ID: 1059714471

View in Genome Browser
Species Human (GRCh38)
Location 9:116900777-116900799
Sequence GAGAACCAAACGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 173}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059714471_1059714478 0 Left 1059714471 9:116900777-116900799 CCCTCCACCTTCGTTTGGTTCTC 0: 1
1: 0
2: 1
3: 20
4: 173
Right 1059714478 9:116900800-116900822 AGGCTCCACAGGAAATAAGTGGG No data
1059714471_1059714477 -1 Left 1059714471 9:116900777-116900799 CCCTCCACCTTCGTTTGGTTCTC 0: 1
1: 0
2: 1
3: 20
4: 173
Right 1059714477 9:116900799-116900821 CAGGCTCCACAGGAAATAAGTGG No data
1059714471_1059714479 3 Left 1059714471 9:116900777-116900799 CCCTCCACCTTCGTTTGGTTCTC 0: 1
1: 0
2: 1
3: 20
4: 173
Right 1059714479 9:116900803-116900825 CTCCACAGGAAATAAGTGGGAGG No data
1059714471_1059714482 5 Left 1059714471 9:116900777-116900799 CCCTCCACCTTCGTTTGGTTCTC 0: 1
1: 0
2: 1
3: 20
4: 173
Right 1059714482 9:116900805-116900827 CCACAGGAAATAAGTGGGAGGGG No data
1059714471_1059714480 4 Left 1059714471 9:116900777-116900799 CCCTCCACCTTCGTTTGGTTCTC 0: 1
1: 0
2: 1
3: 20
4: 173
Right 1059714480 9:116900804-116900826 TCCACAGGAAATAAGTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059714471 Original CRISPR GAGAACCAAACGAAGGTGGA GGG (reversed) Intronic
901017577 1:6240902-6240924 GAAAACCAAATGAGGGGGGAAGG + Intergenic
904296254 1:29521511-29521533 GGGCACCAAAGGAGGGTGGAGGG - Intergenic
904410076 1:30319935-30319957 GGGCACCAAAGGAGGGTGGAGGG + Intergenic
908383637 1:63619831-63619853 GAGATAGAAACAAAGGTGGATGG - Intronic
910036255 1:82792544-82792566 GAGCACCAAGGGAAAGTGGATGG - Intergenic
910331966 1:86083739-86083761 GAGAAGCAAGCCAAGGTGAAGGG + Intronic
913079655 1:115370768-115370790 GAGAACCAAAGGAAGGGGATTGG - Intergenic
916568136 1:166000329-166000351 GAGAACCAATCAAAGGCAGAGGG + Intergenic
920967283 1:210711621-210711643 GACACCCAAACCAAGGTGAAGGG - Intronic
921168850 1:212527647-212527669 GAAAACCAAAAAAGGGTGGAGGG + Intergenic
921231703 1:213079814-213079836 TAGAAGCAAAAGTAGGTGGAGGG - Intronic
921249547 1:213283568-213283590 GAGCAGCAACTGAAGGTGGAAGG + Intergenic
923859446 1:237878324-237878346 GAGAACCTAAGGAAGCTGGCAGG - Exonic
924476884 1:244390301-244390323 TAGAACCAAAAGATGGAGGAAGG - Intergenic
1063776324 10:9269158-9269180 GAGGACTACTCGAAGGTGGAGGG + Intergenic
1066688559 10:38004156-38004178 GAGAACTAAAAGAAGCTGAAGGG - Intergenic
1067004082 10:42644829-42644851 GAGAGCTAAAAGAAGCTGGAGGG + Intergenic
1071252079 10:83829058-83829080 GAGAACCAATGGAATGTGTATGG - Intergenic
1071280766 10:84100624-84100646 GAGAACCAAACAAGGGTGAAAGG + Intergenic
1071387303 10:85134318-85134340 GTGAACAAAACAAAGGTGCAAGG - Intergenic
1074194164 10:111166006-111166028 AAGAAACAAGCAAAGGTGGAAGG - Intergenic
1074425492 10:113347662-113347684 GAGAGCCAAACGGAGCTGAAGGG - Intergenic
1074702722 10:116106628-116106650 CAGAACCAAGAGAAAGTGGAGGG - Intronic
1078478427 11:11655008-11655030 GAGGACCACAAGAAGGAGGAGGG + Intergenic
1078776484 11:14398649-14398671 GAAAACCAAACGAGGGCAGAGGG - Intergenic
1079397956 11:20082297-20082319 GAGAAGCACAGGAAGGTGGGAGG + Intronic
1080894730 11:36439730-36439752 GAGAACAAAAAGGAGGAGGAAGG - Intronic
1081051621 11:38349227-38349249 GAGGACCGAACGAAGAGGGAAGG + Intergenic
1083609363 11:63997850-63997872 CAGAACCCAACGAAGCAGGAGGG - Exonic
1084351403 11:68602534-68602556 GGGAACCAAAAGGATGTGGAGGG + Intronic
1089858844 11:121571233-121571255 GTGAACCAAGCAGAGGTGGAGGG + Intronic
1091639618 12:2225826-2225848 GAGATCCAAACCAAGCTGGATGG + Intronic
1091853533 12:3720369-3720391 GAGAAACGAAGGAAGGGGGAGGG + Intronic
1094140212 12:27172994-27173016 AAGAACAAAAAGAAGGTTGAAGG - Intergenic
1094831913 12:34304203-34304225 GAGGTAGAAACGAAGGTGGAAGG + Intergenic
1096079040 12:48821785-48821807 GAGAACAAAATGAGGCTGGATGG - Intronic
1098158672 12:67626131-67626153 GAGAACAAAAGGGAGGAGGAAGG + Intergenic
1098790702 12:74817804-74817826 ATGAACCAAACTCAGGTGGAAGG + Intergenic
1103175439 12:118859400-118859422 GAGAAACAAACAAAGGTGGGAGG - Intergenic
1103340284 12:120217226-120217248 AAGAACCAAGCGGAGGTGGGTGG + Intronic
1104328282 12:127820482-127820504 GAGCAGCAAGCGAAGGTGGATGG + Intergenic
1106783549 13:33085205-33085227 GAGAAAGAAAGGAAGGAGGAAGG + Intergenic
1107827500 13:44342030-44342052 GAGAACAAAAAGCAGGAGGAAGG + Intergenic
1111139095 13:84090925-84090947 GAGAACCGAGCTAAGGGGGAAGG + Intergenic
1111934093 13:94541842-94541864 GAGAACCACACAAACGTGGAGGG + Intergenic
1114189844 14:20432202-20432224 GAGAATCACATGAAGCTGGAGGG - Intronic
1114435732 14:22706246-22706268 GAGAACCAAGAGGAAGTGGAAGG - Intergenic
1115379634 14:32721594-32721616 GAGAACCAAAAGAAAGGGCAGGG - Intronic
1115746341 14:36441482-36441504 GGGAAGCAAAGGAAGGAGGAAGG + Intergenic
1116954330 14:50908488-50908510 GAGAACCATAAGAAGGTTGAGGG - Intronic
1117129083 14:52666632-52666654 GAGAAACAAAGGAAGGAGGCCGG + Intronic
1119147200 14:72328129-72328151 TAGAACAAAAAGAAGGAGGAGGG - Intronic
1119371284 14:74146322-74146344 GAGAACTAAAGGAATTTGGAAGG - Intronic
1121556546 14:94842110-94842132 TAGAACCAATAGGAGGTGGATGG - Intergenic
1124555258 15:30719397-30719419 GAGAACCAAATGGAGGTGGCTGG + Intronic
1124675997 15:31686284-31686306 GAGAACCAAATGGAGGTGGCTGG - Intronic
1133702364 16:8320836-8320858 TAGAACAAAAAGATGGTGGAAGG + Intergenic
1135172614 16:20200003-20200025 GAGAAAGAAACGAAGGAGGGAGG + Intergenic
1137548590 16:49421266-49421288 GAAAACTAAAGCAAGGTGGAGGG + Intergenic
1137924646 16:52528656-52528678 CAGAACCAACCTAAGGGGGAAGG + Intronic
1139320408 16:66109700-66109722 GAGAAAGAAAGGAAGGGGGAAGG + Intergenic
1140862034 16:79026328-79026350 GATAACCTAATGAAGGTGAAGGG - Intronic
1142930129 17:3277260-3277282 GAGAAGAAAATGAAGGTGAAAGG + Intergenic
1143685650 17:8513572-8513594 GAGAAGCAGACGAAGGTGGAAGG - Exonic
1144022008 17:11245826-11245848 GAGAACCAACCCAAGATGAAGGG - Intronic
1145246573 17:21273568-21273590 GAGAACCAGATGAAGCTGCATGG - Intergenic
1146449305 17:32959861-32959883 GAGAACCAATTGAACTTGGAAGG - Intergenic
1147644475 17:42025651-42025673 GAGAACCAGAAAAAGGGGGAGGG - Intronic
1147699258 17:42381989-42382011 GAGAACTAAACCAAGGGGAAAGG - Intronic
1148290893 17:46448210-46448232 AAGAAGCAAAGGATGGTGGATGG + Intergenic
1148313083 17:46665915-46665937 AAGAAGCAAAGGATGGTGGATGG + Intronic
1149768533 17:59300893-59300915 GAGAAGGAAACGAAGGAGGGAGG - Intergenic
1151384034 17:73744304-73744326 CAGAACCAAACCCAGGTGGAGGG - Intergenic
1152282955 17:79396161-79396183 GGTAACCAAAAGAAGGTGGGAGG - Intronic
1152424384 17:80210981-80211003 GAGAACCAATCCAAGATGGTGGG + Exonic
1161789256 19:6349235-6349257 GAGAAGCAGAGGCAGGTGGATGG + Intergenic
1167940084 19:52939741-52939763 GAGAATCACTTGAAGGTGGAAGG - Intronic
1168648511 19:58077374-58077396 GAAAACCACCTGAAGGTGGAGGG + Intronic
926281476 2:11451216-11451238 CAGTACCAAACCAAGGTTGATGG - Intronic
927295834 2:21452202-21452224 GAGAAACAAACGATGGTGGGAGG - Intergenic
928107424 2:28479978-28480000 GAGAAGCAACCAAAGGTGGGAGG + Intronic
929018004 2:37520567-37520589 GAGAACCAGAGGAAGGGTGATGG - Intergenic
929287768 2:40155059-40155081 GACAACCAAAAAAAGGAGGAGGG - Intronic
931221306 2:60290617-60290639 GGGAACTAAAGGAAGGTGGGTGG + Intergenic
931243940 2:60477439-60477461 GAAAACCAAACATGGGTGGAGGG + Intronic
936600193 2:113888513-113888535 GAGAATGAGAGGAAGGTGGAAGG - Intergenic
941219600 2:162759629-162759651 GAGGACCAAATGAAGGAGAAAGG + Intronic
947088938 2:226488422-226488444 GTGAATCCAAGGAAGGTGGAAGG - Intergenic
1172953854 20:38741143-38741165 GAGAACCAAAAGAAGGTTTCGGG - Intergenic
1173444087 20:43102527-43102549 GAGCACCAAAGGGAGGTGGGCGG - Intronic
1173842431 20:46166597-46166619 GAGCACCAGAGGCAGGTGGAGGG - Intergenic
1174116470 20:48229843-48229865 GAGAACCAGAACAAGGTGGGTGG - Intergenic
1174373497 20:50110329-50110351 CAGAACCAAAGGAAGTGGGAAGG + Intronic
1174719646 20:52798233-52798255 GAGGACCAAGTGAAGGTGGTGGG - Intergenic
1178016106 21:28347533-28347555 GAGAAAGAAAGGAAGGAGGAAGG - Intergenic
1180186164 21:46140413-46140435 GTGAGCCACGCGAAGGTGGACGG - Intronic
1182680717 22:32077359-32077381 GAGAACGAAAGGAAGGAAGAAGG - Intronic
1183587630 22:38762282-38762304 GAGAATCAAACAGAGGAGGATGG - Intronic
951379865 3:21969640-21969662 GAGAAGGAAACGAAGCTGGCTGG + Intronic
952079550 3:29741484-29741506 AAGAACCAAAGGAATGTGTATGG - Intronic
952441824 3:33338320-33338342 GAGAACCACTTGAAGGTGGGAGG + Intronic
952759503 3:36901656-36901678 CTGAACCAAAAGAAGGTAGAGGG + Intronic
953210449 3:40870485-40870507 GAGAAGCAAAGGGAGTTGGAGGG + Intergenic
954315081 3:49796756-49796778 CAGAACCAAGCTAAGGTGGGAGG + Intronic
956738701 3:72258641-72258663 CAGACCCAAAGGAAGGAGGAGGG + Intergenic
958161265 3:89818888-89818910 AAGAAGCAAAAGAAGGTTGAAGG - Intergenic
961921165 3:130428045-130428067 GAAGACCAAAGGTAGGTGGAAGG + Intronic
963622240 3:147624978-147625000 TATAACAAAATGAAGGTGGAAGG - Intergenic
964072814 3:152655349-152655371 CAGAACCAAAAGAAGTTAGATGG + Intergenic
973906254 4:55534543-55534565 GAAAACCAAATCAAGGTGTAGGG - Intronic
974019531 4:56680412-56680434 GAGAACAAAACGAAGGTGCTGGG - Intronic
974620782 4:64350804-64350826 CAGAACCAAAAGAATGTGGAGGG - Intronic
977319048 4:95488038-95488060 GTTAACCAAAGGAAGGTGAAAGG - Intronic
977499181 4:97816840-97816862 GAGAAAGAAAGGAAGGAGGAAGG - Intronic
977803144 4:101262920-101262942 GAAAAACAAAGGAAGGAGGAAGG + Intronic
978260952 4:106758054-106758076 GAAAACCAAATGACAGTGGAGGG + Intergenic
981549077 4:145924602-145924624 AAAAACCAAACTCAGGTGGATGG - Intronic
983625274 4:169796022-169796044 AAAAACAAAACAAAGGTGGATGG - Intergenic
983921808 4:173354208-173354230 GACAACAAAAAGGAGGTGGATGG + Intergenic
985881159 5:2640229-2640251 AGGAAGCAAACAAAGGTGGAAGG + Intergenic
986199174 5:5565820-5565842 GAGAACCAAACAAAAGCAGATGG - Intergenic
987101805 5:14597745-14597767 GAGAACCATCTGGAGGTGGATGG - Intronic
987521787 5:18994800-18994822 AGGAAGCAAAAGAAGGTGGAAGG - Intergenic
989706650 5:44340868-44340890 AAGAATCAATCCAAGGTGGAAGG + Intronic
991576973 5:68114650-68114672 GATAAACAAGGGAAGGTGGAAGG + Intergenic
991718846 5:69477063-69477085 GAGAATAAAACCTAGGTGGAGGG - Intergenic
998985921 5:147756639-147756661 GAGAAGAAAAGGAGGGTGGATGG + Intronic
999497919 5:152118343-152118365 GATAAGCAAACCAAGGTTGAAGG - Intergenic
999841350 5:155430959-155430981 CAGAACAAAACGATGGTGGAAGG + Intergenic
999894483 5:156015164-156015186 GAGAACCTAATGAATGTGGAAGG - Intronic
999943196 5:156567263-156567285 GAGAACCAATAGAGTGTGGAGGG + Intronic
1001024018 5:168207821-168207843 GAGAGACAAAGGAAGGAGGAAGG - Intronic
1002474060 5:179453922-179453944 TAGAACCAAGCCAAGTTGGAGGG - Intergenic
1003520925 6:6857528-6857550 CAGAACCACCCGGAGGTGGAAGG + Intergenic
1004647484 6:17576277-17576299 GAGAGGCCAACGCAGGTGGATGG - Intergenic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1007698226 6:43747271-43747293 CAGAACAAAAGGAAGATGGAGGG + Intergenic
1007871263 6:45041682-45041704 AAGAAGAAAAAGAAGGTGGAAGG - Intronic
1008302984 6:49865561-49865583 GAAAACAAAAGGAAGGTGGTTGG + Intronic
1008410889 6:51178255-51178277 AAGAAGCAAAGGAGGGTGGAAGG - Intergenic
1010466629 6:76174847-76174869 GAGAACCAAAAGAAGGCAGATGG + Intergenic
1010664105 6:78606934-78606956 GAGAACCAAAAAAGGATGGATGG + Intergenic
1013232313 6:108169365-108169387 GAGAACCCGATGAGGGTGGAGGG - Intronic
1015318322 6:131842714-131842736 GAGAAACAAAGGAAGTTGGCCGG - Intronic
1018264582 6:162008876-162008898 GAGAACCAAAGGAATCTGGCTGG + Intronic
1020662844 7:11002840-11002862 GAGCACCAATAGAAGGTTGAGGG + Intronic
1023578115 7:41651887-41651909 GAGAGCAAAATGAAGGTGGTGGG - Intergenic
1023903334 7:44502154-44502176 GAGATCCAAAGGAAGAGGGATGG + Intergenic
1024287557 7:47772543-47772565 GGGAACCAACCCAAGGGGGAAGG - Intronic
1026332681 7:69366428-69366450 GAGAACAAATTGAAGGTTGATGG + Intergenic
1026600522 7:71773759-71773781 GAGAACCAGGGGAAGGAGGATGG + Intergenic
1026638776 7:72106565-72106587 GAGAAAAAGAGGAAGGTGGAAGG + Intronic
1027717086 7:81686235-81686257 GAGAGCCAAGCAAAGGGGGAAGG + Intergenic
1028285189 7:88987969-88987991 GAGAAGAAAAGGAAGGAGGAGGG - Intronic
1032657601 7:133948392-133948414 GAAATCCAAAAGAAGATGGAGGG + Intronic
1032797420 7:135288960-135288982 GAGATCCAAACCCAGGAGGAAGG + Intergenic
1033454753 7:141492670-141492692 AAAAATGAAACGAAGGTGGAAGG - Intergenic
1033733233 7:144198059-144198081 GAGAACCAACTGAAGCTGGAGGG - Intergenic
1033749817 7:144352928-144352950 GAGAACCAACTGAAGCTGGAGGG + Intergenic
1035828456 8:2669128-2669150 GAGAGCCAAACAGAGGTAGAAGG + Intergenic
1036584780 8:10113355-10113377 GAGATCTAAAAGAAGGGGGAAGG + Intronic
1037209836 8:16373362-16373384 GAGAAAGAAAAGAAGGAGGATGG - Intronic
1037415012 8:18640518-18640540 GAGAGCCAAGTGAAGGTGAAGGG - Intronic
1039727731 8:40238105-40238127 GAGAAAGAAAGGAAGGTGGAGGG - Intergenic
1040383973 8:46900772-46900794 GAGACCCAGAGGAAGGTGGTGGG + Intergenic
1040611511 8:48988161-48988183 GAGAAGGAAAAGAAGTTGGAAGG - Intergenic
1043295665 8:78659622-78659644 GAGAACAAAAAGAAGGAGAATGG + Intergenic
1043374820 8:79636530-79636552 GAAAAACAAAGGAAGGTCGAAGG - Intronic
1044234097 8:89809993-89810015 GAGTATCAAGCGAAGGGGGAAGG - Intergenic
1048427269 8:134334320-134334342 GAGAGCCAAACAAAGGTTTAGGG + Intergenic
1048502611 8:134992495-134992517 GAGATCCACACGAAGGTGCATGG - Intergenic
1048532943 8:135266774-135266796 GAGAACCACAAGAAGGGGCATGG - Intergenic
1050304438 9:4294049-4294071 GAGAACAAAATAAAGGAGGAGGG - Intronic
1050748471 9:8906686-8906708 GACAAGCAGAGGAAGGTGGAAGG - Intronic
1053532038 9:38892026-38892048 GAGAACAAAAAGATGGAGGAAGG + Intergenic
1054204263 9:62116435-62116457 GAGAACAAAAAGATGGAGGAAGG + Intergenic
1054634100 9:67471929-67471951 GAGAACAAAAAGATGGAGGAAGG - Intergenic
1059337890 9:113580642-113580664 GAGAAACTAACCAAGATGGAAGG - Intronic
1059365626 9:113784489-113784511 GAGCACCAAACAAAGGGGAAGGG + Intergenic
1059714471 9:116900777-116900799 GAGAACCAAACGAAGGTGGAGGG - Intronic
1187245767 X:17551692-17551714 GAGAATCAAATGAAGGAGGGTGG + Intronic
1188179075 X:27031691-27031713 GAGGCCCAAAGGAAGATGGAAGG - Intergenic
1189751961 X:44231455-44231477 GAGAGCGAAAGGAAGGAGGAGGG - Intronic
1195890874 X:109693625-109693647 GATAAACAAATGAATGTGGAGGG - Intronic
1196835558 X:119810763-119810785 GGAAACCAAAAGAAGTTGGAAGG - Intergenic
1197048497 X:122029372-122029394 GAGAGCAACAGGAAGGTGGAGGG + Intergenic
1198068027 X:133119129-133119151 GAGTACCGAACAAAGTTGGAAGG - Intergenic
1198567691 X:137921647-137921669 GAGAACCAAGAAAAGGAGGAGGG + Intergenic
1199539955 X:148947720-148947742 GAGACAAAAACGAAGGAGGAAGG + Intronic
1200115170 X:153766805-153766827 GAGGACCAGAGGAAGGTGGAAGG - Intronic
1201702455 Y:16899335-16899357 GAGAAGAAAATGGAGGTGGAGGG - Intergenic
1202169301 Y:22024094-22024116 GAGAACCAGAGGAAGGAGGGAGG - Intergenic
1202222060 Y:22562271-22562293 GAGAACCAGAGGAAGGAGGGAGG + Intergenic
1202321055 Y:23633396-23633418 GAGAACCAGAGGAAGGAGGGAGG - Intergenic
1202549712 Y:26036660-26036682 GAGAACCAGAGGAAGGAGGGAGG + Intergenic