ID: 1059717909

View in Genome Browser
Species Human (GRCh38)
Location 9:116930849-116930871
Sequence CTCAGGAAGCAATCTAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059717909_1059717914 8 Left 1059717909 9:116930849-116930871 CCTCCATTAGATTGCTTCCTGAG 0: 1
1: 0
2: 0
3: 10
4: 135
Right 1059717914 9:116930880-116930902 ATTCTCCTTCACCAATGCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059717909 Original CRISPR CTCAGGAAGCAATCTAATGG AGG (reversed) Intronic
900196199 1:1376831-1376853 CTCAGGAAGTAATTTCAGGGAGG + Intergenic
906938623 1:50236228-50236250 CTCAAGAAGCAGTATAATGTGGG + Intergenic
909006892 1:70287315-70287337 CTCAGCAGGCAATACAATGGAGG + Intronic
909031097 1:70541600-70541622 CTCAGAATGCAAGCTAATAGTGG - Intergenic
910099360 1:83560061-83560083 CTCAGGAAGGATTCTAAATGGGG - Intergenic
910371470 1:86520727-86520749 CTTAGGCAGCACTCTGATGGTGG - Intergenic
911104822 1:94121353-94121375 CTCAGGAACCCCTCTCATGGAGG - Intergenic
912111094 1:106344637-106344659 GGCAGGAAGCACTCTAGTGGAGG - Intergenic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
917235584 1:172888554-172888576 CTCAGGATGCAAGCTACAGGTGG + Intergenic
917817760 1:178726736-178726758 AACAGGAATCGATCTAATGGTGG - Intronic
919063337 1:192662528-192662550 CTAAGGAGGCAAACTCATGGAGG + Intergenic
920817632 1:209349786-209349808 CTCAGCAATCAATTTAGTGGAGG - Intergenic
920975212 1:210779594-210779616 CTCAGCAATCAAACTACTGGAGG + Intronic
921757160 1:218871844-218871866 CTCAGGAAGTAATGTAGAGGAGG - Intergenic
922174001 1:223180751-223180773 CTCAGGAAACAAACTCATGCAGG - Intergenic
924843659 1:247743179-247743201 GTCAGGAAGCACTCCAGTGGAGG - Intergenic
1064884119 10:20090598-20090620 CTAAGGAATCACTCTACTGGAGG - Intronic
1069543881 10:69315685-69315707 CTCAGGAAGCTGTCTGATTGGGG + Intronic
1069720969 10:70549157-70549179 CTCAGGACCCAATCTAACTGTGG - Intronic
1070096778 10:73345163-73345185 CTCAGGGGGCAATCTACTGAAGG - Exonic
1074063376 10:109989318-109989340 GTCAGGAAGAAATCTCATGGAGG - Intergenic
1077736791 11:4800034-4800056 CTCAGGATGCAAGCTACTGTTGG + Intronic
1077765498 11:5155712-5155734 TTTAGGAAGCATACTAATGGTGG + Intronic
1084925491 11:72508149-72508171 GGCAGGAAGCACTCTAGTGGAGG - Intergenic
1085086539 11:73671662-73671684 CTCAGGGTGCAAGCTACTGGTGG + Intergenic
1085928857 11:81056384-81056406 CTCAGGAAGGAATCCATAGGAGG - Intergenic
1086109913 11:83188715-83188737 CCAAGTAAGCAACCTAATGGAGG + Intergenic
1086295967 11:85368916-85368938 GGCAGGAAGCACTCTAGTGGAGG + Intronic
1087172897 11:95068087-95068109 ATCAGGAAGCAACGTGATGGAGG + Exonic
1087965129 11:104403420-104403442 CTCTGGAAGCAGTCTCCTGGTGG + Intergenic
1096774083 12:53953854-53953876 CTCAGGAGGCAACCTACTGCGGG + Intergenic
1097812337 12:64032451-64032473 CCCACAAAGCAATCCAATGGTGG - Intronic
1100472780 12:94908596-94908618 CTCAGGAGGCATTTTGATGGTGG - Intronic
1102577584 12:113866091-113866113 CTTTGGAAGCCATTTAATGGAGG + Intronic
1103175000 12:118855313-118855335 ATCAGGAAGAAACCTAACGGAGG + Intergenic
1107102690 13:36611133-36611155 TTAGGGAAGGAATCTAATGGTGG + Intergenic
1108936745 13:55891250-55891272 CACAGGATGCAAGCTATTGGTGG + Intergenic
1108945020 13:56011492-56011514 CTCATGAGGCAATGTAATGAAGG + Intergenic
1109356282 13:61233108-61233130 CTGAGGATGCAGTCTGATGGTGG - Intergenic
1109426185 13:62168268-62168290 CACAGGATGGAAGCTAATGGGGG + Intergenic
1114259492 14:21026345-21026367 CTCAGGAACCAGTCTGAAGGGGG - Intronic
1114896020 14:26992382-26992404 CTCAGGAAGGAACCTAATCAGGG - Intergenic
1115183306 14:30655382-30655404 CCCAGGAAGCAATATAATACAGG + Intronic
1120038555 14:79726603-79726625 CCCAGTAAGCACTCTACTGGGGG - Intronic
1120771260 14:88382967-88382989 CTCAGGAAACACTATCATGGTGG - Intergenic
1121119112 14:91364743-91364765 CACAGGAAGCAAACTGAAGGTGG + Intronic
1124115768 15:26842187-26842209 CTCAGGATGCAGTCTGATTGGGG - Intronic
1129391735 15:75224181-75224203 GTCAGGAAGCAATCCAAAGTTGG - Intergenic
1129472572 15:75763678-75763700 GTCAGGAAGCAATCCAAAGTTGG + Intergenic
1132035084 15:98476099-98476121 CTCAGGAAAAAAAATAATGGTGG + Intronic
1133368868 16:5232979-5233001 CTCAGGCTGCAGTGTAATGGCGG + Intergenic
1142997388 17:3769007-3769029 CTAAGGAAGCAACCTAATTTGGG - Intronic
1146624347 17:34424450-34424472 CTCAGGAAACACTGTTATGGGGG - Intergenic
1149175696 17:53867732-53867754 CTCAGGATGCAAGCTGCTGGTGG + Intergenic
1153708608 18:7773905-7773927 CTCCAAAAGCAATCTAATGTTGG - Intronic
1159259750 18:65998382-65998404 CTCATGCCACAATCTAATGGGGG - Intergenic
1161204422 19:3033656-3033678 CTGAGCAAGCATTGTAATGGAGG - Intronic
1161523353 19:4738360-4738382 CTGTGGAAGCAATCCAACGGCGG + Intergenic
1163438683 19:17310531-17310553 CTCAGGATGCCAACTAATGGGGG - Intronic
1164489380 19:28692684-28692706 CTCAGGGTGCAAGCTGATGGTGG - Intergenic
1168486295 19:56765129-56765151 CTCAGAAAGCAATAAAACGGGGG - Intergenic
925482272 2:4288921-4288943 CTCAGGAAGCAGGATCATGGCGG + Intergenic
925718449 2:6806412-6806434 CTCAGAAATCAATCTAAAAGTGG - Intergenic
925801015 2:7600267-7600289 CTCAGCAAGCAATCTATGGCAGG + Intergenic
929663532 2:43814414-43814436 CTGAGGAAGCAATTTCTTGGAGG - Intronic
932747442 2:74345472-74345494 CTCAGGAATCCTCCTAATGGAGG + Intronic
934130469 2:88943436-88943458 CTCATGAACCAATGTTATGGAGG - Intergenic
934139996 2:89037027-89037049 CTCATGAACCAATGTTATGGAGG - Intergenic
934229244 2:90163524-90163546 CTCATGAACCAATGTTATGGAGG + Intergenic
935152189 2:100447894-100447916 CTCAGGGAGCAATCTGAGGCTGG - Intergenic
938705808 2:133924655-133924677 CTTAGAAAGCAATCAAATGAAGG - Intergenic
938771367 2:134504022-134504044 CTCAGGAGGCCACCAAATGGTGG - Intronic
940403525 2:153273672-153273694 CTCATGAAGGAATCACATGGAGG + Intergenic
947486542 2:230555184-230555206 AGCTGGAAGCAAACTAATGGAGG + Intergenic
947995396 2:234523116-234523138 CTCAGGAAACACAATAATGGCGG - Intergenic
1169580071 20:7011691-7011713 CTCAATAAGCTATCTAAAGGTGG - Intergenic
1170264173 20:14446475-14446497 CTCAAGAAGCAATATAATAAGGG - Intronic
1170406741 20:16045859-16045881 CTCAGGTAGCAGTGTAAAGGAGG - Intronic
1173007506 20:39151384-39151406 CTTTGGAAGCAGTGTAATGGGGG - Intergenic
1178634938 21:34294194-34294216 CTCAGGAGGCAATTTCATGCAGG + Intergenic
1182025077 22:27111463-27111485 CACAGGCAGCACTGTAATGGAGG + Intergenic
1182950560 22:34371442-34371464 CTCAGGAACCAGATTAATGGAGG - Intergenic
1183993843 22:41618478-41618500 ATCATGGAGCTATCTAATGGGGG - Intronic
950007880 3:9703193-9703215 CTCATGACGCAATCTACTGTAGG - Intergenic
953694023 3:45144045-45144067 CTTAGAAAGCAACCAAATGGAGG + Intronic
957282711 3:78174006-78174028 CTTATGAAGCAATCTTATGAAGG + Intergenic
960707233 3:120493025-120493047 CTAAAGAAGCAATCTCTTGGGGG + Intergenic
965946204 3:174244768-174244790 CTCACCAAGCATTTTAATGGGGG - Intronic
966375655 3:179292784-179292806 ATCAGGAGACAATTTAATGGGGG - Intergenic
966414635 3:179676170-179676192 CTCAGGAAACAAAATCATGGCGG - Intronic
968707547 4:2087393-2087415 CTCAGAAAGAAATCAGATGGTGG + Intronic
969133619 4:5011922-5011944 CTCAGGACTCAATCTTCTGGTGG - Intergenic
969439134 4:7207149-7207171 CTCAGGGGGCCTTCTAATGGAGG + Intronic
970025998 4:11624852-11624874 ATCAGGAGGCACTCTAGTGGAGG - Intergenic
972716154 4:41648402-41648424 CTCAGGAAGCACTTCCATGGAGG + Intronic
974653922 4:64793660-64793682 CCCAAGAAGATATCTAATGGTGG + Intergenic
976895246 4:90101581-90101603 ATAAAGAAGCAATTTAATGGTGG - Intergenic
978300020 4:107257546-107257568 CTAACGAAGCAATGTAAGGGTGG - Intronic
980686428 4:136236292-136236314 TTGAGGAAGGAACCTAATGGAGG + Intergenic
980997771 4:139797073-139797095 CTCAGTAAGCAATGTCATGTAGG - Intronic
989308194 5:39981532-39981554 CTCAGGATGCAAGCTGCTGGTGG - Intergenic
990518255 5:56551278-56551300 CTCTGGAATAAATCTAATTGAGG + Intronic
993069100 5:83135618-83135640 CACAGGAAGCAAAAAAATGGTGG - Intronic
993765929 5:91858549-91858571 CTCAAGAAGTAATCTAAGGAGGG - Intergenic
995189049 5:109301452-109301474 CTCAGGATCCTATTTAATGGTGG + Intergenic
996041624 5:118820296-118820318 CTGAAGAAGTAATCTAATGTTGG - Intergenic
997828430 5:137128424-137128446 CTCAGGGAACAATCAGATGGGGG - Intronic
1004729191 6:18341138-18341160 CTCAGGAAGAAACCTAAGGCAGG + Intergenic
1004910675 6:20279885-20279907 TTCAGGAAGGAAACTAATGCTGG + Intergenic
1005653373 6:27906484-27906506 CCCAGGAAGACATCTAATGAAGG + Intergenic
1005872709 6:29986940-29986962 CCCAGGAAGGAATCAAATGTGGG + Intergenic
1005879776 6:30047260-30047282 CTCAGGAAACACAATAATGGTGG + Intergenic
1006336581 6:33424217-33424239 ATCAGGAAGGAATATAAGGGAGG + Intronic
1007545975 6:42695002-42695024 CTCAGGATGGCATCAAATGGAGG - Intergenic
1011937635 6:92800782-92800804 GTCAGAAAGCAATGTGATGGTGG - Intergenic
1014588361 6:123229904-123229926 CTCAGCAAGCAATCTTATCTTGG + Intronic
1025077726 7:55957416-55957438 CTCAGGGATCAATCTAGTTGGGG + Intronic
1030059008 7:105608263-105608285 CTCAGGAAGGATTCTAGTGTTGG + Intronic
1038230928 8:25699234-25699256 CTCAGGACTCAATCTGATGGAGG - Intergenic
1039050319 8:33486590-33486612 CTAAGGTAGTAATTTAATGGTGG + Intronic
1046065622 8:109193720-109193742 CAAAGGAAGCACTCTAGTGGGGG - Intergenic
1046546700 8:115661626-115661648 CTCAGGAACCAAGATAGTGGTGG + Intronic
1047103209 8:121703828-121703850 CCCAGGAAGCATCCTACTGGGGG - Intergenic
1051917719 9:22228300-22228322 TTCAGGAAGCATTCTGTTGGTGG + Intergenic
1054989646 9:71308636-71308658 CTCAGCAAACAAAGTAATGGGGG + Intronic
1055928038 9:81530947-81530969 CTCAGGAAGTAAGCTAACTGAGG - Intergenic
1056436239 9:86578152-86578174 CTCAGGCAGCAACCTATTAGTGG - Intergenic
1057075280 9:92135272-92135294 CTCAGGAAGCATCCTGATGGGGG + Intergenic
1058303890 9:103412077-103412099 CTCAGGAAGCAAAATAATGTGGG + Intergenic
1059717909 9:116930849-116930871 CTCAGGAAGCAATCTAATGGAGG - Intronic
1061358695 9:130126297-130126319 CTCAGGAAGCAAACTAACTCTGG - Intronic
1203449686 Un_GL000219v1:100120-100142 CTCAGGAAGAAGCCTAATCGTGG + Intergenic
1188488365 X:30708317-30708339 CTGAGGAACCAATCTAATCAAGG - Intronic
1189094309 X:38121888-38121910 ATCTGGAAGGAATCCAATGGGGG + Intronic
1191866728 X:65709839-65709861 CCCAGGAAGGAAACTAAGGGGGG - Intronic
1192307412 X:69976728-69976750 CTTAGGAAGAAATTCAATGGAGG + Intronic
1193344236 X:80387213-80387235 ATCAGGAACCAATCCCATGGAGG - Intronic
1198144688 X:133843164-133843186 ATCAGGTTGCAATCTAATGTTGG - Intronic
1200972482 Y:9168146-9168168 CTCAGTAAGTAAAGTAATGGAGG - Intergenic
1201165131 Y:11201988-11202010 ATCTGGAAGGACTCTAATGGTGG - Intergenic
1202138538 Y:21696104-21696126 CTCAGTAAGTAAAGTAATGGAGG + Intergenic