ID: 1059711451

View in Genome Browser
Species Human (GRCh38)
Location 9:116871445-116871467
Sequence TAGGCAGGGACTTATGATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 88}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059711451_1059711456 3 Left 1059711451 9:116871445-116871467 CCTCTATCATAAGTCCCTGCCTA 0: 1
1: 0
2: 0
3: 10
4: 88
Right 1059711456 9:116871471-116871493 CCTCCCAATGACCCTTGTGTTGG No data
1059711451_1059711457 4 Left 1059711451 9:116871445-116871467 CCTCTATCATAAGTCCCTGCCTA 0: 1
1: 0
2: 0
3: 10
4: 88
Right 1059711457 9:116871472-116871494 CTCCCAATGACCCTTGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059711451 Original CRISPR TAGGCAGGGACTTATGATAG AGG (reversed) Intronic
905471155 1:38193082-38193104 GAGGCAGGTAATTATGATAAAGG + Intergenic
909320187 1:74275532-74275554 TAGGGAAGGAGTTATGAGAGGGG + Intronic
909511864 1:76462318-76462340 TACCCAGGGACTTATGAAAATGG - Intronic
909706311 1:78588847-78588869 CAGGTAAGGACTTATGAAAGAGG + Intergenic
914864077 1:151411160-151411182 TAGGCAGGGACAGATCATGGAGG - Intronic
915863069 1:159468243-159468265 TAGGCAGAGAGTTATTATTGTGG + Intergenic
917605954 1:176629652-176629674 GAGGCTGGGTCTTATGATATAGG + Intronic
918739011 1:188103403-188103425 TAGGCAGAGACTTGTCACAGGGG - Intergenic
922216698 1:223525950-223525972 TAGGCAGGTCTTTATGATGGAGG + Intergenic
924205022 1:241703424-241703446 CAGCCAGGGACTTTTGATAGGGG + Intronic
1069993733 10:72330011-72330033 TAGCCAGGGACTCTTGATAGAGG - Intergenic
1070575460 10:77673947-77673969 TAGGCAGGGCCCTAAGCTAGAGG + Intergenic
1072896853 10:99374918-99374940 TGGACAGGGAGTCATGATAGAGG + Intronic
1073082135 10:100866996-100867018 CAAGGAGGGACTTGTGATAGCGG + Intergenic
1073290803 10:102412348-102412370 TAGGCTGGGACTGAGGATGGGGG - Intronic
1074407765 10:113193870-113193892 AAAGCAGGGCCATATGATAGTGG + Intergenic
1074567580 10:114594983-114595005 AAGGCAGGGACATGTGATATAGG + Intronic
1078406363 11:11073649-11073671 TAAGCAGGGATTTATTATAGGGG + Intergenic
1080684571 11:34504519-34504541 GAGGCAGGGGCTTCTGGTAGTGG + Intronic
1083932088 11:65851606-65851628 TAGGGAGGGAGTTAGGGTAGGGG - Intronic
1084391692 11:68881448-68881470 TAGGAAGGGCCTTGTGACAGAGG - Intergenic
1085607665 11:77917087-77917109 TAGACAAAGACTTATGATGGTGG - Intronic
1086020370 11:82221446-82221468 TTGGCAGGGGCTGATGGTAGGGG - Intergenic
1088011147 11:105002312-105002334 AAGGCAGTGTCTTCTGATAGAGG - Intronic
1089563753 11:119359505-119359527 TAGGCAGGGGCACATGACAGAGG + Intronic
1093763712 12:22938831-22938853 TAGGCAGAGACTTGTTACAGAGG + Intergenic
1097225194 12:57472965-57472987 TGGGCAGTGACTTCTGAGAGAGG - Intronic
1098739146 12:74148858-74148880 TATGAAGGGGCTTATGATGGTGG - Intergenic
1104530453 12:129565309-129565331 AAAGCAGGGACTTGAGATAGAGG + Intronic
1110136374 13:72072166-72072188 TAGGCAGGGACTTAAAGGAGAGG + Intergenic
1115080977 14:29450325-29450347 TAGGCAGGGCCCTATAAAAGAGG - Intergenic
1120635629 14:86947105-86947127 TTGCCAGGGACTAATGGTAGAGG - Intergenic
1120968911 14:90191427-90191449 GAGCCAGGGACTTAAGAAAGTGG - Intergenic
1128932423 15:71717430-71717452 TAGCCAGGGACTGATGGTGGTGG + Intronic
1133519291 16:6541736-6541758 TGGGCAGGAGCTAATGATAGAGG + Intronic
1143360271 17:6363790-6363812 TAGGCAGGGCCCCATCATAGAGG - Intergenic
1143450243 17:7031986-7032008 CAGGCAGGGACTTGTCACAGGGG - Intergenic
1152636304 17:81431870-81431892 TAGCCAGGGACTTGGGCTAGAGG + Intronic
1155602255 18:27563026-27563048 AAGGAAGTGACTTATGATAGTGG - Intergenic
1157178161 18:45469851-45469873 TAGGCAGGGACACATTATAAAGG + Intronic
1157743314 18:50112659-50112681 TAGGGAGTGACTTAATATAGTGG - Intronic
1158639288 18:59189479-59189501 TAGTAAGGGACTTGTGATAGAGG - Intergenic
1163415535 19:17184263-17184285 TAGCCAGGGACTGAAGATGGGGG - Intronic
1164956832 19:32393375-32393397 AAGGCAGGGACTTAAGACAGAGG + Intergenic
1168584417 19:57581580-57581602 TAGCAAGGGACTGAAGATAGTGG - Intronic
925986471 2:9219333-9219355 TAGCCAGGGAGTTAGGAGAGCGG + Intronic
1171937443 20:31288420-31288442 CAAGCGGGGGCTTATGATAGTGG - Intergenic
1173382812 20:42561286-42561308 TATGCAGGGACTTAGGAAAATGG - Intronic
1175589891 20:60180919-60180941 TAGGCGGGGACATTTGAAAGGGG + Intergenic
1179145251 21:38762504-38762526 TAGGCTGGGATAAATGATAGTGG - Intergenic
1179304720 21:40143886-40143908 TAGGCAGGAAGTTAAGATATGGG - Intronic
1179370455 21:40801868-40801890 CAGGCAGGGACTTGTCACAGGGG + Intronic
949141216 3:635624-635646 TAGGCAGGGGCTCATCATAAAGG + Intergenic
954243234 3:49310517-49310539 TAGGCAGGGACTCCTGGGAGAGG + Intronic
965871498 3:173270428-173270450 AAGGCAGAGACTTAAGATAGAGG + Intergenic
970305939 4:14732905-14732927 TAGGCAGGTTATTTTGATAGGGG + Intergenic
973945625 4:55951800-55951822 TAGGCAGAGACTTCTCAGAGAGG - Intronic
974279868 4:59779257-59779279 GAGGCAGAGACTTAAGACAGAGG + Intergenic
976322024 4:83727035-83727057 TAGGCAGGTGCTAATGAAAGAGG + Intergenic
976512409 4:85926919-85926941 AAGGCATGGACTTATAATTGTGG - Intronic
981933632 4:150216197-150216219 TAGCCAGGGAGTTATGTCAGAGG - Intronic
988510956 5:31864342-31864364 TAGGCAGGGACTGTTTACAGAGG - Intronic
989050602 5:37316399-37316421 TTGCCAGGGACCTAGGATAGGGG + Intronic
991501726 5:67283510-67283532 TAGGCAAGGACTTATGTAACAGG + Intergenic
992036421 5:72782879-72782901 TAGGCAGAGACTAATTACAGGGG + Intergenic
995302815 5:110604050-110604072 TAGGTAAGCAATTATGATAGTGG - Intronic
996171727 5:120301261-120301283 GAGGCAGTGGCATATGATAGAGG + Intergenic
996888122 5:128383747-128383769 TAGGCAGGGATTTCTCATTGTGG - Intronic
1000966374 5:167662043-167662065 TAGGCAGAGACTGATGATAAAGG + Intronic
1003981778 6:11396748-11396770 TAGGCAGAGACTTAAAATAAGGG + Intergenic
1006301835 6:33197780-33197802 TGGCCAGGCACTTCTGATAGCGG + Exonic
1008057775 6:46962983-46963005 TAGGCATGGAGTGGTGATAGTGG - Intergenic
1013085991 6:106858142-106858164 AAGGCAGAGACTTAAGACAGAGG + Intergenic
1018136430 6:160782268-160782290 AAGGCAGAGACTTAAGACAGAGG + Intergenic
1021187358 7:17580041-17580063 TAGGCAAAGATTTATCATAGGGG + Intergenic
1023450778 7:40282681-40282703 TAGACAGGGTCTCATTATAGTGG - Intronic
1024392055 7:48826720-48826742 TAGGTAGGGAATCAAGATAGAGG + Intergenic
1024489157 7:49957686-49957708 CAGGCAGAGACTTACCATAGGGG + Intronic
1025845289 7:65190842-65190864 TAGACAAAGACTTATGATGGTGG + Intergenic
1025895564 7:65696872-65696894 TAGACAAAGACTTATGATGGTGG + Intergenic
1026500896 7:70942602-70942624 AAGGCAGAGACTTAAGACAGAGG + Intergenic
1028235294 7:88354054-88354076 TAGGCAGGGACTTATCATGAAGG - Intergenic
1031936436 7:127739852-127739874 CAGGCAGGGGCTGATGAGAGTGG + Intronic
1033458123 7:141520810-141520832 TTGGCAGGGATTTGTGAGAGAGG - Intergenic
1036575249 8:10021944-10021966 TGGGCAGGGACTGCTGAAAGAGG + Intergenic
1037097631 8:15004432-15004454 AAGGCAGACACTTAAGATAGAGG + Intronic
1042195380 8:66227663-66227685 CAGGCAGAGACTTATCATAGGGG - Intergenic
1043268654 8:78300712-78300734 TAGACTGGGAATTATGTTAGCGG - Intergenic
1046031780 8:108790728-108790750 TAGACATAGACTTATGAGAGAGG - Intergenic
1048593423 8:135842614-135842636 TAGGCAGGCTCTGGTGATAGTGG - Intergenic
1053092951 9:35296488-35296510 TAGGAAGGGAATTATGAAACAGG - Intronic
1058226727 9:102372911-102372933 TAGTCAGTGACTGATGATGGTGG - Intergenic
1058601114 9:106671460-106671482 TAGGCAGAGACATATTATAAAGG + Intergenic
1059711451 9:116871445-116871467 TAGGCAGGGACTTATGATAGAGG - Intronic
1187499446 X:19827360-19827382 AAGGCAGGAAGCTATGATAGGGG - Intronic
1192157382 X:68756801-68756823 TAGGCAGGGACTGATGCAATTGG + Intergenic
1194411353 X:93562415-93562437 GAGGCTGGGAAGTATGATAGGGG + Intergenic
1194826738 X:98574547-98574569 AAGGCAGAGACTTAAGAAAGAGG - Intergenic
1194956837 X:100190683-100190705 AAGGCAGAGACTTAAGACAGAGG + Intergenic