130061893-130061915 TAGGTACAGGGTTTCTCTTAGGG - Intergenic
1032352409 7:131177279-131177301 TAGAGACGGGGTTTCACTATTGG - Intronic
1032413125 7:131714572-131714594 TAGAGACGGGGTTTCTCTGTTGG - Intergenic
1033063013 7:138125916-138125938 TATAGGCAGTGTTTCCTTTTGGG - Intergenic
1033379805 7:140804387-140804409 TAGAGACAGGTTTTTTTTTTGGG + Intronic
1033405484 7:141068819-141068841 TCGAGGCAGGGTATCACTTGAGG - Intergenic
1034157108 7:148964870-148964892 TAGAGACAGGGTTTCACCATTGG - Intergenic
1034287854 7:149901384-149901406 TAGAGACAGGGTCTCACTTCTGG + Intergenic
1034663273 7:152791536-152791558 TAGAGACAGGGTCTCACTTCTGG - Intronic
1036291866 8:7500211-7500233 TTGGGGCAAGGTTTCCCTTTAGG + Intronic
1036376416 8:8204282-8204304 TTGGGGCATGGTTTCCCTTTAGG - Intergenic
1036885360 8:12548157-12548179 TGGATACAGGGTTTCTTTTTGGG - Intergenic
1037437248 8:18875859-18875881 TGGATACAGGGTTTCTTTTTGGG - Intronic
1038154129 8:24971391-24971413 TAGGGGTAAGGTTTCTTTTTGGG + Intergenic
1038264321 8:26025986-26026008 TAGAGACAGGGTCTCACTCTGGG - Intronic
1038694066 8:29789930-29789952 TAGGTGCAGAGTTTCTGTTTGGG + Intergenic
1038923948 8:32116948-32116970 TAGAGACAGGGTCTCTATATTGG - Intronic
1039991432 8:42491323-42491345 TAGAGACGGGGTTTCACTGTTGG - Intronic
1041355608 8:56996343-56996365 TTAAGGCAGGGTTTTTCATTGGG - Intergenic
1041593680 8:59621072-59621094 TAGGTACAGGGTTTCTGTTTTGG - Intergenic
1042557803 8:70048353-70048375 TAGAGACCGGGTTTCTCTGTTGG + Intergenic
1043378581 8:79678227-79678249 TAGAGGGAGGGTTTGTTTGTGGG - Intergenic
1043887398 8:85617745-85617767 TTGAGGCAGGGTCTCACTTGTGG + Intergenic
1044484506 8:92735394-92735416 TAAAGAAAGGGTTTCTCTATGGG - Intergenic
1044720566 8:95141724-95141746 TAGAGACGGGGTTTCACTGTTGG + Intronic
1044972651 8:97634776-97634798 TAGAGACAGGGTCTCACTCTGGG - Intergenic
1046623205 8:116550043-116550065 TTGAGGCAGAGTTTTTCCTTTGG + Intergenic
1046962721 8:120127050-120127072 TAGGTACAGGGTTTCTTTTTGGG - Intronic
1047261010 8:123259967-123259989 TAGAGACGGGGTTTCACTGTTGG - Intronic
1047719074 8:127621812-127621834 TGGATGCAGGGTTTCTGTTTGGG + Intergenic
1047910067 8:129518285-129518307 TAGAGGGAAGGGTTCTCTTTGGG - Intergenic
1048115882 8:131521419-131521441 TATATGCAGGGTTTTGCTTTAGG - Intergenic
1048770251 8:137887314-137887336 TAGAGACAGGGTTTCCATGTTGG - Intergenic
1050796404 9:9550166-9550188 TAGAGGCAGAATTTCTTCTTTGG - Intronic
1051459607 9:17296185-17296207 TAGAGACGGGGTTTCACTATTGG + Intronic
1051856784 9:21576622-21576644 GAAAGGCAGCCTTTCTCTTTAGG - Intergenic
1052936816 9:34100046-34100068 TAGAGACAGGGTCTCACTTTGGG + Intronic
1053235733 9:36452316-36452338 TGGATACAGGGTTTCTTTTTGGG - Intronic
1053554035 9:39115968-39115990 TAGAGACTGGGTTTCACTATTGG - Intronic
1053818139 9:41936093-41936115 TAGAGACTGGGTTTCACTATTGG - Intronic
1054108400 9:61079752-61079774 TAGAGACTGGGTTTCACTATTGG - Intergenic
1054612457 9:67251373-67251395 TAGAGACTGGGTTTCACTATTGG + Intergenic
1054758927 9:68987375-68987397 TAGAGACAGAGTTTCACTGTTGG - Intronic
1055029178 9:71755325-71755347 TAGAGACAGGGTGTCTCACTAGG - Intronic
1056828971 9:89898949-89898971 TAGAGGCAGGTTTTCTAGATGGG - Intergenic
1057754285 9:97819400-97819422 TAGAGACGGGGTTTCCCTGTTGG - Intergenic
1059711447 9:116871428-116871450 TAGAGGCAGGGTTTCTCTTTGGG - Intronic
1059822343 9:117987082-117987104 TAGAGGCAGGGTTTGTACTCTGG - Intergenic
1059900178 9:118915759-118915781 TAGAGACTGGGTTGCTCTGTTGG - Intergenic
1059970334 9:119661062-119661084 AAAAGGCAGGCTTTCTCTTGAGG - Intergenic
1059996633 9:119916686-119916708 TGGATACAGGGTTTCTTTTTGGG - Intergenic
1060090323 9:120737097-120737119 CAGATACAGGGTTTCTTTTTGGG - Intergenic
1060355276 9:122901774-122901796 TAGAGACAGGGTTTCACCTGTGG + Intronic
1061814501 9:133186290-133186312 CAGGGGCAGGGTTTCCGTTTGGG + Intergenic
1062550679 9:137084924-137084946 GAGAGCCTGAGTTTCTCTTTAGG - Intergenic
1203711513 Un_KI270742v1:102327-102349 TAGAGGTGGGGTTTCACCTTTGG - Intergenic
1185604579 X:1360711-1360733 TAGAGACAGGGTTTCACTAGTGG + Intronic
1185864680 X:3612964-3612986 TAGAGACAGGGTTTCTCCATGGG - Intronic
1186009230 X:5110132-5110154 TAGCTGCAGCGTTTCTCTTTGGG + Intergenic
1186063884 X:5740523-5740545 TGGGGACAGGGTTTCTGTTTGGG + Intergenic
1186819495 X:13272435-13272457 TAGAAGGAGGATTCCTCTTTGGG - Intergenic
1187116505 X:16357546-16357568 AACACGCAGTGTTTCTCTTTTGG + Intergenic
1187362272 X:18640028-18640050 TGGGTGCAGGATTTCTCTTTGGG + Exonic
1187916958 X:24162810-24162832 TAGGTGTAGGGTTTCTTTTTGGG - Intronic
1188360547 X:29247595-29247617 TAGAGACAGGGTTTCACTGTTGG - Intronic
1190387210 X:49894045-49894067 GAGATGAAGGGTTTCTATTTGGG - Intergenic
1190502741 X:51095708-51095730 CAGAAGCAGGGTTGCCCTTTGGG - Intergenic
1190815241 X:53923841-53923863 TAGAGACGGGGTTTCTCTGTTGG - Intergenic
1190834694 X:54089773-54089795 TAGAGACGGGGTTTCTCTGTTGG - Intronic
1190854340 X:54278695-54278717 TAGATTCAGGGTTTTTTTTTGGG - Intronic
1192807986 X:74526592-74526614 CAGAGGCAGGGTTGCTTTTAAGG + Intronic
1193297183 X:79846936-79846958 CAGAAGGAAGGTTTCTCTTTTGG + Intergenic
1194274841 X:91866164-91866186 TAGAAGAAAGGTGTCTCTTTTGG + Intronic
1195231283 X:102851204-102851226 TAGAGACAGGGTTTGGCTGTTGG + Intergenic
1195282469 X:103349100-103349122 AAGAGGCAGCGTTTTTCTTGGGG + Intergenic
1195400134 X:104452743-104452765 TCCAGTCAGGGTTTCTTTTTGGG + Intergenic
1196602285 X:117616256-117616278 GAGAGGCAGAGGCTCTCTTTGGG + Intergenic
1196750577 X:119113565-119113587 TGGGCGCAGGGTTTCTTTTTAGG + Intronic
1197780213 X:130151852-130151874 TAGAGACGGGTTTGCTCTTTTGG - Intronic
1197979446 X:132199902-132199924 TAGGGACAGGGTTTCGCTGTTGG - Intergenic
1198151272 X:133912664-133912686 GAGAGGGAGGAATTCTCTTTTGG + Intronic
1198999409 X:142616569-142616591 GAAAGGAAGTGTTTCTCTTTGGG + Intergenic
1199180744 X:144851078-144851100 TAGAGACAAGGTTTCTATGTTGG - Intergenic
1200368701 X:155697750-155697772 TTGAGTCCTGGTTTCTCTTTGGG + Intergenic
1200592083 Y:5087565-5087587 TAGAAGAAAGGTGTCTCTTTTGG + Intronic
1200797587 Y:7355436-7355458 TAGAGACGGGGTTTCACTGTTGG + Intergenic
1201165903 Y:11208284-11208306 TAGAGGCGGGGTTTCACCATTGG - Intergenic
1201310613 Y:12595567-12595589 TAGAGGCAGGCTATCTATTAAGG + Intergenic
1201325680 Y:12755349-12755371 TAGAGACAGGATTTCTATATTGG + Intronic
1202047602 Y:20750195-20750217 TAGGTACAGGGTTTCTTTTTGGG + Intergenic