ID: 1059711452

View in Genome Browser
Species Human (GRCh38)
Location 9:116871459-116871481
Sequence TCATTGGGAGGAAGTAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 245}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059711452_1059711457 -10 Left 1059711452 9:116871459-116871481 CCCTGCCTACTTCCTCCCAATGA 0: 1
1: 0
2: 1
3: 21
4: 245
Right 1059711457 9:116871472-116871494 CTCCCAATGACCCTTGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059711452 Original CRISPR TCATTGGGAGGAAGTAGGCA GGG (reversed) Intronic
900582614 1:3416551-3416573 TCACTGGGAGGAACTGGCCAGGG - Intronic
900602186 1:3507692-3507714 CCAGTGGGAGGAAGGAGACAAGG + Intronic
902513674 1:16979126-16979148 TCATTTGGAGGGAGAGGGCATGG + Intronic
903891330 1:26572319-26572341 TTATTTGGAGGAGGGAGGCAGGG + Intronic
904420429 1:30387433-30387455 TCATGGGGTGGAGGTTGGCAGGG + Intergenic
904492199 1:30868066-30868088 TCATTGGAAGGAGGGAGGGATGG + Intergenic
905908220 1:41633805-41633827 TGTCTGGGAGGAAGGAGGCAAGG - Intronic
906702353 1:47869050-47869072 TCATTTGGGGGAAGGAGGGAGGG - Intronic
909123342 1:71633662-71633684 TCTTTGGGTGGCAGTAAGCAAGG - Intronic
909313159 1:74179843-74179865 TCATTGTGAAGAAGTATGAATGG - Intronic
909555976 1:76954682-76954704 TCAGAGGGAGGAAGCAGGAATGG + Intronic
910289586 1:85587539-85587561 TGAATGGTAAGAAGTAGGCAGGG - Intergenic
910416760 1:87009300-87009322 TCTTTGGAAAGAAGTAGGAAAGG + Intronic
910698254 1:90045018-90045040 CCAATGGAAGGAATTAGGCAAGG + Intergenic
911212573 1:95158073-95158095 ACATTGGGAGGAAGAAGGGAAGG - Intronic
913670851 1:121096189-121096211 TCACGGGGAGCAAGTGGGCAGGG - Exonic
914661101 1:149791554-149791576 TCACGGGGAGCAAGTGGGCAGGG - Exonic
916425694 1:164677650-164677672 TCATTGAGAGGAGGTAGGGATGG + Intronic
916615853 1:166438619-166438641 GAATTGGGAGGAAGTGGGGATGG - Intergenic
917335254 1:173918910-173918932 GCAGTGGGAGGAAGTGGGGAGGG + Intergenic
917959704 1:180132472-180132494 TCCTTTGATGGAAGTAGGCAGGG - Intergenic
918967349 1:191368993-191369015 TAACTGGGAGCAAGAAGGCATGG - Intergenic
920434418 1:205938858-205938880 TCTTTGGGAGGAAAGCGGCAGGG + Intronic
920751302 1:208680026-208680048 TCATTTTGAGGAAGGAAGCAGGG - Intergenic
920972351 1:210753631-210753653 TCACTGGGGGGTTGTAGGCATGG + Intronic
922776377 1:228215950-228215972 TCACTGGGATGAAGCAGGCAGGG + Intronic
923022588 1:230176208-230176230 TGATTGGAAGGAAGAAGGGAGGG + Intronic
923262020 1:232276634-232276656 GGATAGGGAGGAAGCAGGCAGGG - Intergenic
924745076 1:246824301-246824323 TGATTGAGAAGAAGTAGGCTGGG - Intergenic
1063857507 10:10271727-10271749 CCATTGGGTGGAACCAGGCAAGG + Intergenic
1064194293 10:13233010-13233032 CCAGAGGGAGGAAGTAGCCAAGG + Intronic
1064420106 10:15183598-15183620 TGATGGGGAGGAAGGAGCCAAGG + Intergenic
1065356964 10:24851642-24851664 TACTCGGGAGGAAGGAGGCAAGG + Intronic
1065834042 10:29640887-29640909 TTATTGGGAGTGAGCAGGCAGGG - Intronic
1066165610 10:32785723-32785745 TAATTGGGAGGATTTAGGAAAGG + Intronic
1067056178 10:43052849-43052871 TATTTGGGAGCAAGGAGGCATGG - Intergenic
1067067725 10:43113108-43113130 CCATGGGGAGGGAGCAGGCAGGG + Intronic
1067777115 10:49171736-49171758 TCCTGGGGAGGAAGATGGCAGGG + Intronic
1067837329 10:49649687-49649709 GCCTTGGGAGCTAGTAGGCAAGG - Intronic
1068971336 10:62961442-62961464 TCCTTGGAAGGAATTTGGCAGGG - Intergenic
1070520341 10:77247418-77247440 TCAAAGGGAGGAAATAGACAAGG + Intronic
1071532336 10:86400119-86400141 TCATTGCGCGGAAGTCGGCCTGG - Intergenic
1071866207 10:89735031-89735053 TTATTGGGAGGAATTATCCAGGG - Intronic
1074104951 10:110382436-110382458 GAAATGGGAGCAAGTAGGCAAGG - Intergenic
1075245441 10:120818203-120818225 TCATTGAGAGGAAGAAAGGAAGG - Intergenic
1075576358 10:123580552-123580574 GCAATGGGAGGAAGTTGGAAAGG - Intergenic
1076091067 10:127686144-127686166 ACACTGGAAGGAGGTAGGCATGG - Intergenic
1076129381 10:128002296-128002318 CCATCAGGAGGAAGTGGGCAAGG + Intronic
1077781553 11:5335449-5335471 GCACTGGGAGGAAGTAGGCAGGG + Intronic
1077838619 11:5947640-5947662 ACATCTGGAGGAAGCAGGCAGGG - Exonic
1077846201 11:6027380-6027402 ACATCTGGAGGAAGCAGGCAGGG + Exonic
1078368544 11:10726318-10726340 TCACCAGGAGGAGGTAGGCATGG - Intergenic
1078391278 11:10937576-10937598 TCACTGGGAGGTTGTGGGCAGGG - Intergenic
1078761745 11:14257349-14257371 TCATTGGGAAGATGAAGCCATGG + Intronic
1078768804 11:14327413-14327435 ACATTGGGAGGAAGTGGGGATGG + Intronic
1079124144 11:17707166-17707188 ACAAGGGGAAGAAGTAGGCAGGG + Intergenic
1083343098 11:61971622-61971644 TCATTGGGAGGAGGCTGGCTGGG + Intergenic
1084604533 11:70164880-70164902 GCACTGGGAGGGAGTAAGCAGGG - Intronic
1084739900 11:71133004-71133026 TCTTGGGGAGGTAGAAGGCATGG - Intronic
1089312577 11:117569566-117569588 TAATAGAAAGGAAGTAGGCAGGG - Intronic
1090172775 11:124619269-124619291 GCAGTGGAAGGAAGGAGGCAAGG - Intronic
1092339521 12:7663456-7663478 GCATTGGGAGGAAGGAGGAAGGG + Intronic
1093647803 12:21608489-21608511 TCATTGGGAGGTTTTAAGCAGGG + Intergenic
1095466126 12:42489742-42489764 TGACTGGGAGGAAGAAAGCATGG - Intronic
1097702282 12:62832201-62832223 TCACTGTGAAGAAGAAGGCAGGG - Exonic
1098261408 12:68675635-68675657 ACATTGGGGGGAAGGAGGCGTGG + Intergenic
1098627256 12:72687385-72687407 TCATTTGGAGGAAGGAAGCTTGG + Intergenic
1099514484 12:83580244-83580266 TGATTAAGAGGAAGTATGCAGGG + Intergenic
1099674758 12:85744098-85744120 GTCTTGGGAGGAAGTAGGGAAGG + Intergenic
1099909643 12:88813909-88813931 TCATTGGAAGGGAGTAGCCAAGG - Intergenic
1100658397 12:96671295-96671317 GAATTGGGAGGAAGCAGGCAGGG - Intronic
1102261331 12:111445206-111445228 TCACTGGGAGGATATAGGCCAGG - Intronic
1102960540 12:117090722-117090744 TCCTTGGGGGGATGCAGGCAAGG + Intronic
1103821596 12:123702991-123703013 TCAATTGGAGGAAGTAGGGTAGG - Intronic
1104084794 12:125464360-125464382 CAATTGGCAGGAAGTAGCCATGG + Intronic
1104221078 12:126785715-126785737 TCTTTTGGTAGAAGTAGGCACGG + Intergenic
1105266427 13:18821987-18822009 TCATTAGGAGGAAGTCAGTAAGG - Intergenic
1107278816 13:38709209-38709231 TCATGCAGAGGAAGTGGGCAGGG - Intronic
1108700116 13:52936650-52936672 TCCTTGGGAGGAGGAAGGGAAGG + Intergenic
1109521576 13:63518755-63518777 TCAGTGGGAGCAAGTGGGAAAGG - Intergenic
1111893646 13:94114400-94114422 TCATTGTAAGGAAGCAGGCGGGG + Intronic
1112679409 13:101745273-101745295 TAATGGGGAGGAGTTAGGCATGG - Intronic
1112721562 13:102251775-102251797 TCATTTGGAGGATGCAGGAAGGG - Intronic
1113733371 13:112657890-112657912 CCATGGGGAGGAGGTAGGGACGG + Intronic
1117024052 14:51601723-51601745 TCCATGAGAGGAAGAAGGCAAGG + Intronic
1119318494 14:73714808-73714830 TCATTGGGATGAAATATGCAGGG - Intergenic
1119614244 14:76088218-76088240 TCAATGATAGGAAGAAGGCAGGG - Intergenic
1120871682 14:89343311-89343333 GCATTGGGAGGAGGTGGGGAAGG - Intronic
1121510773 14:94511679-94511701 TCTTTGGAAGGAAGCAGGAAAGG - Intronic
1123062309 14:105599834-105599856 GCAGTGGGAGGAGGTGGGCAGGG - Intergenic
1123087051 14:105721562-105721584 GCAGTGGGAGGAGGTGGGCAGGG - Intergenic
1125484756 15:40104170-40104192 TCATGTGCAGCAAGTAGGCACGG - Exonic
1126429995 15:48572988-48573010 ACAATGGGAGGATGTGGGCATGG + Intronic
1126806230 15:52352101-52352123 GCCTTGGGAGGCAGGAGGCAAGG + Intronic
1127895409 15:63294426-63294448 TCTTTGGTAAGAAGTGGGCATGG - Intronic
1130566282 15:84998808-84998830 TCCTTGGGATGAAGAAGTCAGGG + Intronic
1131376084 15:91924726-91924748 TCATTGTGAGGCAGTAAGCAAGG - Intronic
1132771848 16:1567882-1567904 TGAGTGGGATGAAGAAGGCAGGG + Intronic
1134339329 16:13330793-13330815 TCATTGGGAGCCAGCAGGGATGG + Intergenic
1134556820 16:15172767-15172789 CCATGGGGAAGAAGAAGGCAAGG - Intergenic
1134917400 16:18084485-18084507 CCATGGGGAAGAAGAAGGCAAGG - Intergenic
1135647552 16:24176192-24176214 TCATTAGGAGAAAGTAGGAATGG - Intronic
1137893556 16:52186926-52186948 ACATTAGGAGGAAGCAGGCCTGG - Intergenic
1140873179 16:79125608-79125630 TCCTTGGGAGGATGCAGGAAGGG - Intronic
1141163498 16:81644850-81644872 CCCATGGGAGGAGGTAGGCAAGG + Intronic
1142699686 17:1651379-1651401 TCCTTGGGAGGAAGTATGGTGGG - Intronic
1142854846 17:2723924-2723946 TCCTGGGGAGGAAGAAGGCTTGG + Intergenic
1146275157 17:31511828-31511850 TCTTTTGTAGGAAGTTGGCAAGG - Intronic
1146511855 17:33456347-33456369 TATTTGGGAGGAAGTGGGGAGGG - Intronic
1146934901 17:36807396-36807418 TGATAGGGGTGAAGTAGGCAGGG + Intergenic
1147185705 17:38712114-38712136 TCAGAGGAAGGAAGAAGGCAGGG - Intronic
1147555930 17:41479126-41479148 GCATGGGGAGGAGGTGGGCATGG - Intronic
1148163426 17:45465122-45465144 TACCTGGGAGAAAGTAGGCATGG - Intronic
1148703797 17:49610033-49610055 TCTCTTGGAGGAAGTAGGCAAGG + Intronic
1149014308 17:51890227-51890249 TCATGGGGATAGAGTAGGCAGGG + Intronic
1150227293 17:63530992-63531014 ACATTGGAAGGAAGTAGGGAGGG - Intronic
1150289789 17:63974525-63974547 TGATGGGGAGGAAGGTGGCAAGG - Intergenic
1150394654 17:64811774-64811796 TACCTGGGAGAAAGTAGGCATGG - Intergenic
1151732111 17:75917762-75917784 TCATCGGGAAGATGGAGGCACGG - Exonic
1151817833 17:76479854-76479876 TCTTGGGGAGGAAGGAGGGAGGG + Exonic
1156493377 18:37509995-37510017 GGATTGGGAGGAGGTAGGAATGG + Intronic
1157504415 18:48216623-48216645 TCAGGGGGAGGAAGCAGGAAAGG - Intronic
1157573957 18:48731310-48731332 TCACTGGGAGGGAGTAGAGAAGG + Intronic
1159139170 18:64371505-64371527 TCATTAGAAAGAAGGAGGCAGGG + Intergenic
1159229261 18:65584647-65584669 TCATGGGGAGGAAGTGTGGATGG - Intergenic
1160292298 18:77606216-77606238 TCCTTGGGAGGAAGGAGGCTGGG + Intergenic
1163830194 19:19543895-19543917 TCACTGGGAGGACGTAGCCAGGG - Exonic
1164603462 19:29579102-29579124 TCATTGGAAGGAAGGAGGGGTGG - Intergenic
1164714459 19:30381319-30381341 TTATGGGGAGGGAGAAGGCAGGG + Intronic
925273541 2:2632725-2632747 TCACTGGGAGGAAGTAAAAATGG - Intergenic
927054983 2:19358993-19359015 TCTTTGGGAGGAGGGAGGGAGGG + Intergenic
928341782 2:30449182-30449204 TCATAGGAAGATAGTAGGCATGG - Intronic
929658086 2:43754511-43754533 TCCCTGGTAGGTAGTAGGCAAGG - Intronic
930242751 2:48953254-48953276 TCAGTGTGAGGAAGCAGGTAAGG + Intergenic
932268652 2:70389700-70389722 GTCTTGGGAAGAAGTAGGCATGG - Intergenic
933772123 2:85751212-85751234 TATTTGGGGGGAAGTTGGCACGG + Intergenic
934300906 2:91775598-91775620 CCACTGTGAGGAGGTAGGCAAGG + Intergenic
934764635 2:96873883-96873905 TCCTTTGGAGGAAGTAGGGAGGG - Intergenic
936936874 2:117847441-117847463 TCAATGGGAGAGAGTAGTCAGGG - Intergenic
937312227 2:120909379-120909401 GCAGTGGGAGGAAGCTGGCATGG - Intronic
938395067 2:130939569-130939591 TTATTGGAAGGAACTAGCCATGG - Intronic
938614063 2:132979460-132979482 TGCTGGGGAGGAAGTAGGCATGG - Intronic
938826683 2:135012773-135012795 GTATTGGGAGGATGGAGGCAGGG - Intronic
939995846 2:148918752-148918774 CCTTTGGAAGGAATTAGGCAAGG + Intronic
941207141 2:162588049-162588071 GCGATGGGAGGAAGGAGGCATGG - Intronic
942473605 2:176290269-176290291 TGTTAGGGAGGTAGTAGGCAGGG + Intronic
943068426 2:183113495-183113517 TCATTGGGAGAAACTGGGTAAGG + Intergenic
943848313 2:192680781-192680803 TCACTGAGAGAAACTAGGCAAGG - Intergenic
946360017 2:219213729-219213751 TCTTCGGTAGGAAGTGGGCAGGG - Intronic
946518311 2:220437616-220437638 TCTTTGGGAGAAAGTAAGTAGGG + Intergenic
948006764 2:234616033-234616055 TCATGGGGAGGAAGTGGTCCAGG + Intergenic
948604386 2:239125764-239125786 TCAGGAGGAGGTAGTAGGCAAGG - Intronic
1168835504 20:874592-874614 TCCCTGGGAGGCAGCAGGCAGGG - Intronic
1169102630 20:2964673-2964695 TCCTTTGGAGGAGGTAGGAAAGG + Intronic
1169371268 20:5030066-5030088 AAATTGGCAGGAAGGAGGCAGGG - Intergenic
1169933236 20:10856336-10856358 TCTTTGAGAGTAAATAGGCAGGG + Intergenic
1172975777 20:38904746-38904768 TCAGTGGGACAAAGAAGGCATGG - Intronic
1174336252 20:49862995-49863017 ACATTTTGAGGAAGTAGTCAAGG - Exonic
1175401851 20:58705061-58705083 TCATTATGAGGAAGTTGTCATGG + Intronic
1176851499 21:13920467-13920489 TCATTAGGAGGAAGTCAGTAAGG - Intergenic
1178074680 21:29003880-29003902 TCATTGGCAGAAACTGGGCAGGG + Intergenic
1181470920 22:23139153-23139175 TCACTGGTAGGAAGTGTGCAGGG - Intronic
949639554 3:6019959-6019981 TCAATGGGAGACAGTGGGCAGGG - Intergenic
950365546 3:12480922-12480944 TCATTGCTAGGAAGTAGTGAAGG - Intergenic
951774850 3:26298481-26298503 TACTTGGGAGGAAACAGGCAGGG + Intergenic
955008030 3:54988047-54988069 TCACTGCGAAGAAGTAGGAAAGG + Intronic
955130341 3:56159653-56159675 TACTAGGGAGGAAGGAGGCAAGG - Intronic
957784439 3:84863689-84863711 TTATTGGTAGGAAGCAGCCAGGG - Intergenic
958956093 3:100467171-100467193 TGATTGGCAGGAATTAGCCATGG - Intergenic
961096531 3:124161291-124161313 TCATTGCGAGGAATTAGGACTGG + Intronic
962053328 3:131842277-131842299 GCATAGAGAGGAAGTTGGCAGGG + Intronic
962754969 3:138459892-138459914 GCATGGGGAGAAAGTAGGCCTGG + Intronic
964647959 3:158978889-158978911 TCATTAGGAGGCAGCATGCATGG - Intronic
968575791 4:1365520-1365542 TCAATGGGAGGAGGGAGGCGGGG + Intronic
968657484 4:1785005-1785027 TCATCTGGAGGCAGAAGGCAGGG - Intergenic
968960137 4:3739279-3739301 GCCGTGGGAGGAAGAAGGCAGGG + Intergenic
969361946 4:6670052-6670074 TGATTGGAAGAAAGTAGGAAGGG - Intergenic
970641612 4:18072688-18072710 ACATAGGGAGAAAGTAGGGATGG - Intergenic
972020700 4:34310088-34310110 TCATTAGGAGGAGGTAGGACAGG + Intergenic
972737919 4:41863888-41863910 GCATTGGGAGGAAACAGGGAGGG - Intergenic
973634125 4:52846255-52846277 TCATGGGGAGGAAGAAGGTGGGG - Intergenic
974075779 4:57166979-57167001 ACATGGGCAGGAAGTAGGCATGG + Intergenic
974472755 4:62339260-62339282 TCTTTGGTAGGAAGTATTCAAGG - Intergenic
984809198 4:183779338-183779360 TCATTGGAAGAAATTGGGCAAGG - Intergenic
985178988 4:187236065-187236087 TGATTTGGAGGAAGTATGTAGGG + Intergenic
985262256 4:188125975-188125997 TATTTGGGAGAAAATAGGCAGGG - Intergenic
985721967 5:1494180-1494202 TCTTTGGGAGCAGGTCGGCAGGG - Intronic
985908876 5:2863828-2863850 TCTTGGGGAAGATGTAGGCAAGG - Intergenic
986618837 5:9648826-9648848 TCATGAAGAGGAAGAAGGCAGGG + Intronic
987232072 5:15905208-15905230 TCATTTGAAGGAAGCAAGCATGG - Intronic
987417148 5:17674255-17674277 TCATGTGGAGGAAGGAGGAAGGG + Intergenic
987829103 5:23073431-23073453 TCACTGTGAGGAAGGAGGGAAGG + Intergenic
988316084 5:29630301-29630323 TTATTAGGAGGCAGTAGACAAGG - Intergenic
989281798 5:39652863-39652885 TAATTAGCAGGAGGTAGGCAGGG - Intergenic
994194197 5:96903899-96903921 TGCTTGGGAGAAAGTAGGCCTGG - Intronic
997364231 5:133315466-133315488 TCATTGGGAAGAAGTGGGGTGGG - Intronic
997411984 5:133697415-133697437 TCATTGGGAAGAGGTCAGCATGG - Intergenic
999046363 5:148474075-148474097 TCAGTGGAAGGAACTAGGAAAGG - Intronic
999245981 5:150155035-150155057 GAATTGGGAGAAGGTAGGCAGGG - Intronic
1000044104 5:157507411-157507433 TCCTTGGAAGGAAATGGGCAGGG + Intronic
1001160847 5:169311392-169311414 TCAGAGGGAGGAGGTGGGCAAGG - Intergenic
1001706219 5:173743095-173743117 TCATTGGGTGGGACTAGGGAGGG - Intergenic
1001796826 5:174509477-174509499 GCAGTGGGATGAAGTAGGAAGGG - Intergenic
1002597675 5:180334844-180334866 GCAGTGGGATGCAGTAGGCATGG - Intronic
1007301783 6:40873184-40873206 TAAGTGGGAGGAAGGAGGCTGGG - Intergenic
1007626475 6:43249260-43249282 TCCTTGGGAGGAAGGAGACCTGG - Intronic
1008269060 6:49468107-49468129 GGATTGGGAGGGACTAGGCAGGG + Intronic
1008296688 6:49786794-49786816 TCATGTGGAGGAAGAAGGGAAGG - Exonic
1009373056 6:62932218-62932240 GGATTGGGAAGAAGTGGGCATGG - Intergenic
1010126112 6:72433740-72433762 TCACTGGGAGGTAGGAGACAAGG + Intergenic
1011368314 6:86605045-86605067 TCATTTGGAGGAAAGAGGTAAGG - Intergenic
1012347201 6:98204713-98204735 TCAATGTGAGGAATTAGGCTAGG - Intergenic
1013424654 6:109999775-109999797 TCAGTGGGAAGAAGTCAGCAGGG - Intergenic
1013455220 6:110323873-110323895 ATATGGTGAGGAAGTAGGCAGGG + Intronic
1015585531 6:134772498-134772520 CCATTGTAAGGAAGTACGCATGG + Intergenic
1015984245 6:138869804-138869826 TCAGGGGGAGGAAGAAGGCCTGG - Intronic
1018199086 6:161378849-161378871 TCAAGGGGTGGAAGTAGGGACGG + Intronic
1018229690 6:161663776-161663798 TCATAGGAAAGAAGGAGGCAAGG - Intronic
1018354552 6:162999228-162999250 TTATTGGTAGGAAGCAGTCAGGG + Intronic
1020243727 7:6414661-6414683 TCATTGGAAAGAGGTAGGAAAGG - Intronic
1020365536 7:7377315-7377337 TCATTGGCACCAAGTAGCCAAGG - Intronic
1022194938 7:28055535-28055557 TCATTTGGAGGAAGCTGGAAAGG - Intronic
1022512289 7:30946632-30946654 TCTTTGGAAGGAAGTTGGTAAGG + Intronic
1023865086 7:44234682-44234704 GCATGGGGAGGAAGAAGGTATGG + Intronic
1024885804 7:54140723-54140745 TCATATGGAGGAAGTAGTGAAGG - Intergenic
1028210566 7:88069188-88069210 ACATAGGGAGGAAGGAGACAGGG - Intronic
1028917362 7:96274144-96274166 TGACTGGGAGGGAGCAGGCAGGG - Intronic
1029888316 7:103897924-103897946 CAATAGGGAGGAAGTAGGCTAGG - Intronic
1030274356 7:107703873-107703895 TCATTGGGAGAAACTGGGTAAGG - Intronic
1032924989 7:136594008-136594030 TCGTATGGAGGAAGAAGGCATGG - Intergenic
1034080685 7:148275300-148275322 TCTTTGGGAGCAAGTAGGGAGGG + Intronic
1035222897 7:157417053-157417075 TCACTGGGAGGGAGCATGCAGGG - Exonic
1037963802 8:23118063-23118085 TCATTGGGAGGAGGTGGGGACGG + Intergenic
1039272773 8:35900887-35900909 TCATTGGAAGGAAGGAAGAAAGG - Intergenic
1039588431 8:38727048-38727070 TGATTGGGTGGAAGTACACAGGG - Intergenic
1039740741 8:40380390-40380412 TAAATGGAAGGAAGTAGCCAGGG - Intergenic
1039905530 8:41783548-41783570 TCATTGGATGGACGTAGGCAGGG - Intronic
1040517544 8:48147005-48147027 TCATGGGGAGGGAGTAGAAAAGG + Intergenic
1042405674 8:68402981-68403003 TCACTGGGAAGCAGCAGGCAGGG + Intronic
1043596326 8:81890211-81890233 ACATTGAGAGGCAGTAGGAAGGG - Intergenic
1044006832 8:86947883-86947905 TGGTTGGGAGGAGGTAGGGATGG - Intronic
1047910228 8:129519331-129519353 TCTTTGGGAGAAAGTAAGGAAGG + Intergenic
1048834896 8:138509841-138509863 TCATACGGAGGAGGGAGGCAAGG + Intergenic
1048841690 8:138572356-138572378 TCATATGGAGGAGGGAGGCAAGG + Intergenic
1048940905 8:139399918-139399940 TCAATGGGAGGAGTTACGCAAGG - Intergenic
1049183080 8:141233243-141233265 TCAGTGTGTGGCAGTAGGCAGGG - Intronic
1050911969 9:11082676-11082698 GCATTGTGAGGATGAAGGCAGGG + Intergenic
1052379856 9:27758288-27758310 TCCTTGGGAGAAAGCAAGCATGG + Intergenic
1056736428 9:89213964-89213986 ACAGTGGAAGGAAGTAGGCGTGG + Intergenic
1059188963 9:112305504-112305526 TCAGTGTGTGGCAGTAGGCAAGG - Intronic
1059484805 9:114618337-114618359 TCATCAGGAGAAAGGAGGCAAGG - Intronic
1059487219 9:114636036-114636058 TCAGTGGGAGGAAGGAGGTCTGG + Intronic
1059711452 9:116871459-116871481 TCATTGGGAGGAAGTAGGCAGGG - Intronic
1060925446 9:127452226-127452248 TGGTTGGGAGGAAGTGGGGAGGG + Intronic
1061911558 9:133727873-133727895 GCCTTGGGAGGAATTAGGGATGG + Intronic
1062123428 9:134846636-134846658 CCAGTGGGAGGAGGAAGGCAAGG - Intergenic
1186149056 X:6655085-6655107 TCATGGGCAGGAAGTAATCATGG + Intergenic
1187522084 X:20022617-20022639 CCATTGGGAAGAAGAAGGAAAGG + Intronic
1188137874 X:26512184-26512206 TCAGGGGGAGAAAGTAGGAAGGG - Intergenic
1189274108 X:39772415-39772437 TGGTTGGGAGGAAGCAGCCAGGG - Intergenic
1189866020 X:45328004-45328026 TCAATGGGAGGAAGGAAGGATGG - Intergenic
1193149913 X:78114115-78114137 TCATGTGGAGGAAGAAGGGAAGG + Exonic
1193471692 X:81911894-81911916 TCATTTGGAGGAAGAGGGCATGG - Intergenic
1195130579 X:101847074-101847096 TCCTTGGAATCAAGTAGGCATGG + Intronic
1195152369 X:102084992-102085014 TAATTGAGAGGAACTAGGCTAGG + Intergenic
1197157871 X:123289843-123289865 TCACTGGGTGGAATTTGGCAGGG - Intronic
1199918017 X:152365350-152365372 TCAGTGTCAGGAAGTAGGCTTGG - Intronic
1201144694 Y:11057846-11057868 TCTTGGGGAGGTAGAAGGCATGG - Intergenic