ID: 1059725308

View in Genome Browser
Species Human (GRCh38)
Location 9:117002932-117002954
Sequence GGTTCAGGAATGCCACCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059725301_1059725308 7 Left 1059725301 9:117002902-117002924 CCCCTTCATCTGTTCAGGGCTAG 0: 1
1: 0
2: 0
3: 15
4: 115
Right 1059725308 9:117002932-117002954 GGTTCAGGAATGCCACCTGTAGG No data
1059725302_1059725308 6 Left 1059725302 9:117002903-117002925 CCCTTCATCTGTTCAGGGCTAGA 0: 1
1: 0
2: 0
3: 15
4: 184
Right 1059725308 9:117002932-117002954 GGTTCAGGAATGCCACCTGTAGG No data
1059725303_1059725308 5 Left 1059725303 9:117002904-117002926 CCTTCATCTGTTCAGGGCTAGAG 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1059725308 9:117002932-117002954 GGTTCAGGAATGCCACCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059725308 Original CRISPR GGTTCAGGAATGCCACCTGT AGG Intronic
No off target data available for this crispr