ID: 1059711448

View in Genome Browser
Species Human (GRCh38)
Location 9:116871429-116871451
Sequence ATAGAGGCAGGGTTTCTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 648
Summary {0: 1, 1: 0, 2: 1, 3: 63, 4: 583}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059711448_1059711457 20 Left 1059711448 9:116871429-116871451 CCAAAGAGAAACCCTGCCTCTAT 0: 1
1: 0
2: 1
3: 63
4: 583
Right 1059711457 9:116871472-116871494 CTCCCAATGACCCTTGTGTTGGG No data
1059711448_1059711456 19 Left 1059711448 9:116871429-116871451 CCAAAGAGAAACCCTGCCTCTAT 0: 1
1: 0
2: 1
3: 63
4: 583
Right 1059711456 9:116871471-116871493 CCTCCCAATGACCCTTGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059711448 Original CRISPR ATAGAGGCAGGGTTTCTCTT TGG (reversed) Intronic
900229512 1:1549334-1549356 GTAGAGACAGGGTTTCCCTGTGG - Intronic
901176569 1:7304091-7304113 AAGGAGGCAGAGTTTCTGTTTGG + Intronic
902790936 1:18767467-18767489 AGAGATGCAGAATTTCTCTTTGG - Intergenic
903166732 1:21525391-21525413 ATGGAGGCAGCGCTTGTCTTGGG + Intronic
904449350 1:30600991-30601013 TTGGAGGCGGGGTTTCTCTGGGG - Intergenic
904551216 1:31320438-31320460 ATAGGTACAGGGTTTCTTTTTGG - Intronic
904886572 1:33742929-33742951 ATAGAGGCTTTCTTTCTCTTGGG + Intronic
905018816 1:34794706-34794728 CTAGAGGCAGGCTTCCTCTATGG + Exonic
905052620 1:35064870-35064892 GTAGAGGCAGGGTTTCACCGTGG + Intronic
905125362 1:35712519-35712541 GTAGAGACAGGGTTTCACTGTGG - Intergenic
905838934 1:41156847-41156869 TTAGAGGCAGGGTTTCCCTATGG + Intronic
906377616 1:45308450-45308472 GTAGAGACGGGGTTTCTCTATGG - Intergenic
907174698 1:52508146-52508168 ATAGAGACGGGGTTTCACCTGGG - Intronic
908730607 1:67222298-67222320 ATAGAGGCGGGGTTTCACCATGG + Intronic
908841154 1:68281456-68281478 GTCGAGACAGGGTTTCTCTGTGG - Intergenic
909248030 1:73313736-73313758 GTAGAGACAGGGTTTCTCCTTGG + Intergenic
909632680 1:77784252-77784274 TTAGAGGCAGGGTCTTGCTTTGG + Intronic
910504758 1:87937314-87937336 TTGGAAACAGGGTTTCTCTTGGG + Intergenic
911647970 1:100355868-100355890 ATAGAGGTTGTATTTCTCTTTGG - Intronic
912229485 1:107775393-107775415 GTAGAGACAGGGTTTCACTGTGG - Intronic
912345709 1:108961674-108961696 GTAGAGACAGGGTTTCTCCATGG - Intronic
912353596 1:109037439-109037461 GTAGAGACAGGGTTTCACTGTGG - Intronic
912453907 1:109785238-109785260 ATTGAAGCAGGGTTTGTTTTAGG + Intergenic
912559959 1:110543781-110543803 ATAGAGCCACAGTTGCTCTTGGG - Intergenic
913395996 1:118373403-118373425 GTAGAGACAGGGTTTCACTGTGG + Intergenic
914764584 1:150626739-150626761 ATAGAGACGGGGTTTCACTATGG + Intronic
914903796 1:151727874-151727896 ATAGCGGCAGTTTTTCCCTTGGG + Intronic
915293307 1:154901004-154901026 GTAGAGACAGGGTTTCACTCAGG - Intergenic
915582969 1:156826484-156826506 GTAGAGACAGGGTTTCACCTTGG + Intronic
916121652 1:161533439-161533461 AGAGAGGCAGGGATTCAGTTTGG + Intergenic
917262008 1:173179995-173180017 AAAGAGGCAAGGTCTCTCTGGGG - Intergenic
917419869 1:174851701-174851723 ATAGAGACAGAGTCTCTCTGTGG + Intronic
919570822 1:199244670-199244692 ATAGAGACAGGGTTTCACCATGG - Intergenic
919634257 1:199988583-199988605 GTAGAGACAGGGTTTCTCTATGG + Intergenic
919886414 1:201938310-201938332 GTAGAGACGGGGTTTCTCTATGG + Intronic
920012306 1:202877652-202877674 GTAGAGACAGGGTTTCACATTGG + Intergenic
920449859 1:206051825-206051847 ATAGAAGCAGAGTTTCTCAGAGG - Intronic
920858735 1:209687284-209687306 TCAGAGCCAGTGTTTCTCTTTGG + Intronic
921627976 1:217399595-217399617 ATAGACACAGAGTTTCTTTTGGG + Intergenic
921900377 1:220443980-220444002 ATAGGGGCAGACTTTCTGTTTGG - Intergenic
922493502 1:226037755-226037777 ATGGATACAGGGTTTCTTTTGGG + Intergenic
923150444 1:231228413-231228435 ATAGAGGTAGGGTTTCACCATGG - Intronic
923227508 1:231952178-231952200 ACAGGGAAAGGGTTTCTCTTTGG - Intronic
923255842 1:232220643-232220665 ATAGAGACAGTGTCTCACTTAGG - Intergenic
923294520 1:232580737-232580759 ATACAGCCAGGCTTTCTCTAAGG - Intergenic
924115531 1:240742480-240742502 ATAGAGACAGGTTTTCGCTATGG + Intergenic
924213544 1:241795246-241795268 AGAGAGGCAGGGATTGTTTTCGG + Exonic
924438967 1:244070993-244071015 ATAGAGACGGGGTTTCTCCACGG + Intergenic
924711865 1:246536013-246536035 TTTGAGACAGAGTTTCTCTTTGG + Intergenic
924742524 1:246803571-246803593 GTAGAGACAGGGTTTCTCCACGG - Intergenic
1063311794 10:4959517-4959539 GTAGAGACAGGGTTTCACTATGG - Intronic
1063316005 10:5006955-5006977 GTAGAGACAGGGTTTCACTATGG + Intronic
1063492066 10:6473146-6473168 TTACAGGCAGTGTTTCTTTTTGG - Intronic
1063584805 10:7342592-7342614 ATAGAGACAGGGTTTCACCATGG + Intronic
1063647294 10:7897842-7897864 GTAGAGACAGGGTCTCACTTTGG + Intronic
1064032190 10:11889931-11889953 TTGGAGGCAGGTTTTATCTTTGG - Intergenic
1064215461 10:13396574-13396596 ACAGAGACAGAGTTTCTGTTTGG - Intergenic
1064275254 10:13899643-13899665 ATAGAGACAGGGTCTCGCTCTGG - Intronic
1064312650 10:14225437-14225459 ATGAAGGCACGGTTTCCCTTGGG - Intronic
1064824062 10:19375388-19375410 ATAGAGAAAGGGTTTTTCTCTGG + Intronic
1065195174 10:23257383-23257405 ATAGAGGCAGATCTTCTCTATGG + Intergenic
1065445267 10:25791802-25791824 AAAGAGGCAGGGTCTCTCTCCGG - Intergenic
1065600690 10:27365157-27365179 ATAGGTACAGGGTTTCTTTTGGG - Intergenic
1066324254 10:34340296-34340318 ATAGACGCAGTGTTCATCTTAGG - Intronic
1067702240 10:48582269-48582291 AGAGAGAAAGGGTATCTCTTGGG - Intronic
1068311818 10:55288493-55288515 AAAGATACAGGGTTTCTGTTAGG - Intronic
1068605859 10:59004141-59004163 ATACAGTCAGGATTTCTCTTTGG - Intergenic
1068640607 10:59401498-59401520 ATAGGTACAGGGTTTCTTTTTGG - Intergenic
1068875519 10:61991844-61991866 GTAGAGACAGGGTTTCTCCATGG - Intronic
1069400109 10:68035339-68035361 GTAGAGGCAGGGTTTCACCATGG + Intronic
1069440734 10:68425949-68425971 TTAGAGACAGGGTTTCACTGTGG - Intronic
1070689294 10:78512685-78512707 TTCGAGGCTGGGTCTCTCTTGGG + Intergenic
1070843479 10:79503944-79503966 ACAGAAGCAGGGTTACCCTTTGG - Intergenic
1070930186 10:80255656-80255678 ACAGAAGCAGGGTTACCCTTTGG + Intergenic
1071683440 10:87730535-87730557 ATACAGCCAGGCTTTCTCTAAGG - Intronic
1071729962 10:88237982-88238004 AGACAGGCAGGGTTTATTTTAGG + Intergenic
1072338908 10:94427032-94427054 ATAGGTACAGGGTTTCTTTTGGG - Intronic
1072471219 10:95715783-95715805 ATAGATACAGGATTTCTTTTGGG - Intronic
1072712733 10:97727829-97727851 ACAGGTACAGGGTTTCTCTTTGG - Intergenic
1072822709 10:98574005-98574027 AGGGATGCAGGGTTTCTTTTTGG - Intronic
1072836104 10:98714327-98714349 ATGGATACAGGGTTTCTTTTTGG - Intronic
1072942611 10:99780279-99780301 GTAGAGACAGGGTTTCACTGTGG + Intergenic
1073113302 10:101075739-101075761 ATAGAGTCAGCTTTTCTATTAGG - Intergenic
1073953011 10:108832482-108832504 ATAGAGATGGGGTTTCTCTTTGG - Intergenic
1074182547 10:111077188-111077210 ACGGAGGCAGGGGTTCTCCTGGG - Exonic
1074775952 10:116768373-116768395 ATAGGTACAGGGTTTCTCTTTGG + Intergenic
1075061036 10:119256853-119256875 TTAGATCCAGGGTTTCTTTTTGG - Intronic
1075110688 10:119579152-119579174 GTAGAGACATGGTTTCACTTGGG - Intronic
1075212181 10:120500657-120500679 AGAGAGGAAGGGTTTTTCTGGGG + Intronic
1075262130 10:120972227-120972249 ATAGACACAGGGTTTCTTTTGGG - Intergenic
1075314059 10:121438111-121438133 ATACAGGCAGTGTCTCTTTTGGG - Intergenic
1075421481 10:122304316-122304338 TTAGAGTCACGGTTTGTCTTTGG + Intronic
1075718438 10:124570587-124570609 ATGGGTACAGGGTTTCTCTTTGG - Intronic
1075789119 10:125070846-125070868 GTAGAGGCAGGATTTCACGTTGG + Intronic
1076506670 10:130979610-130979632 ATAGAGACGGGGTTTCACTGTGG + Intergenic
1076651803 10:131994751-131994773 ATAGAGACAGTGTGTCTGTTTGG - Intergenic
1077424771 11:2469855-2469877 ATAGAGACAGGGTTTCACCGTGG + Intronic
1079559915 11:21809195-21809217 ATAGAGTCAGGGTTTCTAAAGGG - Intergenic
1080474610 11:32578017-32578039 ATAGAGACAGGGTTTCACCATGG - Intergenic
1081197516 11:40179186-40179208 CTAGAGACAGGGTCTCTCTATGG + Intronic
1081625713 11:44654008-44654030 ATGGAGCCAGGGCCTCTCTTGGG + Intergenic
1082042353 11:47696448-47696470 AGAGAGACAGGGTTTCACGTAGG + Intronic
1082635533 11:55588434-55588456 ATAGATGGAGGATTTCTTTTTGG + Intergenic
1083689664 11:64399695-64399717 GTAGAGACGGGGTTTCTCTATGG - Intergenic
1083788428 11:64968286-64968308 TTAGAGACAGGATTTCTCTCTGG + Intronic
1084251701 11:67904374-67904396 ATGGATACAGGGTTTCTTTTGGG - Intergenic
1084821139 11:71691653-71691675 ATGGATACAGGGTTTCTTTTGGG + Intergenic
1086622389 11:88902765-88902787 GTAGAGACAGGGTTTCACATTGG - Intronic
1087803952 11:102535285-102535307 ATGGATACAGAGTTTCTCTTTGG - Intergenic
1088703946 11:112443774-112443796 ATAGACACAGAGTTTCTGTTTGG - Intergenic
1089530668 11:119126802-119126824 AAAAGGGCAGGGTTTCTCATGGG + Intronic
1090278200 11:125434126-125434148 AGAGAGGCGGGGTTTCTGTAGGG - Intergenic
1090598688 11:128347131-128347153 ATAGGCCCAGGGTTTCTCTGAGG + Intergenic
1091084000 11:132702875-132702897 ACAGAAGCAGGATTTCTGTTTGG + Intronic
1092254434 12:6918534-6918556 GTAGAGACAGGGTTTCACTGTGG + Intronic
1092364298 12:7863999-7864021 GTAGAGCCAGGGTTTCACTGTGG + Intronic
1092421971 12:8339166-8339188 ATAGATACAGGGTTTCTTTTGGG - Intergenic
1092452894 12:8619527-8619549 TTATAGGCAGTGTTTCTTTTTGG - Intergenic
1093388199 12:18584216-18584238 GTAGAGACAGGGTTTCACTGTGG + Intronic
1095095280 12:38144387-38144409 GTAGAGACAGGGTTTCGCTGTGG + Intergenic
1095462336 12:42456072-42456094 GTAGAGACAGGGTTTCTCCATGG - Intronic
1096579309 12:52574220-52574242 ATAGAGAGATGGTTTCTTTTGGG - Intergenic
1096763030 12:53859442-53859464 ATAGATACAGGTTTTCTCTTTGG + Intergenic
1096972200 12:55676058-55676080 GTAGAGACAGGGTATCTCTCAGG - Intergenic
1097127479 12:56786011-56786033 ATAGGTACAGGGTTTCTTTTTGG + Intronic
1099090808 12:78305371-78305393 TTAGGGGCGGGGTTTATCTTAGG + Intergenic
1099259856 12:80364531-80364553 ATAGGTACAGGGTTTCTTTTTGG - Intronic
1100507252 12:95234475-95234497 GTAGAGGCAGGGTTTCTCCATGG + Intronic
1101293007 12:103390417-103390439 ATGGATGCAGAGTTTCTGTTTGG - Intronic
1101343848 12:103866773-103866795 GTAGAGACAGGGTTTCACTGTGG + Intergenic
1101466705 12:104957400-104957422 AGAGAGACAGGGTTTCTTTTGGG + Intronic
1102176073 12:110875906-110875928 GTAGAGGCAGGGTTTCACCATGG - Intronic
1103097414 12:118143199-118143221 ATGGGGACAGGGTTTCTGTTGGG - Intronic
1103215717 12:119199948-119199970 GTAGAGGCAGGGTTTCACCATGG + Intronic
1104195466 12:126532974-126532996 ATAGAGACAGGGTTTCACCATGG + Intergenic
1104213351 12:126711804-126711826 AGAGAGGAAGGGTTTTTTTTTGG - Intergenic
1104459880 12:128946529-128946551 ATAGAGACAGGGTTTCACCATGG + Intronic
1105072415 12:133242745-133242767 ACAAAGGCTGGGTTTCTCTCTGG + Intergenic
1105911738 13:24874813-24874835 ACAGGTGCAGGGTTTCTGTTTGG - Intronic
1106621412 13:31374373-31374395 ATGGAGGAAGGGGGTCTCTTAGG - Intergenic
1107337275 13:39368396-39368418 ATAGAGACAGGGTTTCACCATGG - Intronic
1107352387 13:39529273-39529295 ATAGAGACAGGGTTTCTCCATGG + Intronic
1108249832 13:48552873-48552895 ATAGAGACGGGGTTTCACTGTGG + Intergenic
1108614166 13:52115196-52115218 GTAGAGACAGGGTTTCACTGTGG + Intronic
1109007976 13:56902436-56902458 GTAGAGACAGGGTTTCACTGTGG + Intergenic
1109737715 13:66508283-66508305 ATAGATGTAGGATTTCACTTGGG + Intronic
1109878022 13:68430789-68430811 ATATAGTCAGGCTTTCTCTAAGG - Intergenic
1110167070 13:72455586-72455608 ATGGGTACAGGGTTTCTCTTTGG + Intergenic
1110496979 13:76179415-76179437 ATAGAGGGAGAGGTTATCTTGGG + Intergenic
1111586008 13:90285248-90285270 ATAGAGACGGGGTTTCACTGGGG + Intergenic
1113120068 13:106916474-106916496 AAAAAGGCAGGGTTGTTCTTGGG + Intergenic
1113993992 14:16052369-16052391 GTAGAGACAGGGTTTCACTGTGG + Intergenic
1114212584 14:20627765-20627787 TTACAGGCAGTGTTTCTTTTTGG - Intergenic
1114613879 14:24058282-24058304 ATGGAGCCAGGGTTTGACTTAGG - Intronic
1115304853 14:31923444-31923466 AAAGAAGCACGGTTTCTCTTTGG - Intergenic
1115553247 14:34523420-34523442 ATAGAGACAGGGTTTCACCGTGG + Intronic
1115559473 14:34570250-34570272 GTAGAGACAGGGTTTCTCCATGG + Intronic
1116705458 14:48292146-48292168 AGAGAGGCAGTATTTTTCTTTGG + Intergenic
1117501420 14:56356561-56356583 ATTGAAGCAGGATTTCTGTTGGG + Intergenic
1117617462 14:57548254-57548276 ACAGAGGGAGGGGTTCTATTTGG - Intergenic
1118170983 14:63388322-63388344 ATAGAGACAGGGTTTCACCATGG + Intronic
1118508260 14:66440831-66440853 AAAGACGCATGGGTTCTCTTTGG + Intergenic
1119336803 14:73840210-73840232 GTAGAGACAGGGTTTCTCCATGG - Intergenic
1120794672 14:88619398-88619420 ATAGAGGCGGGGTCTCACTATGG + Exonic
1120821972 14:88920058-88920080 ATAGATGCAGAGTTTGTATTTGG + Intergenic
1121154699 14:91671832-91671854 GTAGAGGCAGGGTTTCACCGTGG - Intronic
1121653037 14:95574087-95574109 ACAGAGGGAGGGTCTCTCTGAGG - Intergenic
1121940058 14:98061935-98061957 AAAAAGTCATGGTTTCTCTTAGG - Intergenic
1122180048 14:99948265-99948287 ATAGAGACAGGGTTTCACCATGG - Intergenic
1122308796 14:100781841-100781863 ATGGGGGCAGAGTTTCTGTTTGG - Intergenic
1122700278 14:103583739-103583761 ACTGAGGCAGTCTTTCTCTTTGG + Intronic
1124059666 15:26278254-26278276 ATGGATACAGGGTTTCTTTTTGG - Intergenic
1124072627 15:26410112-26410134 ATAGATGCAGGATTTCTATTTGG - Intergenic
1124514681 15:30356558-30356580 ATAGAGACAGGGTTTCAATTTGG + Intergenic
1124728240 15:32174204-32174226 ATAGAGACAGGGTTTCAATTTGG - Intergenic
1125049573 15:35281362-35281384 TTTCAGGCAGTGTTTCTCTTGGG - Intronic
1125964216 15:43860065-43860087 GTAGAGACAGGGTCTCTCCTTGG - Intronic
1125985542 15:44047675-44047697 ATGGATACAGGGTTTCTTTTAGG - Intronic
1126020423 15:44395203-44395225 GTAGAGACAGGGTTTCACTGTGG + Intronic
1126464193 15:48945734-48945756 ATGGTTACAGGGTTTCTCTTTGG + Intronic
1126637966 15:50797581-50797603 GTAGAGACAGGGTTTCTCTGTGG - Intergenic
1127237934 15:57076036-57076058 GTAGAGACAGGGTCTCACTTAGG + Intronic
1127786056 15:62355832-62355854 TTAGAGACAGGGTTTCGCTCTGG + Intergenic
1127817345 15:62622836-62622858 ATGGAGTTTGGGTTTCTCTTGGG + Intronic
1128143679 15:65319852-65319874 ATGGATACAGGGTTTCTTTTTGG - Intergenic
1128194601 15:65740776-65740798 GTAGAGACAGGGTCTTTCTTAGG - Intronic
1129066259 15:72906834-72906856 GTAGAGACAGGGTTTCGCTGTGG - Intergenic
1129067546 15:72918952-72918974 AAAGAGTCAGGGTTTCTTTAAGG - Intergenic
1129224215 15:74157299-74157321 AGAGAGGCAGGGTTTGTCAGAGG - Intergenic
1129317830 15:74756449-74756471 ATGGGTGCAGGGTTTCTTTTAGG - Intergenic
1129796749 15:78383481-78383503 ATAGAGACAAGGTCTCTCTATGG + Intergenic
1130209142 15:81907359-81907381 ATAGAGGCAATGGTTCTCTTTGG - Intergenic
1130689252 15:86066422-86066444 ACAGAGGCAGGGCTTCACTGAGG - Intergenic
1131535190 15:93231543-93231565 ATAGAGGGATGGTTTCTCCTGGG + Intergenic
1132613653 16:829838-829860 ATGGAGACAGGGTTTCCTTTTGG - Intergenic
1132836500 16:1956184-1956206 TTTGAGACAGGGTTTCTCTCTGG + Intronic
1133005451 16:2878770-2878792 ATAGAGACAGGGTTTCACCATGG + Intergenic
1133376321 16:5290411-5290433 ATGGATACAGGGTTTCTTTTTGG + Intergenic
1133790074 16:9002809-9002831 ATAGAGACAGGGTTTCACCGTGG + Intergenic
1133814955 16:9190013-9190035 GTAGAGACAGGGTTTCTCCATGG + Intergenic
1134601102 16:15534367-15534389 GTAGAGACAGGGTTTCGCCTTGG - Intronic
1134872077 16:17661245-17661267 ATAGAGACGGGGTTTCACTGGGG - Intergenic
1134899809 16:17927269-17927291 AAAGAGGAAGGGTTTCTAGTTGG + Intergenic
1135104965 16:19641248-19641270 ATAGAGACAGGGTTTCGCCATGG + Intronic
1135744147 16:25001895-25001917 GTAGAGACAGGGTTTCGCTTTGG - Intronic
1135764760 16:25167941-25167963 ATAGAGACAGGGTTTCATGTTGG + Intronic
1137473281 16:48782258-48782280 ATGGATGAAGGGTTTCTGTTGGG + Intergenic
1138950190 16:61903506-61903528 GTAGAGACAGGGTTTCACTGTGG + Intronic
1139804349 16:69551308-69551330 GTAGAGACAGGGTTTCTCCATGG - Intergenic
1139934916 16:70563014-70563036 ATAGAGACAGGATTTCACCTTGG + Intronic
1140213515 16:72989296-72989318 GTAGAGACAGGGTTTCACCTTGG - Intronic
1140384658 16:74524828-74524850 ATAGATACAGAGTTTCTTTTGGG - Intronic
1141122336 16:81369765-81369787 GTAGAGGCAGGGTTTCACCGTGG + Intronic
1142207284 16:88789905-88789927 ACAGTGGCAGAGTTTCTCTTTGG + Intergenic
1142303332 16:89271416-89271438 GTAGAGACGGGGTTTCTCCTGGG + Intronic
1142758027 17:2026956-2026978 ATAGAGACGGGGTTTCACCTTGG - Intergenic
1142811457 17:2397378-2397400 ATGGAGGCAGGGTCTGTGTTAGG - Intronic
1142835221 17:2580664-2580686 AGAGAGTCAGGATTTCTCATGGG - Intergenic
1143073960 17:4323730-4323752 GTAGAGGCAGGGTTTCACCATGG + Intronic
1143576341 17:7795811-7795833 GTAGAGACAGGGTTTCTCCATGG - Intronic
1143700092 17:8652271-8652293 GTAGAGACAGGGTTTCCCTGGGG + Intergenic
1143971791 17:10801233-10801255 GTAGAGACAGGGTTTCACTGTGG + Intergenic
1144183419 17:12773646-12773668 GTAGAGACAGGGTTTCACTTTGG - Intergenic
1144249611 17:13402528-13402550 ACAGAGGCAGGGTTTCTGAATGG - Intergenic
1144496967 17:15753320-15753342 ATAGAGACAGGGTTTCGCCATGG + Intergenic
1144528211 17:16009935-16009957 ATACAGGCAGTGATTCTCTTTGG + Intronic
1144544196 17:16177458-16177480 ATTGTGGCAGCCTTTCTCTTTGG + Intronic
1144878401 17:18416305-18416327 GTAGAGGCAGGGTTTCACTAAGG - Intergenic
1144904666 17:18631588-18631610 ATAGAGACAGGGTTTCGCCATGG - Intergenic
1145114821 17:20199415-20199437 ATAGAGACAGGGTCTTTCTCTGG + Intronic
1146031977 17:29373965-29373987 GTAGAGACAGGGTTTCACTATGG + Intergenic
1146045342 17:29500996-29501018 ATGGATGCAGAGTTTCTGTTTGG + Intronic
1146122777 17:30209864-30209886 TTAGAGGCAGGGATTCTCCAGGG - Intronic
1146287482 17:31583703-31583725 ATACAGGCAGTGTTTTTCTTTGG + Intergenic
1146361939 17:32184201-32184223 ATAGGTACAGGGTTTCTCTTTGG - Intronic
1146783899 17:35701798-35701820 ATAGAGACAAGGTCTCACTTAGG + Intronic
1147252486 17:39161373-39161395 TGAGAGACAGGCTTTCTCTTTGG + Intronic
1147392765 17:40120814-40120836 GTAGAGACAGGATTTCTCCTTGG - Intergenic
1147462884 17:40585938-40585960 GTAGAGACAGGGTTTCACTGTGG + Intergenic
1147875479 17:43617760-43617782 GTAGAGACAGGGTTTCACTGTGG - Intergenic
1147885874 17:43684142-43684164 TTAGAGGCAAGGTGTCTCTGAGG + Intergenic
1148549071 17:48539485-48539507 ATTGGGGCAGGGTTCCTCTTGGG - Intergenic
1149568134 17:57653719-57653741 AGAGAGGCAGGGTTAATTTTGGG - Intronic
1149938867 17:60841575-60841597 GTAGAGACAGGGTTTCACTGTGG + Intronic
1150184875 17:63169932-63169954 ATAGAGACAGGATTTCACTGTGG - Intronic
1150253585 17:63725041-63725063 GTAGAGACAGGGTTTCACTTTGG - Intronic
1150332491 17:64305536-64305558 ATAGAGACAGGGTTTCGCCCAGG - Intergenic
1150771679 17:68047296-68047318 CTAGAGACAGGGTTTCGCCTGGG - Intergenic
1150899593 17:69257179-69257201 GTAGAGACAGGGTTTCTCCATGG - Intronic
1150904490 17:69323285-69323307 TTATAGGCAGTGTTTCTTTTTGG - Intronic
1151157438 17:72135760-72135782 ATGGAGGCAGGGGTTCACATAGG - Intergenic
1151481627 17:74373025-74373047 GTAGAGACAGGGTTTCACTGTGG - Intergenic
1151668889 17:75560667-75560689 GTAGAGACAGGGTTTCTCCATGG + Intronic
1151972303 17:77464958-77464980 ATGGGGGCAGGGTCTCTTTTGGG - Intronic
1152137419 17:78512753-78512775 GTAGAGACAGGGTTTCACCTTGG - Intronic
1152490256 17:80626915-80626937 ATGGAGACAGAGTTTCTGTTTGG - Intronic
1152651452 17:81495604-81495626 GTAGAGACAGGGTTTCTCCATGG - Intergenic
1153256522 18:3177340-3177362 AGAGAGGAAGGCTTTCTGTTGGG + Intronic
1153284717 18:3447685-3447707 ATTGTGCCAGTGTTTCTCTTTGG + Intronic
1154347885 18:13558797-13558819 ATGGTGGCAGAGGTTCTCTTTGG - Intronic
1154462286 18:14604609-14604631 ATGGTTGCAGGGTTTCTTTTGGG + Intergenic
1155230260 18:23766652-23766674 ATAGAAGCAGGGTTTCACCATGG - Intronic
1156847655 18:41687066-41687088 ATAAATACAGGGTTTCTTTTTGG + Intergenic
1157292992 18:46423235-46423257 ACAGAGGCAGGGCTTGTCCTTGG + Intronic
1157528453 18:48403034-48403056 ATGCAGGGAGGGTTTCTCTTTGG - Intronic
1157686075 18:49643917-49643939 ATGGAGGCAGAGTTTCAGTTTGG - Intergenic
1158666056 18:59433787-59433809 GTAGAGACAGGGTTTCACTGTGG + Exonic
1158895279 18:61907100-61907122 AAAGAATCAGCGTTTCTCTTTGG + Intergenic
1158922392 18:62207788-62207810 ATAGGTACAGGGTTTCTTTTGGG - Intronic
1158933672 18:62345273-62345295 ATAAAGGCATGCTTTGTCTTTGG + Intronic
1159503764 18:69307525-69307547 ATAGAGACGGGGTTTCCCTATGG - Intergenic
1159790730 18:72776626-72776648 AGAGGTGAAGGGTTTCTCTTGGG + Intronic
1159825762 18:73208449-73208471 GTTGAGGCAGTGTCTCTCTTTGG + Intronic
1161186017 19:2921277-2921299 CTAGAGACAGGGTTTCACTGGGG - Intergenic
1161270126 19:3385131-3385153 ATTGAAGCAGGGATTCCCTTGGG - Intronic
1161648661 19:5470478-5470500 ATGTAGGCATCGTTTCTCTTGGG - Intergenic
1161771361 19:6232725-6232747 ACAGACACAGGGTTTCTTTTGGG + Intronic
1161926144 19:7301643-7301665 ATGGGGACAGGGTTTCTGTTTGG - Intergenic
1162179657 19:8859379-8859401 AAAGAGACTGGGTTTCTCTGGGG + Intronic
1162370616 19:10276786-10276808 ATAGAGACGGGGTTTCTCCATGG - Intronic
1162498466 19:11036759-11036781 ATCGGGGCAGGGCTTCTTTTGGG - Intronic
1162979738 19:14230866-14230888 GTAGAGACAGGGTTTCACTATGG + Intergenic
1163573225 19:18095546-18095568 ATAGGTACAGGGTTTCTTTTGGG + Intronic
1163800152 19:19359748-19359770 GTAGAGACAGGGTTTCACTATGG - Intergenic
1165184435 19:34004788-34004810 AGAGAGTCAGGGGTTCTCTCTGG + Intergenic
1165657379 19:37545619-37545641 ATGGATACAGGGTTTCTTTTTGG - Intronic
1166015439 19:39976049-39976071 ATAGAGACGGGGTTTCACTGTGG - Intronic
1166522172 19:43487699-43487721 AGGGATGCAGGGTTTCTTTTGGG + Intronic
1166656680 19:44617276-44617298 AGAGACGCAGGGATTCTTTTTGG + Intronic
1166763777 19:45240493-45240515 ATGGATGCAGGGTTTCCTTTTGG + Intronic
1167496970 19:49825430-49825452 GTAGAGATAGGGTTTCACTTTGG + Intronic
1168286574 19:55337852-55337874 GTAGAGACAGGGTCTCTCTAGGG - Intergenic
1168564671 19:57413059-57413081 ATAGAGACAGGGTTTCACCATGG + Intronic
1168600022 19:57709877-57709899 GTAGAGACAGGGTTTCACTATGG + Intronic
1168612677 19:57813924-57813946 GTAGAGACAGGGTTTCTCCATGG + Intronic
1168614061 19:57823609-57823631 AATGAGGCAGGGTTCCTCTGGGG + Intronic
925428175 2:3768755-3768777 GTAGAGACAGGGTTTCTCCATGG + Intronic
925969441 2:9096410-9096432 AGAGAGGCAGGGTTTTCCCTTGG + Intergenic
926100854 2:10116640-10116662 ATAGAGACAGGGTCTCACTATGG - Intergenic
926122250 2:10249625-10249647 ATAGAGGAAGGTTTTCAATTTGG + Intergenic
926287833 2:11504503-11504525 ATAGATGCAGGATTTCTTTTTGG - Intergenic
926669748 2:15565061-15565083 ATATAGACAGGCTTTCTCTCTGG - Intergenic
927079853 2:19616666-19616688 GTAGAGACAGGGTTTCACTTGGG - Intergenic
927143894 2:20148070-20148092 ATAGACACAGGTTTTCTTTTGGG + Intergenic
927571602 2:24165289-24165311 ATAGGGCCAGGGTTGCTCCTTGG - Intronic
927834399 2:26381435-26381457 GAAGATGCAGCGTTTCTCTTTGG + Intronic
927922536 2:26984337-26984359 ATAGTGGCAGTGATTCTCTTTGG - Intronic
928741851 2:34363884-34363906 TTATAGGCAGTGTTTCTTTTGGG - Intergenic
929105200 2:38358503-38358525 ATAGAGACGGGGTTTCCCTGTGG - Intronic
929708856 2:44245744-44245766 TTACAGGCAGTGTTTCTCTTGGG - Intergenic
930631098 2:53756219-53756241 AGACAGGCAGGATTTCCCTTTGG - Intronic
931289547 2:60860503-60860525 ATAGATACAGGGTTTCTTTGGGG - Intergenic
932169544 2:69541121-69541143 ATGGATACAGGGTTTCTTTTGGG + Intronic
932327042 2:70870227-70870249 TTTGAGACAGGGTTTCACTTTGG + Intergenic
933348358 2:81120310-81120332 ATAGGTACAGGGTTTCTTTTTGG - Intergenic
933493159 2:83014414-83014436 AAATAGGCAGCTTTTCTCTTTGG - Intergenic
933916554 2:87000138-87000160 ATAGGGGCAGTTTTACTCTTAGG - Intronic
934006440 2:87769788-87769810 ATAGGGGCAGTTTTACTCTTAGG + Intronic
935637484 2:105260617-105260639 ATGGGGACAGGGTTTCTGTTCGG + Intergenic
935770093 2:106410696-106410718 ATAGGGGCAGTTTTACTCTTAGG + Intronic
935910002 2:107885228-107885250 ATAGGGGCAGTTTTACTCTTAGG - Intronic
935968121 2:108502103-108502125 ATAGGGGCAGTTTTACTCTTAGG - Intronic
937540105 2:122939267-122939289 ATGGAGACAGGGCTTCCCTTTGG - Intergenic
937709888 2:124968207-124968229 ATAGATATATGGTTTCTCTTGGG + Intergenic
938472291 2:131575871-131575893 ATAGAGACAGGGTTTCACCATGG + Intergenic
938863462 2:135394040-135394062 GTAGAGACAGGGTTTCACTATGG + Intronic
939051821 2:137316576-137316598 ATAGAGACAGGGTTTCACTGTGG - Intronic
939929252 2:148212204-148212226 ATGGATACAGGGTTTCTTTTTGG - Intronic
941520505 2:166536567-166536589 AAAGAAGCAGGGTCTCTTTTAGG - Intergenic
942739667 2:179160947-179160969 TTAGAGACAGGGTCTCTCTCTGG + Intronic
943543492 2:189245669-189245691 GTAGAGACAGGGTTTCACTGTGG + Intergenic
944745562 2:202651868-202651890 GTAGAGACAGGGTTTCTCCATGG - Intronic
944975534 2:205045704-205045726 AGAGAGACATGGTTTTTCTTAGG - Intronic
946039776 2:216773643-216773665 AAGGAGGCAGAGTTTCTCCTGGG - Intergenic
946042064 2:216791071-216791093 ATAGAGACAGGGTTTCACCATGG - Intergenic
946202474 2:218078732-218078754 ATGGGTACAGGGTTTCTCTTTGG - Intronic
946823787 2:223656057-223656079 GTAGAGACAGGGTTTCTCCATGG + Intergenic
1169455793 20:5751098-5751120 CTGGAGGCAGGATTTTTCTTTGG - Intronic
1169578484 20:6992544-6992566 ATAGGTACAGGGTTTCTTTTTGG - Intergenic
1170362014 20:15556676-15556698 ACAGAGGCAGTGATTCTTTTTGG - Intronic
1171093125 20:22305012-22305034 AAAGAGGAAGGCTCTCTCTTGGG - Intergenic
1171397963 20:24851140-24851162 GTAGAGACAGGGTTTCTCCATGG + Intergenic
1171501192 20:25594558-25594580 GTAGAGACAGGGTTTCTCCATGG + Intergenic
1172381481 20:34496617-34496639 GTAGAGACAGGGTTTCTCCATGG - Intronic
1172423337 20:34836357-34836379 GTAGAGACAGGGTTTCTCCATGG + Intergenic
1172554648 20:35830230-35830252 ATAGATACAGGGTTTCAGTTTGG - Intronic
1173130368 20:40387389-40387411 ATAGAGGCAGTGATCCTCTCTGG + Intergenic
1173242006 20:41305307-41305329 GTAGAGGCAGGGTTTCACCTGGG - Intronic
1173654080 20:44687158-44687180 ATAGAGGCAGAGTGTCAGTTTGG - Intergenic
1173879946 20:46405024-46405046 ATAGATGCAGGGTTTGAATTTGG - Intronic
1174313744 20:49680661-49680683 ATAGGTGCAGAGTTTCTGTTTGG + Intronic
1175155385 20:56967904-56967926 ATAGAGGCAGGGTACCACTTGGG - Intergenic
1175476426 20:59278155-59278177 GTAGAGACAGGGTTTCTCCATGG + Intergenic
1175500795 20:59449243-59449265 ACAGAAGCAGGGGTTCTCTATGG + Intergenic
1175648025 20:60692604-60692626 TTATAGGCAGTGTTTCTTTTGGG + Intergenic
1175759678 20:61553307-61553329 ATGGGTGCAGGGTTTCTTTTGGG + Intronic
1176036108 20:63037663-63037685 ATGGAGACAGGGTTTCTGTTTGG - Intergenic
1176812274 21:13554076-13554098 ATGGTTGCAGGGTTTCTTTTGGG - Intergenic
1176989289 21:15475397-15475419 ATAGAAGCAGGTTTTCACTAAGG + Intergenic
1178194487 21:30328085-30328107 ATAGATACAGTGTTTCTCTCAGG + Intergenic
1178748715 21:35279966-35279988 ATGGATACAGGGTTTCTTTTTGG - Intronic
1179041372 21:37805133-37805155 ATAAAGACAGAGTTTCTTTTTGG + Intronic
1180165290 21:46022615-46022637 ATCTGGGAAGGGTTTCTCTTCGG - Intergenic
1180313276 22:11255146-11255168 GTAGAGACAGGGTTTCACTGTGG - Intergenic
1180687610 22:17681702-17681724 ATAGAGGCAGGCTTGGACTTTGG + Intronic
1180695953 22:17751740-17751762 ACACAGCCAGGGTTTCTCCTGGG - Intronic
1181034045 22:20161477-20161499 AGAGGGGCAGGGTTCCTCTGAGG + Intergenic
1182097411 22:27635384-27635406 ACAGAGGCAGGATTTGTCTCAGG - Intergenic
1182113194 22:27738897-27738919 ATTGATACAGGGTTTCTTTTTGG + Intergenic
1182631197 22:31686917-31686939 ATACAGGAAGAGTTTCACTTAGG - Intronic
1184733649 22:46385279-46385301 ATAGAGACAGGGTCTCACTATGG + Intronic
949892598 3:8744479-8744501 GTAGAGACAGGGTTTCACTGTGG + Intronic
950054928 3:10016929-10016951 GTAGAGACAGGGTTTCACTGTGG + Intergenic
950453926 3:13081450-13081472 ATAGAGATAGGGTCTCCCTTTGG + Intergenic
950478961 3:13233001-13233023 ATGGAGGCAGAGTTTGTATTTGG + Intergenic
950564058 3:13754588-13754610 ATAGGGACAGGGTTTCTTTTCGG - Intergenic
951109374 3:18784089-18784111 ATAGAGACAGTGTCTCCCTTTGG - Intergenic
951359596 3:21709435-21709457 ACAGAAGCAGGGGTTCTCTCAGG + Intronic
952366269 3:32677604-32677626 ATAGAGACAGGGTTTCCCCATGG - Intergenic
952388519 3:32860340-32860362 ATAGATACAGGGTTTCGCTGTGG + Intronic
952457943 3:33491931-33491953 ATAGGCACAGGGTTTCTGTTTGG - Intergenic
952743755 3:36759356-36759378 ATAGAGGGAGAGTGTCTCTCTGG - Intergenic
953804706 3:46058426-46058448 ACAGAGACAGGGTTTCTTTAAGG - Intergenic
953835620 3:46340499-46340521 ATAGGTACAGGGTTTCTTTTTGG + Intergenic
954026356 3:47786345-47786367 GTAGAGACAGGGTTTCACTATGG - Intergenic
954520803 3:51224496-51224518 ATAGAAGCAGGGTTTGTTTTTGG - Intronic
955278930 3:57575030-57575052 GTAGAGACAGGGTTTCTCCCTGG + Intronic
955486004 3:59435370-59435392 ATAGGTGCAGGGTTTCTTTTAGG + Intergenic
955524656 3:59808046-59808068 ATGGGTGCAGGGTTTCCCTTCGG - Intronic
955533925 3:59903306-59903328 ATAGGCACAGGGTTTCTTTTGGG + Intronic
955731206 3:61989107-61989129 ATAAAGGCAGGTTTTTCCTTTGG - Intronic
956142482 3:66159795-66159817 ATAGTGGCAGGGCTTTCCTTAGG - Intronic
957065777 3:75520782-75520804 ATGGATACAGGGTTTCTTTTTGG - Intergenic
958817154 3:98928682-98928704 GTAGAGACAGGGTTTCACCTTGG + Intergenic
959709104 3:109367097-109367119 GTAGAGACAGGGTTTCTCCATGG - Intergenic
959853916 3:111125210-111125232 GTAGAGACAGGGTTTCTCCATGG + Intronic
960821410 3:121736884-121736906 TTAGAGGCAGGGTCTCACTCTGG - Intronic
961287373 3:125817279-125817301 ATGGATACAGGGTTTCTTTTTGG + Intergenic
961298456 3:125905650-125905672 ATAGATACAGGGTTTCTCCTCGG + Intergenic
961792017 3:129383095-129383117 GTAGAGTCAGGGTTTTACTTTGG - Intergenic
961899711 3:130198689-130198711 ATGGATACAGGGTTTCTTTTGGG - Intergenic
961946338 3:130692953-130692975 ATGGATACAGGGTTTCTTTTGGG - Intronic
962116828 3:132518811-132518833 ATAGAAATAGGGTTTCTTTTTGG - Intronic
962223522 3:133585072-133585094 TTAGAGACAGGGTTTCACTCTGG + Intronic
962578446 3:136775721-136775743 GTAGAGACAGGGTTTCACTGTGG + Intergenic
962977695 3:140459880-140459902 ATATTGGCAGGGTTCCTCTCAGG - Intronic
963278288 3:143355164-143355186 ATAAAGGAAAGGTTTCACTTGGG - Intronic
964465343 3:156985648-156985670 ATAGAGACAGGGTTTCACCATGG - Intronic
965323124 3:167271551-167271573 AGTGAGGCAGGATTTCTCTCAGG - Intronic
965587912 3:170335227-170335249 GTAGAGACAGGGTTTCACTGTGG - Intergenic
965711806 3:171563298-171563320 ATAGAGGCAGGGGTGCTCAGAGG - Intergenic
965744775 3:171913343-171913365 GTAGAGGCAGGGTTTCACCGTGG + Intronic
966802460 3:183776766-183776788 ATAGAGACAGGGTTTCACCATGG - Intronic
967585558 3:191210226-191210248 ATGGAGGCAGATTTTCCCTTTGG - Intronic
967750892 3:193115107-193115129 ATACAGCCAGGCTTTCTCTGAGG - Intergenic
968020727 3:195386257-195386279 ATAGATACAGGGTTTCTTTTTGG + Intronic
968419147 4:468080-468102 ATAGAGACAGGGTTTCACCGCGG - Intronic
969010375 4:4056844-4056866 ATAGATATAGGGTTTCTTTTTGG - Intergenic
969439811 4:7210299-7210321 ATAGAGGCGGGGCTTCTCTGTGG + Intronic
969743678 4:9053051-9053073 ATGGATACAGGGTTTCTTTTTGG + Intergenic
970296661 4:14638152-14638174 GTAGAGACAGGGTTTCACTGTGG + Intergenic
970446939 4:16131358-16131380 TTAAAGGAAGGGTTTCTCATAGG + Intergenic
971222673 4:24722965-24722987 AGAGAGTCAGGGTGTCTCTTTGG - Intergenic
971326757 4:25650738-25650760 GTAGAGACAGGGTTTCACTATGG - Intergenic
971517423 4:27505464-27505486 ATAGAAGCAGGTTTTCTAGTTGG + Intergenic
971547079 4:27899650-27899672 ATGGATACAGGGTTTCTATTTGG + Intergenic
973628375 4:52794901-52794923 TTGGAGGCTGGGTTTCTATTTGG - Intergenic
974013608 4:56629281-56629303 ATAGGTACAGGGTTTCTCTTTGG + Intergenic
974235723 4:59179431-59179453 ATTGGGGCAGGGTTTTTCCTGGG - Intergenic
975821762 4:78277994-78278016 GTAGAGACAGGGTTTCACTGTGG + Intronic
976054166 4:81043770-81043792 GTAGAGACAGGGTTTCACTATGG + Intronic
976744366 4:88388818-88388840 ATGCAGGCAGGCTTTCTCTGAGG - Intronic
979617757 4:122763407-122763429 ATAGATTCAGGGTTTCATTTGGG + Intergenic
979813529 4:125069265-125069287 ATAGATACAGGGTTTATTTTTGG + Intergenic
980044072 4:127969382-127969404 ATAGAGACGGGGTTTCTCCATGG + Intronic
981074578 4:140578382-140578404 ATTGAAGCATGATTTCTCTTTGG - Intergenic
981107283 4:140895279-140895301 TTAGAGACAGGGTTTCTCTAAGG + Intronic
981194457 4:141902560-141902582 ATACAGCCAGGTTTTCTCTGTGG + Intergenic
981234921 4:142404493-142404515 AAAGAGGAAGTGTTTCCCTTTGG - Intronic
982342595 4:154318176-154318198 ATAGACACAGGGTTTGTATTTGG - Intronic
982473414 4:155821734-155821756 TTGAAGGCAGGGTTTCTCTGGGG - Intergenic
982732200 4:158968210-158968232 ATAGAGACAGGGTTTCACCATGG + Intronic
983436113 4:167717873-167717895 ATAAAGCCAGGGTCTATCTTAGG + Intergenic
984586125 4:181566891-181566913 TTAGAGGCAGGGCTGGTCTTAGG - Intergenic
984598427 4:181698027-181698049 GTAGAGACAGGGTTTCACTATGG - Intergenic
984839426 4:184054071-184054093 GTAGAGACAGGGTTTCACTGTGG + Intergenic
984890177 4:184484852-184484874 ATAGAGACAGGGTTTCACCATGG + Intergenic
987000507 5:13655380-13655402 ATGGAAGGAGGCTTTCTCTTTGG - Intergenic
987046527 5:14114317-14114339 GTAGAGACAGGGTTTCACGTTGG + Intergenic
987398565 5:17450479-17450501 ATAGAGCCAGTGTCTCTCTCTGG + Intergenic
987663758 5:20908834-20908856 GTAGAGACAGGGTTTCACTGTGG - Intergenic
987845740 5:23282024-23282046 ATAGATACAGAGTTTCTATTTGG + Intergenic
988515621 5:31901729-31901751 ATGGATGGAGGGTTTCTTTTAGG - Intronic
988585993 5:32507974-32507996 TTGAAGGCAGGGTTTCACTTGGG + Intergenic
989110892 5:37905751-37905773 GTAGAGACAGGGTTTCACGTTGG + Intergenic
989630062 5:43472952-43472974 GTAGAGACAGGGTTTCACTGTGG - Intronic
990334045 5:54755185-54755207 ATTGAGCCAGGCTTGCTCTTAGG + Intergenic
991368689 5:65895641-65895663 GTAGAGGCGGGGTTTCACCTTGG - Intergenic
991932765 5:71770600-71770622 ATGGGTGCAGGATTTCTCTTTGG - Intergenic
992083199 5:73254513-73254535 ATAGATTCAGGGCTTCTCTTGGG - Intergenic
992233236 5:74684002-74684024 ATAGAGACGGGGTTTCACTTTGG + Intronic
992357967 5:76005106-76005128 ATAGCCCCAGGGTTTCTCTGAGG + Intergenic
992885638 5:81157166-81157188 ATAGAGACAGGGTTTCACCGTGG - Intronic
994102074 5:95904206-95904228 ATGAGGGCAGGGTTTCTATTGGG + Intronic
994718112 5:103347966-103347988 ACACAGGCAGGGTTTCCCTAGGG - Intergenic
994994818 5:107046836-107046858 ATAGGTGCAGGGTTTCTTTTAGG + Intergenic
995425407 5:112016116-112016138 ATAGGGACAGGATTTCTATTTGG + Intergenic
995719342 5:115113721-115113743 TTACAGGCAGTGTTTCTTTTTGG + Intergenic
995956105 5:117778554-117778576 GTAGAGACAGGGTTTCTCCAAGG + Intergenic
996067244 5:119092611-119092633 ATAGACACGGGATTTCTCTTGGG - Intronic
996741404 5:126802625-126802647 ATAGAGACAGGGCTTCATTTTGG + Intronic
997290842 5:132733145-132733167 ATGGATACAGGGTTTCTTTTTGG + Intronic
997334925 5:133100599-133100621 GTAGAGACAGGGTTTCACCTTGG - Intronic
997927374 5:138043178-138043200 ATAGAGACAGGGTCTCACTATGG - Intronic
998168410 5:139857691-139857713 AAGGAAGCAGGGATTCTCTTTGG - Intronic
999422375 5:151456190-151456212 GTAGAGGCAGGGTCTCACTATGG + Intronic
999427614 5:151501106-151501128 ATAGAGAAAGGGTTTGTCTGAGG - Intergenic
999750885 5:154627576-154627598 ACAGAGGCAGGGTGTGTGTTGGG - Intergenic
1000051704 5:157568789-157568811 CTAGAGGCTGGATTTCACTTGGG - Intronic
1000578383 5:163005391-163005413 ATAGACACAGGGTTTCAGTTGGG - Intergenic
1000671436 5:164067871-164067893 GTAGAGGCAGGGTTTCAGGTTGG + Intergenic
1001142787 5:169159240-169159262 GTAGAGACAGGGTTTCTCCATGG - Intronic
1001278357 5:170367130-170367152 GTAGAGACAGGGTTTCGCTGTGG - Intronic
1001933778 5:175690717-175690739 AGAGGTGCAGGGTTTCTTTTGGG - Intergenic
1002152111 5:177242710-177242732 GTAGAGGCAGGGTTTCTCAATGG + Intronic
1002396545 5:178960438-178960460 GTAGAGACGGGGTTTCTCCTTGG + Intronic
1002509324 5:179702950-179702972 GTAGAGACAGGGTTTCTCCGTGG + Intronic
1002788231 6:419826-419848 ATGGAGACAGGGTTTCAATTTGG - Intergenic
1002850974 6:996054-996076 ATAGGGACGGGGTTTCTTTTAGG + Intergenic
1003434111 6:6069670-6069692 ATAGAGATGGGGTTTCTCCTTGG + Intergenic
1005241997 6:23840780-23840802 ATAGAGGCAGGGTCTCCATGTGG + Intergenic
1005328290 6:24722882-24722904 ATAGGTACAGGGTTTCTTTTTGG - Intergenic
1005766171 6:29014522-29014544 ATGTAGGCAGGGTTTAGCTTTGG - Intergenic
1007416646 6:41694908-41694930 GGAGAGGCAGGGATTCTCTGGGG - Intronic
1007572719 6:42904789-42904811 ATAGAGACGGGGTTTCACATTGG - Intergenic
1007671179 6:43555123-43555145 GTAGAGACAGGGTTTCTCCAAGG + Intronic
1008442723 6:51551097-51551119 CTAGATGCATAGTTTCTCTTTGG + Intergenic
1008980285 6:57475325-57475347 ATAGTTACAGGGTTTCTTTTGGG - Intronic
1009168391 6:60368268-60368290 ATAGTTACAGGGTTTCTTTTGGG - Intergenic
1009351106 6:62680080-62680102 GTAGAGACAGGGTTTCACTGTGG - Intergenic
1009652650 6:66495728-66495750 TTACAGGCAGTGTTTCTTTTTGG + Intergenic
1009714015 6:67363896-67363918 ATAGAGACAGGGTTTCACTATGG + Intergenic
1009989111 6:70818989-70819011 ATAGCTGTAGGGTTTCTTTTGGG - Intronic
1010587592 6:77672721-77672743 GTAGAGACAGGGTTTCACCTTGG + Intergenic
1011265754 6:85516819-85516841 GTAGAGGCAGGGTTTCACCAAGG + Intronic
1011412378 6:87079253-87079275 AGTGAGGGAGGGCTTCTCTTTGG + Intergenic
1011674034 6:89713849-89713871 GTAGAGACAGGGTTTCACTGTGG - Intronic
1011751342 6:90458243-90458265 ATAGAGGCAGTGACTCTGTTGGG - Intergenic
1012455317 6:99396799-99396821 ATAGAGACAGGGTTTCATGTTGG - Intergenic
1013181522 6:107720720-107720742 AGAGAGGTCGTGTTTCTCTTGGG + Exonic
1013413529 6:109903928-109903950 ATAGAGCCAGGATTTTTCTTAGG - Intergenic
1014745957 6:125201023-125201045 TTATAGGCAGCGTTTCTTTTTGG + Intronic
1016059991 6:139620206-139620228 ATAGAGACAGGGTTTCACCATGG - Intergenic
1016152554 6:140760681-140760703 GTAGAGACAGGGTTTCACTGTGG + Intergenic
1016882204 6:148922210-148922232 ATAGGTACAGGGTTTCTTTTTGG - Intronic
1016954278 6:149611276-149611298 GTAGAGACAGGGTTTCGCTGTGG - Intronic
1017108912 6:150913942-150913964 GTAGAGGCAGGGTTTCACCACGG - Intronic
1020091036 7:5341224-5341246 GTAGAGACAGGGTTTCACTGTGG - Intronic
1021470340 7:20995569-20995591 ATAGGGACAGAGTTTATCTTGGG - Intergenic
1022177969 7:27890323-27890345 ATTCAGCCAGGGTTTCTCTAAGG - Intronic
1022966180 7:35474628-35474650 TTAGATGCAGGATTTCTTTTTGG - Intergenic
1023036404 7:36135223-36135245 ATAGGTGCAGAGTTTCTATTTGG + Intergenic
1023304688 7:38813393-38813415 ATAGGTGCAAGGTTTCTTTTTGG + Intronic
1023761636 7:43469801-43469823 AAAGAGGGAGGGATTCTCTCTGG - Intronic
1025091075 7:56064685-56064707 GTAGAGACAGGGTTTCACGTTGG - Intronic
1025202958 7:56973317-56973339 ATTGAAGCAGGGTCTCTCTGTGG + Intergenic
1025668986 7:63603609-63603631 ATTGAAGCAGGGTCTCTCTGTGG - Intergenic
1026432511 7:70361146-70361168 GTAGAGACAGGGTTTCACTGTGG - Intronic
1026817618 7:73524244-73524266 GTAGAGACAGGGTTTCTCCATGG - Intergenic
1027156041 7:75768765-75768787 GTAGAGACAGGGTTTCACTGTGG + Intergenic
1027629048 7:80579590-80579612 CTAGAGGAAGGTTTTCTTTTGGG + Intronic
1028096374 7:86765916-86765938 ATGGAGGCTGGGTTTCACTGGGG + Intronic
1028397654 7:90389815-90389837 TTAGAGACAGGGTCTCTCTGTGG + Exonic
1028934906 7:96454007-96454029 ATAGAGGAAGGGCTTATTTTTGG + Intergenic
1029028324 7:97441992-97442014 ATAGAAACAGAGTTTCTATTTGG + Intergenic
1029613235 7:101639033-101639055 ATAGAGACAGGGTTTCACCATGG + Intergenic
1030048111 7:105515221-105515243 TTATAGGCAGTGTTTCTTTTTGG - Intronic
1032229486 7:130061894-130061916 ATAGGTACAGGGTTTCTCTTAGG - Intergenic
1032450029 7:132022642-132022664 GTAGAGGCAGGGTCTTGCTTTGG + Intergenic
1032696370 7:134340064-134340086 GTAGAGACAGGGTTTCTCCATGG + Intergenic
1033545205 7:142393263-142393285 GTAGAGGTGGGGTTTCTCTTTGG + Intergenic
1035493010 7:159296186-159296208 AGAAAGGCTGGGTTTCTCTCTGG + Intergenic
1036065620 8:5378609-5378631 ATAGAGGCAGAGTTTCACCATGG - Intergenic
1036784096 8:11674134-11674156 ATAGGTGCAGGGTTTCTGTTTGG + Intergenic
1036885361 8:12548158-12548180 ATGGATACAGGGTTTCTTTTTGG - Intergenic
1037437249 8:18875860-18875882 ATGGATACAGGGTTTCTTTTTGG - Intronic
1037437276 8:18876108-18876130 AGAGAGACAGGGTCTCTCTATGG + Intronic
1037847779 8:22299389-22299411 GTAGAGACAGGGTTTCTCCATGG + Intronic
1038121358 8:24619875-24619897 GTAGAGACAGGGTTTCTCCATGG - Intergenic
1038694065 8:29789929-29789951 ATAGGTGCAGAGTTTCTGTTTGG + Intergenic
1038968272 8:32601412-32601434 AAAGAGTTAGGTTTTCTCTTTGG - Intronic
1039609177 8:38905438-38905460 TTAGAGGCAGGGTCTCGCTCTGG - Intronic
1039945682 8:42127385-42127407 ATAGGTACAGGGTTTCTTTTGGG - Intergenic
1039951592 8:42177138-42177160 GTAGAGGCAGGGTTTCACCATGG + Intronic
1040041826 8:42923686-42923708 ATGGAGATAGGGTTTCTTTTTGG + Intronic
1040077412 8:43251116-43251138 GTAGAGTCAGGGTTTCTCTGTGG + Intergenic
1040279756 8:46033652-46033674 ATAGAGGCAGGGTTTCACTGTGG - Intergenic
1041058942 8:54017173-54017195 ATAGGTACAGGGTTTCTTTTTGG + Intronic
1041643431 8:60227104-60227126 GTAGAGACAGGGTTTCACTGTGG - Intronic
1041929244 8:63269033-63269055 ATGGATACAGGGTTTCTCTTTGG - Intergenic
1042114109 8:65413023-65413045 TTTGAGACAGGGTTTCACTTAGG + Intergenic
1042245321 8:66703985-66704007 ATAGACGCAGGGTTTCACTATGG - Intronic
1042457123 8:69018899-69018921 GTAGAGACAGGGTTTCCCTATGG + Intergenic
1043447079 8:80329692-80329714 GTAGAGACAGGGTTTCTCCATGG + Intergenic
1043841907 8:85116210-85116232 ACAGTGGCAGTGGTTCTCTTGGG + Intronic
1044679160 8:94759687-94759709 GTAGAGACAGGGTTTCTCCATGG + Intronic
1045578251 8:103449135-103449157 ACAGAGGGAGGGTTTCTGTGTGG - Intergenic
1045581018 8:103480526-103480548 TTTGAGACAGGGTCTCTCTTTGG + Intergenic
1046035647 8:108837778-108837800 GTAGAGACAGGGTTTCTCCATGG + Intergenic
1046962722 8:120127051-120127073 ATAGGTACAGGGTTTCTTTTTGG - Intronic
1047333137 8:123910602-123910624 ATAGAGGCAATGTTTCAGTTAGG - Intronic
1047378244 8:124325967-124325989 AGAGATGCAGGTTTTCTTTTTGG - Intronic
1047719073 8:127621811-127621833 CTGGATGCAGGGTTTCTGTTTGG + Intergenic
1047910068 8:129518286-129518308 GTAGAGGGAAGGGTTCTCTTTGG - Intergenic
1048114387 8:131505355-131505377 ATAGGGGAAGGGGTTCTTTTGGG + Intergenic
1048521722 8:135161658-135161680 ATAAAGGGATGGTTTCACTTTGG + Intergenic
1048560382 8:135529861-135529883 GTAGAGACAGGGTTTCACTGTGG - Intronic
1048897933 8:139010969-139010991 ATGGGTGCAGGGTTTCTTTTGGG + Intergenic
1049146494 8:141004614-141004636 GTAGAGACAGGGTTTCACTGTGG - Intergenic
1049167312 8:141134478-141134500 GTAGAGACAGGGTTTCACTGTGG + Intronic
1049793047 8:144481457-144481479 GTAGAGACAGGGTTTCTCCATGG - Intronic
1049841064 8:144772338-144772360 ATAGGTACAGGGTTTCTGTTTGG + Intergenic
1050845670 9:10214657-10214679 ATAGAGGCAGGCCTTGTGTTAGG - Intronic
1051269605 9:15342674-15342696 ATAGAGACAGGGTCTCACTATGG - Intergenic
1052874346 9:33542556-33542578 GTAGAGTCAGGGTTTCACTATGG + Intronic
1052936815 9:34100045-34100067 TTAGAGACAGGGTCTCACTTTGG + Intronic
1053235734 9:36452317-36452339 ATGGATACAGGGTTTCTTTTTGG - Intronic
1053501687 9:38601805-38601827 ATAGAGTCAGGGTTTCACTATGG - Intergenic
1055740876 9:79387692-79387714 ATGGCTGCAGTGTTTCTCTTTGG + Intergenic
1055904888 9:81281729-81281751 ACAGAGCCAGTGTTTTTCTTTGG - Intergenic
1056079444 9:83075982-83076004 GTAGAGGCGGGGTTTCACTGTGG - Intergenic
1056362867 9:85876256-85876278 GTAGAGACAGGGTTTCACTGTGG + Intergenic
1056546574 9:87618783-87618805 ATGGACACAGGGCTTCTCTTGGG + Intronic
1057147259 9:92766458-92766480 ATTGATGCTGGGTTTTTCTTTGG + Intergenic
1057392474 9:94651272-94651294 TCAGAGGCAGGGTTTGGCTTAGG - Intergenic
1057759493 9:97860932-97860954 ATGGAGGCAGGAGTACTCTTGGG - Intergenic
1057864274 9:98666909-98666931 AGAGGGGCAGGGCTGCTCTTAGG + Intronic
1058427724 9:104889974-104889996 ACTGAGGCAGGGTTTTCCTTTGG - Intronic
1058919201 9:109597223-109597245 AGAGAGGCAGGGTTGTTCTGTGG + Intergenic
1059194240 9:112355802-112355824 GTAGAGACAGGGTTTCGCGTTGG + Intergenic
1059303294 9:113333121-113333143 AAAGAGGCAGAGTTTCCTTTTGG + Intronic
1059309862 9:113380886-113380908 ACAGTGACAGGGTATCTCTTTGG + Intergenic
1059711448 9:116871429-116871451 ATAGAGGCAGGGTTTCTCTTTGG - Intronic
1059996634 9:119916687-119916709 ATGGATACAGGGTTTCTTTTTGG - Intergenic
1060090324 9:120737098-120737120 ACAGATACAGGGTTTCTTTTTGG - Intergenic
1060617478 9:125031444-125031466 GTAGAGACAGGGTTTCACTGTGG + Intronic
1061103506 9:128511019-128511041 GTAGAGACAGGGTTTCACTGTGG - Intronic
1061932337 9:133839632-133839654 GTAGAGACAGGGTTTCACTATGG + Intronic
1062540291 9:137039036-137039058 ATTGAGTCTGGGTTTCTCATGGG - Intergenic
1203653581 Un_KI270752v1:2165-2187 TTCGAGACAGGGTTTCTCTGTGG + Intergenic
1203654109 Un_KI270752v1:7232-7254 TTTGAGACAGGGTTTCTCTGTGG + Intergenic
1185864681 X:3612965-3612987 GTAGAGACAGGGTTTCTCCATGG - Intronic
1186009229 X:5110131-5110153 ATAGCTGCAGCGTTTCTCTTTGG + Intergenic
1186027486 X:5328625-5328647 ATACAGCCAGGCTTTCTCTGAGG - Intergenic
1186063883 X:5740522-5740544 ATGGGGACAGGGTTTCTGTTTGG + Intergenic
1186785347 X:12951807-12951829 ATACAGCCAGGCTTTCTCTGAGG + Intergenic
1187112867 X:16319523-16319545 ATGCAGGCAGGCTTTCTCTGAGG + Intergenic
1187362271 X:18640027-18640049 ATGGGTGCAGGATTTCTCTTTGG + Exonic
1187837316 X:23446108-23446130 ATAGCAGAACGGTTTCTCTTAGG - Intergenic
1187949065 X:24454225-24454247 ATAGAGACAGGGTTTCATGTTGG + Intergenic
1187980760 X:24754438-24754460 ATAGAGACGGGGTTTCTCCGTGG + Intronic
1188221241 X:27544007-27544029 ATACAGCCAGGTTTTCTCTATGG + Intergenic
1189376183 X:40467833-40467855 GTAGAGACAGGGTTTCGCTTTGG + Intergenic
1189619566 X:42821345-42821367 AAACAGGCAGGCTTTCTCTGAGG + Intergenic
1189929087 X:45988911-45988933 CTAGCAGCAGGGTTTCTCATTGG - Intergenic
1190315900 X:49150770-49150792 ATAGAGACGGGGTTTCACTGTGG + Intergenic
1191773997 X:64792891-64792913 CTAAAGTCAGGGTTTCTTTTGGG + Intergenic
1193100690 X:77608182-77608204 GTAGAGGCGGGGTTTCACTGTGG - Intronic
1194650082 X:96504070-96504092 GTAGAGACAGGGTTTCACCTTGG + Intergenic
1195070273 X:101272660-101272682 ATGGATACAGGGTTTCTTTTTGG + Intronic
1195110581 X:101645008-101645030 ATAGGTGCAGGGTTTCTGTTTGG - Intergenic
1195282468 X:103349099-103349121 GAAGAGGCAGCGTTTTTCTTGGG + Intergenic
1195806651 X:108779590-108779612 ATAGGTACAGGGTTTCTTTTTGG - Intergenic
1196222226 X:113124924-113124946 ATACAGCCAGGCTTTCTCTGAGG - Intergenic
1196366235 X:114927431-114927453 ATGCAGCCAGGGTTTCTCTGAGG - Intergenic
1196490872 X:116264695-116264717 TTAGAGGAATGGTTTCTTTTGGG + Intergenic
1196602284 X:117616255-117616277 AGAGAGGCAGAGGCTCTCTTTGG + Intergenic
1197630337 X:128850979-128851001 AAAGAGGCAGTTTTTCTCATAGG - Intergenic
1197963793 X:132034489-132034511 GTAGAGACAGGGTTTCACTGTGG + Intergenic
1199714226 X:150494865-150494887 ATTGAGGCAGGGTATCACTCTGG - Intronic
1200287883 X:154841229-154841251 TTTGAGACAGGGTTTCTCTCTGG + Intronic
1200644414 Y:5763428-5763450 GTAGAGGCAGAGTTTCTCCATGG + Intergenic
1201332322 Y:12837817-12837839 TTAGAGACAGGGTTTTTCTCAGG - Intronic
1201335201 Y:12873113-12873135 GTAGAGGCGGGGTTTCACTGTGG - Intergenic
1201416639 Y:13753774-13753796 AGAAAGGCATGATTTCTCTTCGG + Intergenic
1201418304 Y:13770628-13770650 ATAGATATAGGGTTTCTTTTAGG + Intergenic
1201969217 Y:19773307-19773329 GTAGAGACAGGGTTTCACCTGGG + Intergenic
1202047601 Y:20750194-20750216 ATAGGTACAGGGTTTCTTTTTGG + Intergenic