ID: 1059725303

View in Genome Browser
Species Human (GRCh38)
Location 9:117002904-117002926
Sequence CTCTAGCCCTGAACAGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 137}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059725303_1059725308 5 Left 1059725303 9:117002904-117002926 CCTTCATCTGTTCAGGGCTAGAG 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1059725308 9:117002932-117002954 GGTTCAGGAATGCCACCTGTAGG No data
1059725303_1059725313 21 Left 1059725303 9:117002904-117002926 CCTTCATCTGTTCAGGGCTAGAG 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1059725313 9:117002948-117002970 CTGTAGGAGGAAAAGTGTTTGGG No data
1059725303_1059725307 -10 Left 1059725303 9:117002904-117002926 CCTTCATCTGTTCAGGGCTAGAG 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1059725307 9:117002917-117002939 AGGGCTAGAGAGAGGGGTTCAGG No data
1059725303_1059725309 8 Left 1059725303 9:117002904-117002926 CCTTCATCTGTTCAGGGCTAGAG 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1059725309 9:117002935-117002957 TCAGGAATGCCACCTGTAGGAGG No data
1059725303_1059725312 20 Left 1059725303 9:117002904-117002926 CCTTCATCTGTTCAGGGCTAGAG 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1059725312 9:117002947-117002969 CCTGTAGGAGGAAAAGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059725303 Original CRISPR CTCTAGCCCTGAACAGATGA AGG (reversed) Intronic
900310368 1:2030495-2030517 CCCGAGACCTGCACAGATGAAGG + Exonic
900908409 1:5576935-5576957 GTGTAGCCCTGTACAGGTGAGGG + Intergenic
902391717 1:16110981-16111003 CCCTAGCCCTGCCCAGATGGGGG + Intergenic
903657438 1:24957996-24958018 CTCTAGCCCTGAAAAAACCAGGG + Intronic
903745952 1:25586739-25586761 CTCCAGGCCTGAGCAGATGGGGG + Intergenic
904123631 1:28220515-28220537 CTCTTGCCCTTACCTGATGACGG - Intronic
907143675 1:52212546-52212568 CTCTAGGCGAGAACTGATGAGGG + Intronic
909327019 1:74363948-74363970 CTCTAGCAAGGAACAGATGAGGG + Intronic
910360671 1:86411408-86411430 CTCCAGCCCTGCAAAGATGGGGG + Intergenic
910632326 1:89368805-89368827 CTCTACCCCAGAGCACATGAAGG + Intronic
911321072 1:96414748-96414770 CTGTAGCCCATGACAGATGAGGG - Intergenic
913277079 1:117148893-117148915 TTCTACCCCTGAACAACTGACGG + Intronic
914936945 1:151989818-151989840 CTCTATTCCTGGACAGATGTGGG + Intronic
915270848 1:154752379-154752401 TTCAAGCACTGAGCAGATGAAGG + Intronic
916368125 1:164057059-164057081 CTCTACCTTTGAACAGATAAAGG - Intergenic
916806575 1:168266338-168266360 CTCCAGCCCTGCAAAGATGGGGG + Intergenic
918226684 1:182490329-182490351 CTCTAATCCTGAACAAATTAGGG - Intronic
921148827 1:212384072-212384094 CCCTAACCCAAAACAGATGAAGG - Intronic
922463369 1:225829501-225829523 CTCTATCCCTGTGCAGAGGAGGG - Intronic
922621826 1:226994585-226994607 CTGTAGGCCTTTACAGATGATGG + Intronic
923691623 1:236199095-236199117 CTTTAGTCCTAAACAGATGCTGG + Intronic
1062969540 10:1635826-1635848 CTCTATCCCTGGACAGTTGCTGG + Intronic
1064560606 10:16591899-16591921 CTCTATCCCTAAACAGGGGATGG + Exonic
1065670706 10:28113658-28113680 CTCTAGCCCTGCTCTGATGCAGG - Intronic
1067538665 10:47135891-47135913 CTCTAACCATAAACAGCTGATGG - Intergenic
1068844723 10:61659090-61659112 CTCTAGGCCTGAAGAGGCGAGGG + Intergenic
1068946668 10:62736395-62736417 CTCCAGGCCTGAAAAGATGAGGG + Intergenic
1069881924 10:71598553-71598575 CTGTAACCCAGAACAGCTGATGG + Intronic
1074938072 10:118206555-118206577 ATCTCTCACTGAACAGATGAGGG - Intergenic
1076103887 10:127804725-127804747 CCCCAGCCCAGAACACATGATGG + Intergenic
1077172618 11:1174714-1174736 CTCAAGCCCAGCACAGAGGACGG - Intronic
1079099683 11:17533415-17533437 CTCCAGCCCTGAAAAGCTGCTGG - Intronic
1085408272 11:76276934-76276956 CTCAAGCCCCGGACAGATGCAGG - Intergenic
1085740561 11:79074870-79074892 CCCTGGTCCTGCACAGATGAGGG - Intronic
1087928996 11:103954499-103954521 CTCTAGCCATGAATAGTTTATGG - Intronic
1089335445 11:117719954-117719976 CCCTAACCCTGAACATATGTGGG + Intronic
1092907586 12:13115946-13115968 CTCTTGCCCTGCTCAGCTGAAGG - Intronic
1093420343 12:18967438-18967460 ACCTAGACATGAACAGATGAAGG + Intergenic
1095046309 12:37511006-37511028 CTCTAGGTCTGAAGGGATGAAGG - Intergenic
1095943040 12:47738802-47738824 CTGTAGCCCAGAAAAGGTGAAGG + Intronic
1095982452 12:47981135-47981157 CCCTCACCCTGAACACATGATGG + Intronic
1096803084 12:54124439-54124461 CTCTAGCTCTGAACAAAGAAGGG - Intergenic
1101766843 12:107708920-107708942 TTCTAGGCCAGTACAGATGACGG + Exonic
1104815654 12:131644174-131644196 CTGTGGCCCTGAAGAGAGGAAGG + Intergenic
1105717398 13:23081099-23081121 CTCTAGCCCTGGAATGAGGAGGG - Intergenic
1110132154 13:72022116-72022138 CTCCAGCCCTGCAAAGCTGAGGG - Intergenic
1110781970 13:79477037-79477059 TTATAGAGCTGAACAGATGACGG + Intergenic
1111993848 13:95143207-95143229 CTCTAGGCCTGAAAAAATGTGGG - Intronic
1117726281 14:58677755-58677777 CCCTAGGCCTGAATGGATGAGGG + Intergenic
1118311756 14:64698828-64698850 CTTTAGCATTAAACAGATGATGG + Intergenic
1126288794 15:47047529-47047551 CTCTAGGCCTGAAGGGATGAAGG + Intergenic
1131443266 15:92474738-92474760 TTCTAGGCCTGAACAACTGAGGG + Intronic
1137446561 16:48535854-48535876 CACTAGCCCTTGACAGATGAGGG + Intergenic
1138605237 16:58084476-58084498 CTCAAGCACTGAGCAGATTAGGG - Intergenic
1139923922 16:70475368-70475390 CACGATCCCTGCACAGATGAAGG - Exonic
1141547245 16:84778570-84778592 CTGTAGGCCTGTACAGCTGATGG + Intronic
1141659344 16:85433534-85433556 CTGTATCTCTGACCAGATGAAGG + Intergenic
1142627372 17:1200886-1200908 CTGTAGCCCTGCCCAGAGGAAGG - Intronic
1144581509 17:16461948-16461970 CTCCAGCCCTGCAGAAATGAGGG + Intronic
1144814481 17:18024462-18024484 CCCTATCCCTGATCATATGAGGG + Intronic
1147257741 17:39192088-39192110 CTCTACCCTTGAACAGAAGCTGG - Intronic
1148233771 17:45953671-45953693 CTCTAGCCCTGCAGGGATGGTGG + Intronic
1154054956 18:11003984-11004006 CTCTGACCCTAAACAAATGATGG + Intronic
1158572689 18:58610349-58610371 CTCTACCCTTGAAAACATGAAGG - Intronic
1161906375 19:7159836-7159858 CTCTGGCCCTGACCTGCTGAAGG - Intronic
1162898824 19:13781802-13781824 CCCCAGCCCTGAACAGAGGCCGG - Intergenic
1163295744 19:16411426-16411448 ATCTAGCCCTGAACAGTAAATGG - Intronic
1164655063 19:29914944-29914966 CTCTAGCCCTGTACCAACGAGGG - Intergenic
1164785178 19:30924898-30924920 GTCTAGCAGTAAACAGATGAGGG - Intergenic
925004568 2:431237-431259 CACAAGCCCTGATCTGATGAAGG + Intergenic
926330345 2:11820199-11820221 CTCAGTCCTTGAACAGATGAGGG + Intronic
927797378 2:26061981-26062003 CTCTTACCATGAACAGTTGATGG + Intronic
933655055 2:84880470-84880492 CTCAGGCACTGAACATATGAAGG + Intronic
937905410 2:127050564-127050586 CTCCAGCCCTGCACAGAGCACGG + Intronic
940405010 2:153291511-153291533 CTCTAGCACTGACCAGAGCAAGG - Intergenic
940520087 2:154734546-154734568 TTCTAGCCATCAACAGATGCTGG - Intronic
940780099 2:157924277-157924299 GTCTAGCCCTGAACCTATCATGG - Intronic
940922790 2:159328273-159328295 CTCTAGCCAAGAAAAGGTGATGG - Intronic
942141595 2:172982933-172982955 TTCTAGCCCTGAGGAGATAAGGG - Intronic
942846739 2:180435727-180435749 CCCAAGCCCTGAAGAGGTGAAGG + Intergenic
944391765 2:199225863-199225885 CTCTAGCCTTGCAAAGATGGGGG + Intergenic
945485887 2:210395114-210395136 CTCCAGCCCTGAAGGAATGAAGG + Intergenic
947073815 2:226319732-226319754 CTATAGCCATGAAGGGATGAAGG + Intergenic
947096815 2:226575906-226575928 ATCTAGACCTGAGCAGATGGGGG + Intergenic
948294166 2:236848301-236848323 CTATAGCCCAGGAGAGATGAGGG - Intergenic
948507002 2:238435209-238435231 CTCTAACACTGCACAAATGATGG - Intronic
948795006 2:240398009-240398031 CCCTAGCCCTGAACACAGGATGG + Intergenic
1169887427 20:10415946-10415968 GTCTAGACCTGAACAAAAGAAGG + Intronic
1171540877 20:25954607-25954629 CTCTAGGCCTGAAGGGATGAAGG - Intergenic
1171793680 20:29550148-29550170 CTCTAGCTCTGAACAAAGAAGGG + Intergenic
1171800191 20:29605703-29605725 CTCTAGGCCTGAAGGGATGAAGG + Intergenic
1171843904 20:30251000-30251022 CTCTAGGCCTGAAGGGATGAAGG - Intergenic
1171854792 20:30334240-30334262 CTCTAGCTCTGAACAAAGAAGGG - Intergenic
1174600569 20:51721091-51721113 CTCTTGCCCTGAGAAGAGGAAGG - Intronic
1179516993 21:41915234-41915256 CCCTAGCACTGCACAGGTGAGGG + Intronic
1179979822 21:44890105-44890127 CCCCAGCCCTGAGCAGATGATGG + Exonic
1182606440 22:31508818-31508840 CTCTAGGCCCAAAGAGATGAGGG - Intronic
950095327 3:10325797-10325819 GTCTCCCCCTCAACAGATGAGGG - Exonic
951819338 3:26791032-26791054 CTCTAGCCCAGGACAGATCCAGG + Intergenic
960393829 3:117111835-117111857 CTGAAGCCCAGAACAGATGGAGG + Intronic
967117843 3:186357712-186357734 GCCTAGCCCCGAAGAGATGAGGG - Intronic
969206460 4:5650894-5650916 CTCTGGCACAGAACAGATGCTGG + Intronic
970696683 4:18686192-18686214 CTCCTGCTCAGAACAGATGAGGG + Intergenic
974798706 4:66785741-66785763 TTCTAGCACTGAACATATTAGGG - Intergenic
985825073 5:2185594-2185616 CTCTAGCCCGGGGCAGAGGAAGG + Intergenic
987165540 5:15194298-15194320 CTTTAGGCCTGAAGAGATGAAGG - Intergenic
988400257 5:30752709-30752731 CTCTCTCCCTGAACAGGTTAAGG + Intergenic
989332927 5:40281029-40281051 CTTTAGACCTGAATAGATGTGGG + Intergenic
989800772 5:45535734-45535756 CTTTATCACTGAAAAGATGATGG - Intronic
992412822 5:76523651-76523673 CTCTAGCCCTGAATAGAATGGGG + Intronic
995675976 5:114663012-114663034 CTCTAGTCTTGAAGAAATGAAGG - Intergenic
996821250 5:127631073-127631095 CACTAGCCCTGAAAAAATGTGGG - Intergenic
999186474 5:149714302-149714324 CTCTATCACTGTAAAGATGATGG - Intergenic
999386016 5:151155117-151155139 CTCCAGCCCTTAACAGTTTAAGG - Intronic
1001971139 5:175955989-175956011 CTGTAGCCTTGAAAAGAGGATGG - Intronic
1002246303 5:177887788-177887810 CTGTAGCCTTGAAAAGAGGATGG + Intergenic
1004150919 6:13119529-13119551 CACTAGCCCAGAATAGATGCTGG + Intronic
1006340147 6:33442479-33442501 CTCGAGGCCTCAACAGGTGAGGG + Exonic
1013418943 6:109949035-109949057 CTCTGGCCCTGGACTGATGAGGG + Intergenic
1014886224 6:126784747-126784769 CTCTAACCCTTAACTGATAATGG - Intergenic
1015451353 6:133370493-133370515 CTTTAGCCATAAACAGATCAGGG - Intronic
1018601503 6:165548564-165548586 CTCAAGGCCTGAAGAGATGTAGG + Intronic
1019336252 7:484431-484453 CTCTGGCCCTGAGCAGGTGGAGG - Intergenic
1021935584 7:25627895-25627917 CTTTACACCAGAACAGATGACGG + Intergenic
1023012900 7:35939383-35939405 CACTGGCCCTGGACACATGATGG + Intergenic
1024573380 7:50743992-50744014 TTCTAGCCCTGAAAAGAGGTGGG + Intronic
1025292305 7:57740863-57740885 CTCTAGGCCTGAAGGGGTGAAGG - Intergenic
1026365083 7:69640238-69640260 TTATAGCCCTGAACACTTGATGG - Intronic
1029952252 7:104599474-104599496 CTCTACCCATAAACAGAGGATGG - Intronic
1030600389 7:111585038-111585060 CTCTAACACTGAAAAGAAGAAGG - Intergenic
1037457862 8:19082114-19082136 GTCCAGCCCTGGACAGATTAAGG - Intronic
1037904218 8:22705932-22705954 CTCAAGCCCTGATCTGCTGATGG - Intergenic
1038463544 8:27738294-27738316 CTGTATCCCTTAACAGAAGACGG + Intronic
1039427983 8:37502720-37502742 CTCCAGCCCTGTCCACATGATGG - Intergenic
1040538513 8:48330530-48330552 CTCTAGCCCTCAAAAGGTGCAGG - Intergenic
1043335947 8:79177344-79177366 GTCTAGCCCTGGACACATGGGGG - Intergenic
1043663173 8:82772567-82772589 CTTTAGCCCAAAATAGATGATGG + Intergenic
1046088543 8:109469283-109469305 TACTGGCCCTGAAAAGATGAAGG + Intronic
1051220093 9:14839139-14839161 ATCTAGCCCAGAAAAGATGAAGG + Intronic
1053792614 9:41697523-41697545 CTCTAGCTCTGAACAAAGAAGGG - Intergenic
1054152560 9:61617297-61617319 CTCTAGCTCTGAACAAAGAAGGG + Intergenic
1054164194 9:61704849-61704871 CTCTAGGCCTGAAGGGATGAAGG + Intergenic
1054181028 9:61909544-61909566 CTCTAGCTCTGAACAAAGAAGGG - Intergenic
1054472337 9:65548445-65548467 CTCTAGCTCTGAACAAAGAAGGG + Intergenic
1054656563 9:67671598-67671620 CTCTAGCTCTGAACAAAGAAGGG + Intergenic
1056494166 9:87139620-87139642 GTCTGTCCCTGAATAGATGATGG + Intergenic
1059725303 9:117002904-117002926 CTCTAGCCCTGAACAGATGAAGG - Intronic
1060717225 9:125943819-125943841 CACTTGGCCTGAAGAGATGAGGG + Intronic
1061940706 9:133882365-133882387 CTCCAGCCCCGTACAGATGTCGG - Intronic
1193574363 X:83181319-83181341 GTCTTGCCATGAACACATGAAGG - Intergenic
1199542930 X:148977817-148977839 CTCTTGCCCAGAACAAATGTGGG + Intronic