ID: 1059725301

View in Genome Browser
Species Human (GRCh38)
Location 9:117002902-117002924
Sequence CTAGCCCTGAACAGATGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 115}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059725301_1059725313 23 Left 1059725301 9:117002902-117002924 CCCCTTCATCTGTTCAGGGCTAG 0: 1
1: 0
2: 0
3: 15
4: 115
Right 1059725313 9:117002948-117002970 CTGTAGGAGGAAAAGTGTTTGGG No data
1059725301_1059725308 7 Left 1059725301 9:117002902-117002924 CCCCTTCATCTGTTCAGGGCTAG 0: 1
1: 0
2: 0
3: 15
4: 115
Right 1059725308 9:117002932-117002954 GGTTCAGGAATGCCACCTGTAGG No data
1059725301_1059725312 22 Left 1059725301 9:117002902-117002924 CCCCTTCATCTGTTCAGGGCTAG 0: 1
1: 0
2: 0
3: 15
4: 115
Right 1059725312 9:117002947-117002969 CCTGTAGGAGGAAAAGTGTTTGG No data
1059725301_1059725307 -8 Left 1059725301 9:117002902-117002924 CCCCTTCATCTGTTCAGGGCTAG 0: 1
1: 0
2: 0
3: 15
4: 115
Right 1059725307 9:117002917-117002939 AGGGCTAGAGAGAGGGGTTCAGG No data
1059725301_1059725309 10 Left 1059725301 9:117002902-117002924 CCCCTTCATCTGTTCAGGGCTAG 0: 1
1: 0
2: 0
3: 15
4: 115
Right 1059725309 9:117002935-117002957 TCAGGAATGCCACCTGTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059725301 Original CRISPR CTAGCCCTGAACAGATGAAG GGG (reversed) Intronic
900908411 1:5576937-5576959 GTAGCCCTGTACAGGTGAGGGGG + Intergenic
907811582 1:57876198-57876220 CTTTCCCTGCACAGTTGAAGAGG - Intronic
908415696 1:63911348-63911370 CTAGCCCTGGACAGATGTTGAGG - Intronic
910452496 1:87361316-87361338 CAAGCCCTGAAGAGACAAAGAGG + Intergenic
910923802 1:92377613-92377635 CCAGCCCTGAACAGTTGAAATGG + Intronic
912307845 1:108589120-108589142 CTGGCCCTGAACAGGAGAAGAGG - Intronic
915101916 1:153507047-153507069 CTGGCCCTGAAGAGGGGAAGGGG + Intergenic
916893911 1:169141336-169141358 GTAGGCCTCAAAAGATGAAGTGG + Intronic
917345286 1:174022548-174022570 CACGCCCTGAGCAGATGAACCGG + Intergenic
917768525 1:178250115-178250137 CTAGCTCTGAAGAGAGCAAGGGG - Intronic
919858556 1:201722497-201722519 CAACCCATGAACAGATGAATGGG - Intronic
920635597 1:207699310-207699332 CAAATACTGAACAGATGAAGGGG - Intronic
922609623 1:226915740-226915762 CCAGACCTAAACAGATGAACTGG - Intronic
922630641 1:227106129-227106151 CTATCCCAGTACATATGAAGTGG + Intronic
922825688 1:228516632-228516654 CAGGCCCAGAACAGATGGAGGGG - Intergenic
1063582257 10:7318719-7318741 CTAGCCCAGAATAGAAGACGCGG - Intronic
1063916052 10:10883829-10883851 CTAGCATTGAACAGATGATGAGG + Intergenic
1064621994 10:17226856-17226878 CTATCCCTGAGATGATGAAGAGG + Intergenic
1065670704 10:28113656-28113678 CTAGCCCTGCTCTGATGCAGGGG - Intronic
1068870021 10:61933179-61933201 CTAAACTTGAACAGATGAAGAGG - Intronic
1069286737 10:66723986-66724008 ACAGGCCTGAACAGAGGAAGTGG + Intronic
1072160374 10:92760663-92760685 TTGGCCCAGAAGAGATGAAGAGG - Intergenic
1072859956 10:98993229-98993251 CTAGGCCTTAAAAAATGAAGAGG + Intronic
1075642394 10:124074189-124074211 CTGGCCCTGCAGAAATGAAGTGG - Intronic
1080560269 11:33456866-33456888 CCAGGCCTGAGCAGATGATGGGG - Intergenic
1083301308 11:61740869-61740891 CTGGCCCTTAACAGATGAATGGG + Intronic
1086577722 11:88359748-88359770 CTAACACTGAAAAGAGGAAGTGG + Intergenic
1091894771 12:4092311-4092333 CTAGCCCTTAACAAAGGAAGTGG + Intergenic
1093116866 12:15222077-15222099 CTAGCCTTTCACAGATGAGGAGG + Intronic
1094184479 12:27626392-27626414 CAAGCCCTGCCCAGATGAGGTGG - Intronic
1101937378 12:109069364-109069386 GCAGCCCTGTACAGATGAACAGG - Intronic
1106774824 13:32998810-32998832 CTACCCCTGAACAGCTGGATAGG - Intergenic
1107054590 13:36089346-36089368 CTAGGCCTGAACAGAAGCACAGG + Intronic
1111117584 13:83801027-83801049 TTAGCCCTTAACAGATACAGTGG + Intergenic
1111589343 13:90323464-90323486 CCAGCGCTGAACAGAAGAATTGG - Intergenic
1113248293 13:108423200-108423222 TAAAACCTGAACAGATGAAGGGG - Intergenic
1113659530 13:112096140-112096162 CTTTCCCTGGACAGAGGAAGGGG - Intergenic
1114802710 14:25796620-25796642 CTAGCCCTGAGGAAATGCAGGGG - Intergenic
1116386242 14:44334035-44334057 CTGCTCCTGAAAAGATGAAGTGG + Intergenic
1117355316 14:54918540-54918562 CTTGCCCTGGACAGGGGAAGAGG + Intergenic
1120728483 14:87974549-87974571 GTAGCCCTGAACAGTTCAAGTGG + Intronic
1123436521 15:20258554-20258576 CAAGCCTTGAAAAGATGCAGAGG + Intergenic
1125954007 15:43776956-43776978 CAAACCCTGAACAGAGGAGGTGG - Exonic
1127348405 15:58125360-58125382 CTAGCCATGAACAAATGAACTGG - Intronic
1132757884 16:1494742-1494764 GAACCCCTGAACAGAAGAAGCGG + Intronic
1133486913 16:6228379-6228401 GTGTCCCTGAACAGATGAAAAGG + Intronic
1135036942 16:19086449-19086471 CAAGCTCTGAACACATGAGGTGG - Intergenic
1136016430 16:27403872-27403894 ATAGTCCTCAACAGGTGAAGCGG + Intronic
1138384413 16:56626366-56626388 CTGGCCCTGCACAGAGGAGGGGG + Intronic
1138386070 16:56636339-56636361 CTGGCCCTGCACAGAGGAGGGGG + Intergenic
1138391114 16:56670406-56670428 CTGGCCCTGAACAGAGAAGGGGG + Intronic
1142190840 16:88716615-88716637 CCAGCCGTGCCCAGATGAAGCGG - Exonic
1144453237 17:15398488-15398510 GTGGCCCTGAATTGATGAAGAGG - Intergenic
1144582667 17:16468308-16468330 GTGGCCATGAACAGATGAATGGG + Intronic
1149493700 17:57103296-57103318 CTGCCCCTGAAGTGATGAAGTGG - Intronic
1157430425 18:47619982-47620004 CTAGCCATAAACAGCTGATGTGG + Intergenic
1159808802 18:72991195-72991217 CTATCCCTTATCAGAAGAAGAGG - Intergenic
1162898820 19:13781800-13781822 CCAGCCCTGAACAGAGGCCGGGG - Intergenic
1165032589 19:33008958-33008980 CAAGCCATGAAAAGATGCAGAGG + Intronic
1167758427 19:51427669-51427691 CTAGACCTGATTAGATGAAGTGG + Intergenic
1168350813 19:55674747-55674769 CGAGCCCAGAACCGAGGAAGAGG - Intergenic
932899293 2:75679758-75679780 CTGGCCCTGCAGAGATGAACCGG - Intronic
938601305 2:132843448-132843470 GAAGCCTTAAACAGATGAAGAGG - Intronic
940335067 2:152518115-152518137 CTTGCCCTGAACAGCACAAGAGG + Intronic
941171085 2:162138068-162138090 CTAGCATTCTACAGATGAAGAGG - Intergenic
944312120 2:198245060-198245082 TGAGCCCAGAACACATGAAGAGG - Intronic
945863757 2:215153707-215153729 CAAGCCATGAACAGATGACAAGG - Intergenic
948272629 2:236686294-236686316 CTCGCCCAGAACATAGGAAGAGG - Intergenic
1169289277 20:4334931-4334953 CTAGCCCTGAGCAGAGGAGGAGG + Intergenic
1170673177 20:18454033-18454055 GTAGCCCTCACCAGGTGAAGTGG + Intronic
1171564841 20:26172309-26172331 CTAGCCCTGGCCAGGTGCAGTGG + Intergenic
1172102904 20:32496240-32496262 CCAGCCCTGCAGAGATGAAGTGG - Intronic
1172409282 20:34709872-34709894 CTAGCCCTTAACAGGTAAACTGG - Intronic
1178067119 21:28917091-28917113 CCAGTGCTGAACAAATGAAGAGG + Intergenic
1182271767 22:29158319-29158341 ATAGCCCTGAAGACATCAAGGGG + Intronic
1184252230 22:43267370-43267392 CTATTTCGGAACAGATGAAGCGG + Intronic
1185361370 22:50409328-50409350 TTAGCCATGAACAGATGATGTGG - Intronic
951297401 3:20955414-20955436 TTTGCCCTGAACATATGAGGGGG + Intergenic
965041719 3:163517620-163517642 GTAGGCCTGAATATATGAAGTGG - Intergenic
965451029 3:168838458-168838480 TTAGCCCTGAACAGATGAGTGGG - Intergenic
968477620 4:819769-819791 CCACCACTAAACAGATGAAGGGG + Intronic
969176047 4:5399853-5399875 CTGGCCCTGAGCAGAGAAAGGGG - Intronic
970466086 4:16324312-16324334 CCAGCACAGACCAGATGAAGGGG - Intergenic
970563712 4:17309943-17309965 TTACCCCAGAATAGATGAAGAGG + Intergenic
971039782 4:22738847-22738869 CTAGCCCTGAACAGCAGGACAGG - Intergenic
971409889 4:26359487-26359509 CGAGCCCAGAACCGAGGAAGAGG - Intronic
977731879 4:100363521-100363543 CTAGAGCTGAATAGAGGAAGAGG - Intergenic
981229861 4:142340191-142340213 CTATCAATGAACAGATGGAGAGG - Intronic
981681745 4:147407467-147407489 CAAGCCCTTAACGGATGATGGGG - Intergenic
982846344 4:160257654-160257676 CTGTACCTGAATAGATGAAGAGG + Intergenic
982899908 4:160985720-160985742 TTTGCCCTGAACTGATGAACAGG + Intergenic
994297377 5:98106892-98106914 CAAGCTCTGCAAAGATGAAGAGG + Intergenic
995527225 5:113059738-113059760 CTGGCAATGAACAGATGCAGAGG - Intronic
997612862 5:135227389-135227411 CCAGCCCTGGGCAGCTGAAGAGG - Intronic
998171941 5:139877606-139877628 CTACCCTTGAACAGGTGAACAGG - Intronic
999386126 5:151155777-151155799 CTATCCCTGTAGAGAGGAAGGGG + Intronic
1004150921 6:13119531-13119553 CTAGCCCAGAATAGATGCTGGGG + Intronic
1008435469 6:51470770-51470792 CTAATCCTTAAAAGATGAAGAGG + Intergenic
1010041665 6:71391833-71391855 TTAGCCTAGAACAGAAGAAGAGG - Intergenic
1010744343 6:79543946-79543968 ATTGCCCTGCACAGTTGAAGTGG + Intergenic
1012808440 6:103926333-103926355 CTAGTCATTAACTGATGAAGTGG + Intergenic
1015510226 6:134031093-134031115 CCAGCCCTGAACAAGTGTAGTGG - Intronic
1017806894 6:157953855-157953877 CTAGCCCTTATTAGATGGAGTGG + Intergenic
1018681863 6:166271434-166271456 ATAGCCCTGACCAGTTGACGTGG + Intergenic
1021931383 7:25584652-25584674 TTAGCCTTGGCCAGATGAAGTGG - Intergenic
1022101442 7:27171745-27171767 CCAGCCCTGCACAGATGTAACGG + Exonic
1022860645 7:34363176-34363198 CTACCTCTGCACAGCTGAAGAGG + Intergenic
1022940455 7:35231902-35231924 CTAGGGCTGAACAGAGGAATGGG + Intronic
1023999675 7:45182254-45182276 CTAGCCCTGCACAGAGGGGGTGG + Intronic
1024483939 7:49894816-49894838 TTAGCGCTGAACAGATGATAAGG - Intronic
1024939998 7:54752591-54752613 CTGGACCTGAAAAGATGATGTGG + Intronic
1034880839 7:154761362-154761384 CAAGCCCTGGTCAGATGGAGAGG - Intronic
1036127024 8:6072176-6072198 CTACCTCTGACCAAATGAAGAGG - Intergenic
1036180351 8:6579188-6579210 CTCTCACTTAACAGATGAAGAGG - Intronic
1037475891 8:19257396-19257418 CAAGCCATGAAAAGATAAAGAGG + Intergenic
1037483691 8:19327950-19327972 CAAGCCCTGCTGAGATGAAGCGG - Intronic
1038000761 8:23389604-23389626 CTAGTCATGCACAGATAAAGGGG + Intronic
1040414299 8:47182969-47182991 CTAGCCCTGACAAGAAGTAGGGG + Intergenic
1045681457 8:104665245-104665267 CTATTCCTGTACAGATGCAGAGG - Intronic
1045920403 8:107522261-107522283 CTCTCCCTGAACAGATGAATAGG - Intergenic
1046989134 8:120429709-120429731 CTAGTCCTCCACAGATGGAGAGG - Intronic
1056263439 9:84872544-84872566 CTAGCCCTAGGCACATGAAGAGG - Intronic
1057251131 9:93503418-93503440 CAAGCCATGAAAAGATGCAGAGG + Intronic
1057271609 9:93654701-93654723 CTTGTCCTGAGCATATGAAGTGG + Intronic
1059725301 9:117002902-117002924 CTAGCCCTGAACAGATGAAGGGG - Intronic
1186307998 X:8285427-8285449 CTAGACCAGAACAAAGGAAGGGG + Intergenic
1193572383 X:83160524-83160546 TTTGCCCTGGACAGATGGAGAGG - Intergenic
1194800122 X:98262769-98262791 CAAGCCCTGAACACATGGACTGG + Intergenic
1198020811 X:132656183-132656205 ATTGCTCTGAACAGATGAAAGGG - Intronic
1198173199 X:134128179-134128201 CCAGACCTGAGCAAATGAAGGGG + Intergenic
1200163987 X:154023662-154023684 CTAGCCCTGCCCGGATGGAGCGG - Intronic