ID: 1059711449

View in Genome Browser
Species Human (GRCh38)
Location 9:116871440-116871462
Sequence AGGGACTTATGATAGAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059711449_1059711456 8 Left 1059711449 9:116871440-116871462 CCCTGCCTCTATCATAAGTCCCT 0: 1
1: 0
2: 1
3: 8
4: 149
Right 1059711456 9:116871471-116871493 CCTCCCAATGACCCTTGTGTTGG No data
1059711449_1059711457 9 Left 1059711449 9:116871440-116871462 CCCTGCCTCTATCATAAGTCCCT 0: 1
1: 0
2: 1
3: 8
4: 149
Right 1059711457 9:116871472-116871494 CTCCCAATGACCCTTGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059711449 Original CRISPR AGGGACTTATGATAGAGGCA GGG (reversed) Intronic
901606399 1:10462572-10462594 AGGTACTTATGACAGGGACAAGG + Intronic
901700428 1:11042340-11042362 ATGGACTGATGATAGAAGAATGG + Intronic
904238381 1:29128383-29128405 AAGGGCTCATGACAGAGGCAGGG - Intergenic
905544978 1:38790470-38790492 AGGAACATTTGGTAGAGGCAGGG + Intergenic
905754726 1:40499363-40499385 GAGGACTGATGATTGAGGCAAGG + Intergenic
906332446 1:44898029-44898051 AGGAATTTATAATAGAGGCCAGG - Intronic
909511860 1:76462313-76462335 AGGGACTTATGAAAATGGCTGGG - Intronic
910000153 1:82331521-82331543 ATAGATTTATGATAGAGACATGG - Intergenic
917844722 1:179011117-179011139 AGGGACTTGTGAAAAAGGCCAGG + Intergenic
919264731 1:195248308-195248330 ATGGACTTATGTTAGTGTCAAGG + Intergenic
922234916 1:223715424-223715446 AGGGATTAAAGATAAAGGCAGGG + Intronic
922534134 1:226367524-226367546 AGGGTCTGATGATAGCAGCAAGG - Exonic
922542566 1:226430078-226430100 ACGGCCTCATGATAGAGGCCTGG + Intergenic
1062953097 10:1519970-1519992 AGGGACTCATTCTAGAGGAAAGG - Intronic
1063720333 10:8574121-8574143 AGGGAAATATGAAAGAGGAAGGG + Intergenic
1064893969 10:20212360-20212382 AGGGAAACATGATAGAGACAAGG + Intronic
1069393238 10:67960063-67960085 TGTGACTTATGATAGGGGCTTGG + Intronic
1071846986 10:89530802-89530824 AGTGACTGATGATGGATGCAAGG - Intronic
1078605445 11:12771121-12771143 AGGAACATGTGATAAAGGCATGG + Intronic
1079820817 11:25125334-25125356 TGGGACTTATGATCCAGGAAGGG - Intergenic
1079834776 11:25320866-25320888 AGGGAATTATGATATATTCAAGG + Intergenic
1080834105 11:35923944-35923966 AGGGACTTAAGATGGAGATAGGG + Intergenic
1080861604 11:36154860-36154882 AGGGACTTGTGGTAGAGGCCAGG - Intronic
1082054109 11:47798821-47798843 AGGCACTGAGGATAGAGACAGGG - Intronic
1084664331 11:70568365-70568387 AGGGAGCTGTGAGAGAGGCAAGG - Intronic
1088802357 11:113317677-113317699 AGGGAGATATGAGAGAGGTAAGG - Intronic
1092037956 12:5357003-5357025 TGGGATTTCTGAGAGAGGCAGGG - Intergenic
1095980656 12:47972709-47972731 AGGGAGGTATGCTAGAGGGAGGG - Intergenic
1096916726 12:55040947-55040969 AGTGATTTAAGATAGAGGGATGG + Intergenic
1102164708 12:110797061-110797083 AGGGACTTAAGGTGAAGGCAGGG + Intergenic
1104530455 12:129565314-129565336 AGGGACTTGAGATAGAGGCAGGG + Intronic
1105716093 13:23066285-23066307 AGGGACTGAGGGTAGAAGCAAGG + Intergenic
1108337626 13:49462257-49462279 AGGCACTTCTGACAAAGGCATGG - Intronic
1108550817 13:51542127-51542149 AGGGACTGAGGAGAGAGGGAAGG + Intergenic
1109256368 13:60088401-60088423 AGGGAGTAAGGATAGAGGGAAGG - Intronic
1113617849 13:111693828-111693850 AGGGAATTTAGAGAGAGGCAGGG - Intergenic
1113623382 13:111779089-111779111 AGGGAATTTAGAGAGAGGCAGGG - Intergenic
1114225571 14:20735068-20735090 AGGGGCTATTGATGGAGGCAGGG - Intronic
1114227026 14:20748083-20748105 AGGGGCTATTGATGGAGGCAGGG - Exonic
1115259046 14:31434556-31434578 AGGGACTTATGAAGGAGATAGGG - Intronic
1115323439 14:32110683-32110705 AGGGAATGATGGTAGAAGCAGGG + Intronic
1117424915 14:55584046-55584068 AGGGAGTTAGGGCAGAGGCAGGG - Intronic
1119282037 14:73417440-73417462 TGGGACTTGTGATAGCGGTATGG - Intronic
1119599564 14:75966255-75966277 AGGAACCAATGCTAGAGGCAAGG + Intronic
1120610816 14:86639057-86639079 GGGGACTTTTGAAAGAAGCATGG + Intergenic
1120982212 14:90300140-90300162 AGGGTCTTAGGAAAGGGGCAGGG + Intronic
1124094887 15:26640134-26640156 AGGGAGTTATGACAGAGGTATGG + Intronic
1125399983 15:39291755-39291777 AAGGACTTAGAACAGAGGCATGG - Intergenic
1126531163 15:49712648-49712670 AGGACCTTATGATAGTTGCAGGG + Intergenic
1131249794 15:90822757-90822779 AGGGACTCATGACAAAGCCAGGG + Intergenic
1131980723 15:97992081-97992103 AGGGTCTTGTGACTGAGGCAGGG + Intergenic
1132298452 15:100761759-100761781 AGGGTCTCATGATCCAGGCAGGG + Intergenic
1134740227 16:16536423-16536445 TGGGATTTATGCAAGAGGCAGGG + Intergenic
1134927274 16:18175738-18175760 TGGGATTTATGCAAGAGGCAGGG - Intergenic
1139648940 16:68352076-68352098 AGGGACTGATGAGGGAGGGAGGG + Intronic
1143518217 17:7430446-7430468 TAGGAGTTATGATAGGGGCAGGG - Intergenic
1143813510 17:9491877-9491899 GGCGACTTATGATAGAGGAAAGG + Exonic
1149245381 17:54699635-54699657 TGGAAGTTATGATAGAGTCATGG + Intergenic
1149310859 17:55391659-55391681 AGGGAGTTGTGAGAAAGGCAGGG + Intergenic
1149778123 17:59374311-59374333 AGAGCCTTATGAAAGAGACATGG - Intronic
1150260168 17:63782748-63782770 AGATACTCATGGTAGAGGCAAGG - Intronic
1151699368 17:75734808-75734830 AGGGAGGTATGAGAGAGGAAGGG + Intronic
1153449423 18:5210164-5210186 AGGAACTTATGATATTGCCAAGG - Intergenic
1153595868 18:6724815-6724837 AGGGACTATTTATAAAGGCATGG + Intergenic
1155345963 18:24857035-24857057 AGGAACTTCTGATATAGACATGG + Intergenic
1157054929 18:44216241-44216263 TGACACTTATGCTAGAGGCAGGG + Intergenic
1159420403 18:68211482-68211504 AGGAACTAATCATAGAGGAATGG + Intergenic
1160121058 18:76130810-76130832 AGGGACCTGTGAGAGAGGCGGGG + Intergenic
1164725854 19:30465171-30465193 AGGGAATGAGAATAGAGGCAAGG - Intronic
1164912793 19:32026244-32026266 AGGGACTGATGCAAGGGGCAAGG - Intergenic
1164956828 19:32393335-32393357 AGGGACTTAAGGCAGAAGCAGGG + Intergenic
927788443 2:25990895-25990917 AGGTATTTTTGGTAGAGGCAGGG - Intergenic
928285479 2:29986570-29986592 AGGGACTTATTACAAAGGCATGG + Intergenic
931262675 2:60633849-60633871 AGGGCCTGGTGATAGAGCCACGG + Intergenic
932429442 2:71665350-71665372 AGGGTCTGATGAGAGAGGGAGGG - Intronic
935712411 2:105910908-105910930 TGGGTCTAATGATAGAGGCAGGG + Intergenic
937991330 2:127664065-127664087 AGGGACCTATGTTAGAGACGAGG - Intronic
945471169 2:210229234-210229256 ATGGGCATAAGATAGAGGCAGGG + Intergenic
948977831 2:241474478-241474500 AGGGAGTCATGATAGAAACAAGG + Intronic
1168772510 20:424439-424461 AGGGGCATAGGAGAGAGGCAGGG - Intronic
1169275540 20:4231475-4231497 AGGCACTTGTGCTAGAGGCTGGG - Intronic
1170277023 20:14602469-14602491 AGTGGCTACTGATAGAGGCAAGG - Intronic
1172343129 20:34175109-34175131 GGGGAATTATATTAGAGGCAGGG - Intergenic
1173506609 20:43591969-43591991 AGGGATTTATTATATAGGCGAGG + Intronic
1173908101 20:46643337-46643359 AGGGTCTAAAGATAGGGGCAGGG + Intronic
1175194837 20:57235911-57235933 AGGGAGTGAGGACAGAGGCAGGG + Intronic
1175194841 20:57235930-57235952 AGGGAGTGAGGACAGAGGCAGGG + Intronic
1175194845 20:57235949-57235971 AGGGAGTGAGGACAGAGGCAGGG + Intronic
1179991645 21:44951305-44951327 AGGGAGGTAGGAGAGAGGCAGGG + Intronic
1182809215 22:33102065-33102087 ATGGGCATATGAGAGAGGCAGGG - Intergenic
1182894881 22:33850835-33850857 AGGGGCATAAGAGAGAGGCAGGG - Intronic
1184099629 22:42335284-42335306 AGGGGGTGCTGATAGAGGCAGGG - Intronic
949146336 3:704997-705019 AAGGAAAAATGATAGAGGCAAGG + Intergenic
952858963 3:37796258-37796280 AGATCCTCATGATAGAGGCATGG - Intronic
953531252 3:43741514-43741536 AGGAACTAAGGAGAGAGGCATGG + Intergenic
953749272 3:45596728-45596750 AGGGACCAGTGATTGAGGCAGGG + Intronic
953944624 3:47135831-47135853 AGAGACTGATGATAGAGGAGAGG - Intronic
958414546 3:93858366-93858388 AAGGAATTCTGAGAGAGGCAGGG + Intergenic
959213257 3:103416412-103416434 AGGGACTAATAATATAGGTATGG - Intergenic
959590586 3:108075628-108075650 AGGGAATTATAAAAGATGCATGG - Intronic
960453786 3:117844112-117844134 AGGGACTTCTGTTACAGACATGG + Intergenic
960513454 3:118577453-118577475 AGGGACTTGTGAGAGAGGGAGGG + Intergenic
964039234 3:152238545-152238567 AGGGAGTTATGATAGGGACTGGG - Intergenic
964513156 3:157476067-157476089 AGTGACTGATGACAGAGGCTTGG - Intronic
967451337 3:189626791-189626813 AGGGACTTAAGAAATAGGAATGG - Intergenic
967834205 3:193947207-193947229 AGGGAATTTTGAAAGAGGGATGG - Intergenic
971181336 4:24330945-24330967 AGGGGATCATGATAGAGGTAGGG - Intergenic
975697401 4:77027047-77027069 AGGTACTATTGATAGTGGCAAGG + Intronic
978424862 4:108571676-108571698 AGGGACTTAAGGCAGTGGCATGG - Intergenic
981756764 4:148148212-148148234 AGGCACTTATGGCAGAGGCTTGG + Intronic
982663340 4:158231114-158231136 AGGGTCTTATGATCTAGACAAGG + Intronic
986066945 5:4243685-4243707 AGTGATTTATGATAGAGGGCAGG + Intergenic
988815267 5:34828251-34828273 AGGTGGTAATGATAGAGGCAGGG + Intronic
989668326 5:43883098-43883120 AGGGAATTTTGATAAAGGAAAGG + Intergenic
996152176 5:120052744-120052766 GGGGACTTGTGATAGAGCCCAGG + Intergenic
998068315 5:139176820-139176842 AGGGAATAATGATAGTGCCATGG - Intronic
998136186 5:139675950-139675972 AGAGCCTTAGGGTAGAGGCACGG + Intronic
999089419 5:148922375-148922397 ATGGTTTTTTGATAGAGGCATGG - Intergenic
1000155690 5:158549443-158549465 AGGGACTTGTTGCAGAGGCATGG + Intergenic
1001318195 5:170659350-170659372 AGGGACTAATGACAAAGGCATGG + Intronic
1001501624 5:172240911-172240933 ATGTATTTATGATAGAGACAGGG - Intronic
1001895776 5:175379008-175379030 AGGTATTTATGATACAGACATGG - Intergenic
1003966258 6:11255452-11255474 AGGGCCTTGTGAGAGAGGTAAGG + Intronic
1013489963 6:110636625-110636647 GAGGACTTTTGATAGAGGGATGG + Intronic
1015634414 6:135261808-135261830 AGTGAGTTATGATAGGGACATGG - Intergenic
1022249261 7:28591141-28591163 AGGGACACAAGATAGAGACATGG - Intronic
1022636459 7:32140810-32140832 TGGGATGTATAATAGAGGCAGGG + Intronic
1028854303 7:95573263-95573285 AGGGACTCAGAATGGAGGCATGG - Intergenic
1030048679 7:105520014-105520036 CGTGTCTTTTGATAGAGGCAGGG - Intronic
1032195734 7:129787258-129787280 AGGGACTTATGCTAAATGCTGGG - Intergenic
1034724223 7:153320305-153320327 AGGGACTAATTACAAAGGCACGG - Intergenic
1037614893 8:20510125-20510147 AGGGACTTCTTATGGAGGAAGGG + Intergenic
1037744205 8:21630232-21630254 AGAGCCTTGTGATAGAGGCATGG - Intergenic
1039476745 8:37842791-37842813 AGGGACCTAGGATCTAGGCAGGG - Exonic
1039897575 8:41727068-41727090 AGGGACTAATGACAAAGTCATGG - Intronic
1040469322 8:47724199-47724221 ACAGACTTATCACAGAGGCAGGG + Intronic
1042713910 8:71750856-71750878 TGGGACTTCTGTTAGAAGCATGG + Intergenic
1044756682 8:95470004-95470026 AGGGCTTTTTGATAGAGGTATGG + Intergenic
1045349517 8:101325347-101325369 AGTGACATAAGATAGATGCAGGG - Intergenic
1045524648 8:102931257-102931279 AGTGCCTTATGAGACAGGCAGGG + Intronic
1052164106 9:25300853-25300875 AAGGAGTTCTGAAAGAGGCATGG + Intergenic
1052842934 9:33308858-33308880 AGGGCCTTGTGATCAAGGCATGG + Intronic
1053130939 9:35615348-35615370 AGGGACACATAAAAGAGGCAAGG - Intronic
1054713852 9:68537994-68538016 AGGGTGTTAGGATAGAGACATGG - Intronic
1057886746 9:98835306-98835328 GGGGTCTTATGATACAGGAATGG + Exonic
1059711449 9:116871440-116871462 AGGGACTTATGATAGAGGCAGGG - Intronic
1061588720 9:131584474-131584496 AGGGACTGATGATGGGGGCCTGG + Intronic
1186167103 X:6838413-6838435 AGAGACTTAGGCTAGAGTCAAGG + Intergenic
1186864744 X:13708418-13708440 AGGGGCTTATCATAGAGTAACGG + Intronic
1187349141 X:18495850-18495872 AGAGTCTTATGATAGAGTTATGG - Intronic
1188237797 X:27751036-27751058 AGGGACTTATAATAGGGTCCAGG - Intergenic
1188257105 X:27976557-27976579 AGGGACTTATAATAGGGTCTAGG + Intergenic
1189166465 X:38865856-38865878 CTGGACTAATGAAAGAGGCAGGG - Intergenic
1190526082 X:51331220-51331242 AGGGACCTATTGCAGAGGCACGG + Intergenic
1190543388 X:51500450-51500472 AGGGACCTATTGCAGAGGCACGG - Intergenic
1192196098 X:69029289-69029311 AAGGACTTATGATAGACTCCAGG - Intergenic
1195805123 X:108757031-108757053 AGGGACTTATAAAAGTGGGAAGG + Intergenic
1197507248 X:127321130-127321152 AGGGACTTAAAAGAGGGGCAGGG - Intergenic
1199640211 X:149853134-149853156 AGGGATTTCTTAAAGAGGCAAGG - Intergenic