ID: 1059725302

View in Genome Browser
Species Human (GRCh38)
Location 9:117002903-117002925
Sequence TCTAGCCCTGAACAGATGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 184}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059725302_1059725312 21 Left 1059725302 9:117002903-117002925 CCCTTCATCTGTTCAGGGCTAGA 0: 1
1: 0
2: 0
3: 15
4: 184
Right 1059725312 9:117002947-117002969 CCTGTAGGAGGAAAAGTGTTTGG No data
1059725302_1059725308 6 Left 1059725302 9:117002903-117002925 CCCTTCATCTGTTCAGGGCTAGA 0: 1
1: 0
2: 0
3: 15
4: 184
Right 1059725308 9:117002932-117002954 GGTTCAGGAATGCCACCTGTAGG No data
1059725302_1059725313 22 Left 1059725302 9:117002903-117002925 CCCTTCATCTGTTCAGGGCTAGA 0: 1
1: 0
2: 0
3: 15
4: 184
Right 1059725313 9:117002948-117002970 CTGTAGGAGGAAAAGTGTTTGGG No data
1059725302_1059725307 -9 Left 1059725302 9:117002903-117002925 CCCTTCATCTGTTCAGGGCTAGA 0: 1
1: 0
2: 0
3: 15
4: 184
Right 1059725307 9:117002917-117002939 AGGGCTAGAGAGAGGGGTTCAGG No data
1059725302_1059725309 9 Left 1059725302 9:117002903-117002925 CCCTTCATCTGTTCAGGGCTAGA 0: 1
1: 0
2: 0
3: 15
4: 184
Right 1059725309 9:117002935-117002957 TCAGGAATGCCACCTGTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059725302 Original CRISPR TCTAGCCCTGAACAGATGAA GGG (reversed) Intronic
900908410 1:5576936-5576958 TGTAGCCCTGTACAGGTGAGGGG + Intergenic
901715158 1:11147654-11147676 TCTAGCCCAGAGCTCATGAAAGG + Intronic
905064144 1:35165667-35165689 TCTGCCCATCAACAGATGAATGG + Intergenic
907117853 1:51985325-51985347 TCTAGCGTTGACCAGATGTAAGG - Intronic
909025863 1:70481274-70481296 ACTAGCCCAGAACAGTTTAATGG + Intergenic
909218054 1:72917146-72917168 TACAGCCATCAACAGATGAATGG - Intergenic
909292730 1:73904286-73904308 ACTATCCATCAACAGATGAATGG + Intergenic
909327020 1:74363949-74363971 TCTAGCAAGGAACAGATGAGGGG + Intronic
909594224 1:77387082-77387104 TGCATCCATGAACAGATGAACGG - Intronic
909705524 1:78579165-78579187 ACTGTCCCTCAACAGATGAATGG - Intergenic
912141368 1:106732936-106732958 GATAGCCTTGAATAGATGAATGG + Intergenic
914927881 1:151905065-151905087 TGTTGTCCTGAACAGAGGAAAGG + Intronic
915728417 1:158035434-158035456 CCTTGCCCTGAACAGTAGAAGGG + Intronic
918872505 1:189993449-189993471 TCTAGCCCCAAACAAATAAATGG - Intergenic
918888154 1:190224724-190224746 TTAATCCCTGGACAGATGAATGG - Intronic
919285915 1:195559620-195559642 TCCAGCCCTGAATAGGTTAAGGG - Intergenic
919858557 1:201722498-201722520 ACAACCCATGAACAGATGAATGG - Intronic
920526599 1:206671499-206671521 ACTGGCCCTGAACAGAGGTAGGG + Intronic
920619360 1:207528837-207528859 TCAAATACTGAACAGATGAAGGG - Intronic
920621142 1:207547392-207547414 TCAAATACTGAACAGATGAAGGG - Intronic
920635598 1:207699311-207699333 TCAAATACTGAACAGATGAAGGG - Intronic
922045157 1:221938430-221938452 TCTATCCCTGGGGAGATGAAAGG - Intergenic
922410266 1:225366860-225366882 TCTATCTCTGAAAAGAGGAAAGG + Intronic
1065484097 10:26220097-26220119 TCAAGACCTGGGCAGATGAATGG - Intronic
1065491931 10:26291100-26291122 TCTGACCCTGTCCAGATGAATGG - Intronic
1065670705 10:28113657-28113679 TCTAGCCCTGCTCTGATGCAGGG - Intronic
1066701183 10:38130266-38130288 TGTGCCCATGAACAGATGAATGG - Intergenic
1068359362 10:55955222-55955244 AGTAGCCCTGAACAGTTCAAAGG + Intergenic
1068946669 10:62736396-62736418 TCCAGGCCTGAAAAGATGAGGGG + Intergenic
1069745634 10:70713269-70713291 CCCAGCTCTGAACAAATGAATGG - Intronic
1069912889 10:71770667-71770689 GTTAGGCCTGAGCAGATGAAAGG - Intronic
1071301516 10:84259287-84259309 TCTATCCATCAACAGATGATTGG - Exonic
1074142883 10:110690792-110690814 TCTGGCCATCAACAGATGAATGG - Intronic
1077528422 11:3083170-3083192 AGTATCCATGAACAGATGAATGG + Intergenic
1077749123 11:4944163-4944185 TCTTGCCCTGATCTGATGATAGG + Intronic
1079226880 11:18614601-18614623 TCCAGCAATGGACAGATGAATGG - Exonic
1079306943 11:19331628-19331650 ACTAGCAGTGAACAGAAGAAAGG + Intergenic
1079417047 11:20247972-20247994 TCTACCCTTAAACAAATGAAAGG - Intergenic
1082192123 11:49258758-49258780 AATATCCCTCAACAGATGAATGG + Intergenic
1083079605 11:60076916-60076938 ACTATCCATGAACAGATAAATGG + Intergenic
1083301307 11:61740868-61740890 CCTGGCCCTTAACAGATGAATGG + Intronic
1083551600 11:63594131-63594153 TTTAGGCCTGAGCAGCTGAATGG + Intronic
1085408271 11:76276933-76276955 TCAAGCCCCGGACAGATGCAGGG - Intergenic
1086674003 11:89582274-89582296 AATATCCCTCAACAGATGAATGG - Intergenic
1086944420 11:92831039-92831061 TCTGCTCCTGAACAGATGGAAGG - Intronic
1087432919 11:98076161-98076183 TCTACCCTAGAACAGATCAAGGG - Intergenic
1088885206 11:114000864-114000886 TGTAGCCCTGATCAGAGGACAGG - Intergenic
1095046308 12:37511005-37511027 TCTAGGTCTGAAGGGATGAAGGG - Intergenic
1095943041 12:47738803-47738825 TGTAGCCCAGAAAAGGTGAAGGG + Intronic
1097479609 12:60105736-60105758 TATTGCCTTTAACAGATGAAGGG + Intergenic
1097532388 12:60820543-60820565 TCTATCAATCAACAGATGAATGG + Intergenic
1099686320 12:85893762-85893784 AGTATCCCTCAACAGATGAATGG - Intergenic
1099808607 12:87551876-87551898 ACTAGCCAGCAACAGATGAATGG + Intergenic
1099872370 12:88365982-88366004 TCCAGCCATGAACAAATAAATGG + Intergenic
1103286821 12:119809593-119809615 TCCTGCCTTGAGCAGATGAAAGG - Intronic
1103482042 12:121256796-121256818 TATGCCCCTCAACAGATGAATGG - Intronic
1104815655 12:131644175-131644197 TGTGGCCCTGAAGAGAGGAAGGG + Intergenic
1105798837 13:23885052-23885074 ACTGTCCATGAACAGATGAATGG + Intronic
1107525423 13:41226492-41226514 TCTAGCTCTCAACACACGAAAGG + Exonic
1108349167 13:49574839-49574861 AATATCCATGAACAGATGAATGG + Intronic
1109135749 13:58648430-58648452 TCTTGCCCTGAAAAGGTAAATGG + Intergenic
1109418377 13:62075083-62075105 TTTATCCCTTATCAGATGAATGG + Intergenic
1109894911 13:68673947-68673969 TATAACCCTGATCAGAAGAAAGG - Intergenic
1115270586 14:31547882-31547904 TCCATCCATCAACAGATGAATGG - Intronic
1115645845 14:35368008-35368030 TCCAGCCCAGAAGAGAAGAAGGG - Intergenic
1118247019 14:64121067-64121089 TCTAGCCCCCAACAGTTGTAGGG + Intronic
1121655953 14:95595807-95595829 GCTAGCCTTGAATGGATGAAAGG + Intergenic
1122026642 14:98882452-98882474 AGTATCCATGAACAGATGAATGG + Intergenic
1122735761 14:103840174-103840196 TCTAGGGCTAAACAGAGGAATGG - Intronic
1123397009 15:19946867-19946889 TGTGTCCATGAACAGATGAACGG - Intergenic
1126288795 15:47047530-47047552 TCTAGGCCTGAAGGGATGAAGGG + Intergenic
1126313085 15:47338839-47338861 TCCTGCCTTGGACAGATGAAAGG - Intronic
1127178196 15:56383753-56383775 TTTAACCCAGAACAAATGAAAGG + Intronic
1128595312 15:68941007-68941029 ATTGGCCATGAACAGATGAATGG - Intronic
1129903180 15:79167324-79167346 TCTCTCCATGAACAGAGGAAAGG - Intergenic
1131452666 15:92558517-92558539 TCAATCCATCAACAGATGAAGGG + Intergenic
1131879525 15:96847777-96847799 TGTATCCATCAACAGATGAATGG + Intergenic
1133258821 16:4535502-4535524 GTTAGCGCTGAAGAGATGAAGGG - Intronic
1133880195 16:9774345-9774367 TCTAGACCTTACCAGATGACTGG - Intronic
1135552797 16:23411103-23411125 TCTTTCCCTGATCATATGAAAGG + Intronic
1136097088 16:27964521-27964543 CCTAACCATCAACAGATGAATGG + Intronic
1136415821 16:30102948-30102970 TCTATCCCCGAGCAGATGTATGG + Intergenic
1138710619 16:58966548-58966570 TCTAGGGATGAACAGAAGAATGG - Intergenic
1139216431 16:65129855-65129877 TCCAGCCTTGGGCAGATGAAAGG - Intergenic
1139652995 16:68371880-68371902 TCCAGCCGTGAATAGATGTAGGG + Exonic
1139901900 16:70334693-70334715 TCTTGCCTTGGACAGATAAATGG - Exonic
1144582666 17:16468307-16468329 GGTGGCCATGAACAGATGAATGG + Intronic
1144690581 17:17260106-17260128 TCTAGCCCTGAAAAGACCAAAGG + Intronic
1145054468 17:19691349-19691371 AGTATCCATGAACAGATGAATGG + Intronic
1146542309 17:33707918-33707940 TCTAGCCCTTTACAGAAGATTGG - Intronic
1146589371 17:34115347-34115369 TCTAGTACTGAACGGATGATTGG - Intronic
1146612248 17:34317986-34318008 GAGAGCCCTCAACAGATGAATGG + Intergenic
1151996771 17:77614477-77614499 TAGAGCCATCAACAGATGAATGG + Intergenic
1154968195 18:21380597-21380619 TCTATCCCTTAATAGTTGAATGG + Intronic
1159687036 18:71435439-71435461 ACTATCCATCAACAGATGAATGG - Intergenic
1160264542 18:77328733-77328755 TTTGTCCCTGGACAGATGAATGG - Intergenic
1161906374 19:7159835-7159857 TCTGGCCCTGACCTGCTGAAGGG - Intronic
1162698268 19:12494366-12494388 ACTGTCCCTCAACAGATGAATGG + Intronic
1163414483 19:17177789-17177811 TCTAGCATTGAGCAGCTGAAAGG - Intronic
1164518305 19:28955652-28955674 TCTAGGCCTGATCATTTGAAAGG - Intergenic
1164785177 19:30924897-30924919 TCTAGCAGTAAACAGATGAGGGG - Intergenic
933074090 2:77900840-77900862 TCTGTCCTTCAACAGATGAAAGG - Intergenic
933517347 2:83321925-83321947 TGTATCCATCAACAGATGAATGG + Intergenic
936827005 2:116593997-116594019 TATATCCCTCAATAGATGAATGG - Intergenic
943327590 2:186520627-186520649 TCAAGCCCTGAACACATCATTGG + Intergenic
944856224 2:203769881-203769903 AATATCCATGAACAGATGAACGG + Intergenic
945886619 2:215382856-215382878 TTGAGCCCTGAACTCATGAATGG + Intronic
948565862 2:238885665-238885687 GCTAGCCCTGGGGAGATGAAGGG + Intronic
1171481192 20:25456999-25457021 CCTTGCTCTGGACAGATGAAAGG - Intronic
1171540876 20:25954606-25954628 TCTAGGCCTGAAGGGATGAAGGG - Intergenic
1171800192 20:29605704-29605726 TCTAGGCCTGAAGGGATGAAGGG + Intergenic
1171843903 20:30250999-30251021 TCTAGGCCTGAAGGGATGAAGGG - Intergenic
1172250542 20:33476128-33476150 TCTAGCTCTACACAAATGAATGG - Intergenic
1173094821 20:40015406-40015428 TCTCAGTCTGAACAGATGAAAGG + Intergenic
1173526006 20:43733182-43733204 TCTACTCCTGCACAGAGGAAAGG + Intergenic
1173546562 20:43902562-43902584 TCAAGCCCTGTACAGATGGCAGG + Intergenic
1174600568 20:51721090-51721112 TCTTGCCCTGAGAAGAGGAAGGG - Intronic
1175426677 20:58871848-58871870 TCTAGTCCAGAACAGAGGAGAGG + Intronic
1176743517 21:10629731-10629753 TGTGTCCATGAACAGATGAATGG - Intergenic
1177473287 21:21585965-21585987 TCTAGATCAGAAAAGATGAAAGG - Intergenic
1179192549 21:39135779-39135801 TCTAGCACTGAATAATTGAATGG - Intergenic
1180278517 22:10669296-10669318 TCTAGCCCTGCTCACATGACAGG + Intergenic
1181375934 22:22458002-22458024 TCCATCCCTGAGCAGATGTATGG + Intergenic
1181963560 22:26640551-26640573 TCTGTCCATCAACAGATGAATGG - Intergenic
949922206 3:9011726-9011748 TCCAGCCCACAACAGATGATTGG + Intronic
950392517 3:12707767-12707789 CCTAGAGCTGTACAGATGAAAGG + Intergenic
951250873 3:20393236-20393258 TGTATCCATCAACAGATGAATGG + Intergenic
953640870 3:44706377-44706399 TCTAGCCTAGAACATATAAATGG - Intergenic
957989106 3:87608445-87608467 TCCATCCCTGAGCAGATGTATGG - Intergenic
960936762 3:122909296-122909318 TGTGTTCCTGAACAGATGAAGGG + Exonic
961260496 3:125597734-125597756 TGTGTCCATGAACAGATGAATGG + Intergenic
962364883 3:134772271-134772293 TCCAGCCCTGCACAGCTGCACGG - Intronic
962816791 3:139007497-139007519 ACTATCCATCAACAGATGAATGG - Intronic
963901189 3:150734942-150734964 TCCAGCCCTGAACAGGAGAAAGG - Intergenic
964721672 3:159773085-159773107 TCTGTCGCTGAAGAGATGAATGG + Intronic
965174236 3:165310039-165310061 TGTATCCATCAACAGATGAATGG + Intergenic
965451030 3:168838459-168838481 ATTAGCCCTGAACAGATGAGTGG - Intergenic
966936636 3:184714400-184714422 TCTAGCACTTAACAGATGGGTGG - Intergenic
969862403 4:10048008-10048030 TCTTGCCCTCAGCAGATGACTGG + Intronic
970466088 4:16324313-16324335 TCCAGCACAGACCAGATGAAGGG - Intergenic
971140301 4:23918075-23918097 TGTAGCCTTGAACAGGTGAAAGG - Intergenic
974735081 4:65920210-65920232 TCTGTCCATCAACAGATGAATGG - Intergenic
979502877 4:121460369-121460391 TGTAGCCCTGAGAAGATGCACGG - Intergenic
980125832 4:128772836-128772858 TCTATTCCTGACCAGAGGAATGG + Intergenic
980774229 4:137418664-137418686 TGTGTCCCTGAACAGATGACTGG + Intergenic
983253356 4:165369975-165369997 TATATCCATGGACAGATGAATGG - Intronic
985167325 4:187110835-187110857 AGTAGCCATCAACAGATGAATGG - Intergenic
987165539 5:15194297-15194319 TTTAGGCCTGAAGAGATGAAGGG - Intergenic
988400258 5:30752710-30752732 TCTCTCCCTGAACAGGTTAAGGG + Intergenic
989756121 5:44956977-44956999 TCTATCCATCAACAGATGAATGG - Intergenic
995137024 5:108690171-108690193 TCTAGCCAATAACATATGAAGGG + Intergenic
997125644 5:131224390-131224412 TTTTGACCTGAGCAGATGAAAGG - Intergenic
997516250 5:134491921-134491943 TATAGGCCTGTACAGAGGAAAGG - Intergenic
1003142583 6:3483826-3483848 TCTAGCTCAGCCCAGATGAATGG - Intergenic
1004519095 6:16345597-16345619 TCTGACCCTCAAAAGATGAATGG + Intronic
1004700325 6:18073083-18073105 TCTGTCCATCAACAGATGAATGG - Intergenic
1005457680 6:26036779-26036801 TCTAGCCCTGTACATATCCAAGG - Intergenic
1007120292 6:39374963-39374985 TCAACCCATCAACAGATGAATGG + Intronic
1009871116 6:69452709-69452731 TGTATCCATCAACAGATGAATGG + Intergenic
1013039040 6:106415775-106415797 TCTTGACCTGAACATATGACAGG + Intergenic
1013989023 6:116231331-116231353 TCTAGCCCAGAATTGAGGAAGGG + Intronic
1015134614 6:129853305-129853327 TTTAGACCTGAAAAGATGAGTGG - Intronic
1017436403 6:154419709-154419731 CCCAGCCATCAACAGATGAATGG + Intronic
1017922934 6:158887098-158887120 TCTACCCCTCCCCAGATGAACGG - Intronic
1022049541 7:26652090-26652112 TCTTTCCTTGAAGAGATGAAGGG + Intergenic
1022095006 7:27134121-27134143 TCTAGAGCTGAACAGTGGAATGG + Intronic
1022280775 7:28907011-28907033 TCAAGCCTTTAACAGATGTATGG - Intergenic
1022940454 7:35231901-35231923 GCTAGGGCTGAACAGAGGAATGG + Intronic
1024573381 7:50743993-50744015 TCTAGCCCTGAAAAGAGGTGGGG + Intronic
1025292304 7:57740862-57740884 TCTAGGCCTGAAGGGGTGAAGGG - Intergenic
1026365082 7:69640237-69640259 TATAGCCCTGAACACTTGATGGG - Intronic
1030812691 7:113993903-113993925 TCTGTCCATTAACAGATGAATGG + Intronic
1031769621 7:125827777-125827799 TGTGTCCATGAACAGATGAATGG - Intergenic
1035310945 7:157968415-157968437 TCATGCCCTGAACAGATTGATGG - Intronic
1035829673 8:2681131-2681153 TCTATTCCTGAACAAATCAATGG - Intergenic
1036554787 8:9848911-9848933 TCTATCCATCAACTGATGAAGGG + Intergenic
1038236733 8:25765943-25765965 ACTAGCCCTGGAGAGATAAAAGG + Intergenic
1040538512 8:48330529-48330551 TCTAGCCCTCAAAAGGTGCAGGG - Intergenic
1041245249 8:55882695-55882717 CAGAGCCCTGAACAAATGAAAGG - Intronic
1041504646 8:58582431-58582453 ACTAGCCCAGAACAGTTTAATGG + Exonic
1041866027 8:62574280-62574302 TCTGTCCATTAACAGATGAAAGG - Intronic
1042422252 8:68605545-68605567 GCAAGCCCTGAAAAGATGAGAGG + Intronic
1044852718 8:96444835-96444857 TCTAGCCCTGTACATAGCAAGGG + Intergenic
1046088544 8:109469284-109469306 ACTGGCCCTGAAAAGATGAAGGG + Intronic
1047787775 8:128170322-128170344 CCCAGCCATGAACAAATGAATGG + Intergenic
1051399060 9:16659689-16659711 GCAAGCCCTGCACAGATCAAGGG - Intronic
1054164195 9:61704850-61704872 TCTAGGCCTGAAGGGATGAAGGG + Intergenic
1054833115 9:69648074-69648096 TATAGCATTGGACAGATGAAGGG + Intronic
1056994971 9:91447219-91447241 TGTATCCATCAACAGATGAATGG - Intergenic
1059725302 9:117002903-117002925 TCTAGCCCTGAACAGATGAAGGG - Intronic
1186770945 X:12817653-12817675 AGTGGCCATGAACAGATGAATGG + Intronic
1186839690 X:13472942-13472964 ACTATCCATTAACAGATGAATGG + Intergenic
1187206722 X:17188576-17188598 GCTAGCTCTGGACAGAGGAAAGG + Intergenic
1188475652 X:30588766-30588788 TCTGTCCATCAACAGATGAATGG - Intergenic
1192058182 X:67794702-67794724 TCTAGGCATGAAAGGATGAAGGG + Intergenic
1193574362 X:83181318-83181340 TCTTGCCATGAACACATGAAGGG - Intergenic
1195428255 X:104760173-104760195 TGTATCCATCAACAGATGAATGG - Intronic
1198020812 X:132656184-132656206 AATTGCTCTGAACAGATGAAAGG - Intronic
1199920044 X:152391214-152391236 TCTACTCCTGAACTGATAAAAGG - Intronic
1199927968 X:152489414-152489436 TCTGTCCATCAACAGATGAATGG - Intergenic