ID: 1059711450

View in Genome Browser
Species Human (GRCh38)
Location 9:116871441-116871463
Sequence CAGGGACTTATGATAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059711450_1059711457 8 Left 1059711450 9:116871441-116871463 CCTGCCTCTATCATAAGTCCCTG 0: 1
1: 0
2: 1
3: 15
4: 126
Right 1059711457 9:116871472-116871494 CTCCCAATGACCCTTGTGTTGGG No data
1059711450_1059711456 7 Left 1059711450 9:116871441-116871463 CCTGCCTCTATCATAAGTCCCTG 0: 1
1: 0
2: 1
3: 15
4: 126
Right 1059711456 9:116871471-116871493 CCTCCCAATGACCCTTGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059711450 Original CRISPR CAGGGACTTATGATAGAGGC AGG (reversed) Intronic
900990896 1:6097832-6097854 CAGGGACTTCTGAGTGAGACGGG + Intronic
903891549 1:26573418-26573440 CAGGGACTTGTGGAAGAGCCAGG + Intronic
905471156 1:38193086-38193108 CAGGTAATTATGATAAAGGATGG + Intergenic
908318041 1:62953789-62953811 CAGGGGCTTCTCACAGAGGCGGG - Intergenic
909292299 1:73899244-73899266 CAGAGACTTAAGAGAGAGGCAGG - Intergenic
909511861 1:76462314-76462336 CAGGGACTTATGAAAATGGCTGG - Intronic
911608533 1:99935739-99935761 AATGCCCTTATGATAGAGGCAGG + Intergenic
918302018 1:183213503-183213525 CAGATACTTAAGATATAGGCTGG + Intronic
920259059 1:204676687-204676709 CTGGGACATATGATAGAAGTGGG - Intronic
920563124 1:206953284-206953306 CAGTGGCTTATGAGAGGGGCTGG - Intergenic
1064605994 10:17039398-17039420 CAGGCACTTATTATACAGGTGGG - Intronic
1066117993 10:32257144-32257166 CAGGGACTTCTGCTGGAGGGGGG + Intergenic
1066307631 10:34162034-34162056 TATGTACATATGATAGAGGCAGG + Intronic
1066596485 10:37056323-37056345 CAAGGAACTATTATAGAGGCTGG - Intergenic
1074010925 10:109478760-109478782 AAGAGATTTATGATTGAGGCAGG - Intergenic
1081056531 11:38416225-38416247 CAGAGACTTAAGACAGAAGCAGG + Intergenic
1082832114 11:57626300-57626322 CAGTGATCTATGATTGAGGCAGG - Intergenic
1084972674 11:72780421-72780443 CAGGGACTCAGGATTGTGGCTGG - Intronic
1087614231 11:100470029-100470051 CAGAGAGTTAGGATAGAGGAAGG - Intergenic
1088815856 11:113420265-113420287 CAGGAGCCTAGGATAGAGGCTGG - Intronic
1091107184 11:132933898-132933920 CAGGGGTTTATTAGAGAGGCTGG - Intronic
1092037957 12:5357004-5357026 CTGGGATTTCTGAGAGAGGCAGG - Intergenic
1093442446 12:19214604-19214626 CAGCGACATATGATGGAGGGTGG + Intronic
1096102867 12:48979997-48980019 CAGGCGCTTTTGAGAGAGGCTGG - Intronic
1097225193 12:57472961-57472983 CAGTGACTTCTGAGAGAGGATGG - Intronic
1101039982 12:100745957-100745979 CAAGTAGTAATGATAGAGGCTGG + Intronic
1102164707 12:110797060-110797082 CAGGGACTTAAGGTGAAGGCAGG + Intergenic
1103116459 12:118337742-118337764 CAGGGATTTTGGATAGAGGGTGG + Intronic
1104530454 12:129565313-129565335 CAGGGACTTGAGATAGAGGCAGG + Intronic
1107690998 13:42952854-42952876 GAGCTGCTTATGATAGAGGCAGG + Intronic
1112385725 13:98938026-98938048 CAGTGAGTGATGATAGAAGCAGG - Intronic
1113433723 13:110272547-110272569 AGGGGACTTATGATGGAGGATGG - Intronic
1114225572 14:20735069-20735091 CAGGGGCTATTGATGGAGGCAGG - Intronic
1114227027 14:20748084-20748106 CAGGGGCTATTGATGGAGGCAGG - Exonic
1117424916 14:55584047-55584069 CAGGGAGTTAGGGCAGAGGCAGG - Intronic
1117620472 14:57581161-57581183 CAAGGAGTTATGAAAAAGGCAGG + Intronic
1122595475 14:102887374-102887396 CAGGGACTCAGGGTAGAGGAGGG + Intronic
1202923971 14_KI270724v1_random:7551-7573 CAGGGACTAAGGAGAGAGGGTGG - Intergenic
1123808866 15:23903326-23903348 CAGGGACTTAGGAGAGAGAAAGG - Intergenic
1126531162 15:49712647-49712669 CAGGACCTTATGATAGTTGCAGG + Intergenic
1128084569 15:64877058-64877080 AAGAGGCTTAAGATAGAGGCGGG + Intronic
1132298451 15:100761758-100761780 CAGGGTCTCATGATCCAGGCAGG + Intergenic
1133519292 16:6541740-6541762 CAGGAGCTAATGATAGAGGAAGG + Intronic
1143018240 17:3903280-3903302 CAGGGTCTTGTGAAAGAGGCAGG + Exonic
1147034840 17:37672184-37672206 CAGGGGCTTATGCTGGAGTCGGG + Intergenic
1147460478 17:40565103-40565125 CAGGGACATAAGAGAGTGGCGGG - Intronic
1148175434 17:45560128-45560150 CTGTGACTCATGATACAGGCTGG - Intergenic
1149310858 17:55391658-55391680 CAGGGAGTTGTGAGAAAGGCAGG + Intergenic
1149351891 17:55797720-55797742 CAGGCAGTTATACTAGAGGCAGG - Intronic
1150406651 17:64907072-64907094 CTGTGACTCATGATACAGGCTGG - Intronic
1151219855 17:72604384-72604406 CAGGGACTTAGTATGGAGGGAGG - Intergenic
1203170791 17_GL000205v2_random:146466-146488 CAGGGACTAAGGAGAGAGGGTGG + Intergenic
1154384405 18:13880236-13880258 GAGGCACTTCTGATAGAGGCAGG + Intergenic
1159584671 18:70272403-70272425 CAAAGACTTAAGACAGAGGCAGG - Intergenic
1160121057 18:76130809-76130831 CAGGGACCTGTGAGAGAGGCGGG + Intergenic
1163254712 19:16148742-16148764 CAGGAAGCTATGACAGAGGCCGG + Exonic
1164810881 19:31154868-31154890 CTGGCCCTTATGATAGAGACAGG - Intergenic
1164956827 19:32393334-32393356 CAGGGACTTAAGGCAGAAGCAGG + Intergenic
1164956834 19:32393379-32393401 CAGGGACTTAAGACAGAGGTGGG + Intergenic
929652214 2:43691637-43691659 CAGGTGATAATGATAGAGGCGGG - Intronic
931877390 2:66528701-66528723 AAGGGACCAATGTTAGAGGCAGG - Intronic
932268057 2:70385453-70385475 AAGGGACTTATGAGAAGGGCAGG - Intergenic
933310320 2:80652400-80652422 GAGGAACTCATGATAGAGACAGG - Intergenic
933412192 2:81940520-81940542 CTGAGACTTAAGATAGAGGCAGG - Intergenic
935712410 2:105910907-105910929 TTGGGTCTAATGATAGAGGCAGG + Intergenic
937898341 2:126995993-126996015 CAGAGACTTAAGACAGAGGCAGG - Intergenic
937956126 2:127422695-127422717 CAGGGACGTGGGATGGAGGCTGG + Intronic
938911471 2:135889303-135889325 CAGTGACTGATGACAGAGGCAGG + Intergenic
945471168 2:210229233-210229255 CATGGGCATAAGATAGAGGCAGG + Intergenic
947545214 2:231005670-231005692 CAGGGCCTGGTGATAGAGGTAGG - Intronic
1169275541 20:4231476-4231498 CAGGCACTTGTGCTAGAGGCTGG - Intronic
1169503387 20:6183245-6183267 CAAGTACTTAAGATTGAGGCAGG + Intergenic
1171130590 20:22649367-22649389 CAGGGACTTCTGAGAGATGGTGG + Intergenic
1173758650 20:45540338-45540360 TAGGGACTGATGCTAGAGGTAGG - Intronic
1173943778 20:46933825-46933847 CAGAGAGTAATGAGAGAGGCAGG + Intronic
1175194840 20:57235929-57235951 CAGGGAGTGAGGACAGAGGCAGG + Intronic
1175194844 20:57235948-57235970 CAGGGAGTGAGGACAGAGGCAGG + Intronic
1177567400 21:22843234-22843256 GAGGGGCAAATGATAGAGGCAGG - Intergenic
1177866790 21:26521746-26521768 CAGGGCCTCTAGATAGAGGCAGG + Intronic
1179046577 21:37850217-37850239 GTGGGACTGATGATAGGGGCAGG + Intronic
1179991644 21:44951304-44951326 CAGGGAGGTAGGAGAGAGGCAGG + Intronic
1181019353 22:20090882-20090904 CACGGAGTTATGAGACAGGCTGG - Intronic
1182142045 22:27967803-27967825 CTGGGAGGGATGATAGAGGCTGG - Intergenic
1184099630 22:42335285-42335307 CAGGGGGTGCTGATAGAGGCAGG - Intronic
951513280 3:23528515-23528537 CGGAGACTTAAGAAAGAGGCAGG - Intronic
951958174 3:28281729-28281751 CAGTGAATTCTGATATAGGCAGG + Intronic
954396375 3:50295521-50295543 CAGGGACCTGTGGTAGGGGCTGG + Exonic
955664449 3:61335539-61335561 TAGGGACATCTAATAGAGGCAGG + Intergenic
957080587 3:75632941-75632963 CAGGGACTAAGGAGAGAGGGTGG - Intergenic
959229414 3:103629522-103629544 CAGAGACAAATGAGAGAGGCAGG - Intergenic
960513453 3:118577452-118577474 GAGGGACTTGTGAGAGAGGGAGG + Intergenic
963566122 3:146933139-146933161 CTGAGAATTATGATAGAGGGAGG - Intergenic
964039235 3:152238546-152238568 TAGGGAGTTATGATAGGGACTGG - Intergenic
965871500 3:173270432-173270454 CAGAGACTTAAGATAGAGGTGGG + Intergenic
967125083 3:186416027-186416049 CAGGGACCTGGGAAAGAGGCTGG - Intergenic
972316106 4:37927182-37927204 CACAGACTTCTAATAGAGGCGGG + Intronic
974279870 4:59779261-59779283 CAGAGACTTAAGACAGAGGTGGG + Intergenic
978193491 4:105943411-105943433 CAGGGACAGATGAGAGAAGCTGG + Intronic
983346681 4:166535802-166535824 CAGAGACTTGAGACAGAGGCAGG - Intergenic
983397251 4:167215396-167215418 CAGGGACTCATGAAAAAGACAGG + Intronic
986334137 5:6740606-6740628 CAGGTGCTTTTGATTGAGGCTGG + Intronic
988730205 5:33964912-33964934 CAGTGACTTCTGATAAAGGTGGG + Intronic
989111378 5:37909594-37909616 CTGGGGCTCATGATTGAGGCTGG + Intergenic
989727352 5:44602560-44602582 CAGGGCCTAATGAGAGAGCCAGG + Intergenic
997005285 5:129809651-129809673 CAGGGGCATAGGATAGAGTCAGG - Intergenic
998622629 5:143811799-143811821 CAGGGACCTATGATAGAAAAGGG + Intergenic
998894212 5:146781314-146781336 CTGAGAATTATGAGAGAGGCAGG - Intronic
999087467 5:148905475-148905497 CAGGGCCACATGATTGAGGCTGG - Intergenic
999870601 5:155746623-155746645 CAGAGACTTAAGACAGAAGCTGG - Intergenic
1000817434 5:165941033-165941055 CACGTACTTTTGATAGTGGCTGG + Intergenic
1001421232 5:171588865-171588887 CAGGAACTGGTGCTAGAGGCAGG + Intergenic
1001796097 5:174503707-174503729 CAGGGCATTTTGATAGTGGCTGG + Intergenic
1013085993 6:106858146-106858168 CAGAGACTTAAGACAGAGGTGGG + Intergenic
1013761347 6:113522545-113522567 CAGGGACTTATCAGAGTTGCTGG - Intergenic
1014274176 6:119368157-119368179 CAGGTACTATTGATAGAGACAGG + Intergenic
1018136432 6:160782272-160782294 CAGAGACTTAAGACAGAGGTGGG + Intergenic
1026024341 7:66732881-66732903 CAGGGAATTCTGGCAGAGGCTGG - Intronic
1026500897 7:70942606-70942628 CAGAGACTTAAGACAGAGGCAGG + Intergenic
1028763672 7:94525384-94525406 CAGGGACTTAAGATAGGGAAAGG + Intronic
1031864660 7:127025230-127025252 CAGGGTCTTTTGATAGAGAGTGG + Intronic
1032193640 7:129778159-129778181 CAGGGGCATTTGATAGAGACTGG - Intergenic
1032195735 7:129787259-129787281 GAGGGACTTATGCTAAATGCTGG - Intergenic
1033981537 7:147171046-147171068 CTGGGAGATTTGATAGAGGCGGG - Intronic
1036603177 8:10282202-10282224 CAGGCACTTACTGTAGAGGCTGG - Intronic
1037097633 8:15004436-15004458 CAGACACTTAAGATAGAGGTGGG + Intronic
1037614892 8:20510124-20510146 CAGGGACTTCTTATGGAGGAAGG + Intergenic
1043678808 8:82996317-82996339 CAGGAACATATGATGAAGGCTGG + Intergenic
1050035648 9:1433139-1433161 CAAGAACTTATGATAAAGGTGGG + Intergenic
1051947194 9:22583165-22583187 TAGGGAATAATGATAGAAGCTGG - Intergenic
1056705606 9:88950182-88950204 CAGGGCCTTGTGGTGGAGGCAGG - Intergenic
1057346579 9:94256820-94256842 CAGGGTCTTAGGATGGAAGCAGG + Intergenic
1059255101 9:112922997-112923019 CAGAGACTGGTGATAGAGGGAGG - Intergenic
1059377652 9:113898482-113898504 CAGGGAGATATGATCCAGGCTGG - Intronic
1059711450 9:116871441-116871463 CAGGGACTTATGATAGAGGCAGG - Intronic
1060687692 9:125626255-125626277 CAGGCACTTTTGAGAGAGCCTGG - Intronic
1203435341 Un_GL000195v1:132211-132233 CAGGGACTAAGGAGAGAGGGTGG - Intergenic
1186214647 X:7286460-7286482 CAGGGACTTTTGACAGGGGCTGG + Intronic
1186883079 X:13885725-13885747 CAGTGACTTAAGATGGAGGGGGG - Intronic
1190736360 X:53257902-53257924 CAGCTACTAATGATAGAGCCAGG + Intronic
1194463627 X:94204422-94204444 CAGAGACTTAGGACAGAGGCTGG - Intergenic
1194826736 X:98574543-98574565 CAGAGACTTAAGAAAGAGGAGGG - Intergenic
1194956839 X:100190687-100190709 CAGAGACTTAAGACAGAGGCGGG + Intergenic
1197066453 X:122238822-122238844 GAGGGGGTAATGATAGAGGCAGG + Intergenic