ID: 1059711457

View in Genome Browser
Species Human (GRCh38)
Location 9:116871472-116871494
Sequence CTCCCAATGACCCTTGTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059711449_1059711457 9 Left 1059711449 9:116871440-116871462 CCCTGCCTCTATCATAAGTCCCT 0: 1
1: 0
2: 1
3: 8
4: 149
Right 1059711457 9:116871472-116871494 CTCCCAATGACCCTTGTGTTGGG No data
1059711452_1059711457 -10 Left 1059711452 9:116871459-116871481 CCCTGCCTACTTCCTCCCAATGA 0: 1
1: 0
2: 1
3: 21
4: 245
Right 1059711457 9:116871472-116871494 CTCCCAATGACCCTTGTGTTGGG No data
1059711450_1059711457 8 Left 1059711450 9:116871441-116871463 CCTGCCTCTATCATAAGTCCCTG 0: 1
1: 0
2: 1
3: 15
4: 126
Right 1059711457 9:116871472-116871494 CTCCCAATGACCCTTGTGTTGGG No data
1059711447_1059711457 21 Left 1059711447 9:116871428-116871450 CCCAAAGAGAAACCCTGCCTCTA 0: 1
1: 1
2: 5
3: 79
4: 504
Right 1059711457 9:116871472-116871494 CTCCCAATGACCCTTGTGTTGGG No data
1059711448_1059711457 20 Left 1059711448 9:116871429-116871451 CCAAAGAGAAACCCTGCCTCTAT 0: 1
1: 0
2: 1
3: 63
4: 583
Right 1059711457 9:116871472-116871494 CTCCCAATGACCCTTGTGTTGGG No data
1059711451_1059711457 4 Left 1059711451 9:116871445-116871467 CCTCTATCATAAGTCCCTGCCTA 0: 1
1: 0
2: 0
3: 10
4: 88
Right 1059711457 9:116871472-116871494 CTCCCAATGACCCTTGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059711457 Original CRISPR CTCCCAATGACCCTTGTGTT GGG Intronic
No off target data available for this crispr