ID: 1059725505

View in Genome Browser
Species Human (GRCh38)
Location 9:117004577-117004599
Sequence AGGATTTCTTCACCTCTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 304}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059725505_1059725510 6 Left 1059725505 9:117004577-117004599 CCATTGAGAGGTGAAGAAATCCT 0: 1
1: 0
2: 1
3: 19
4: 304
Right 1059725510 9:117004606-117004628 GAGGGAGGAGATCCTTGACCTGG No data
1059725505_1059725508 -9 Left 1059725505 9:117004577-117004599 CCATTGAGAGGTGAAGAAATCCT 0: 1
1: 0
2: 1
3: 19
4: 304
Right 1059725508 9:117004591-117004613 AGAAATCCTCAAATAGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059725505 Original CRISPR AGGATTTCTTCACCTCTCAA TGG (reversed) Intronic
901523388 1:9803238-9803260 AGGATTAGATAACCTCTCAAGGG + Intronic
903380246 1:22891688-22891710 TGGTGTTCTTCATCTCTCAAAGG + Intronic
904381704 1:30115757-30115779 ATGACTTAGTCACCTCTCAAAGG - Intergenic
904798037 1:33072213-33072235 ATGATTTAGTCACCTCTCAATGG + Intronic
906274313 1:44504967-44504989 AGTTTTTCTTCCCCTCTGAAAGG - Intronic
907320857 1:53601443-53601465 AGGTTTTTTTCACGTCTTAATGG - Intronic
907769591 1:57447300-57447322 TGGACTTCTTCACTGCTCAAAGG + Intronic
907827667 1:58034681-58034703 ATGATTTCTTCCCATCCCAAAGG + Intronic
907860980 1:58352760-58352782 ATGATCTCATCACCTCTCAAAGG - Intronic
909054446 1:70805789-70805811 TGCATTTCTACACCTCTCAAGGG + Intergenic
909118215 1:71566962-71566984 ATGATCTGTTCACCTCCCAAAGG + Intronic
910686906 1:89926907-89926929 TCTATTTCTTCCCCTCTCAAGGG + Intronic
911687292 1:100792107-100792129 AGGATTTACTCACCTCCCTAAGG + Intergenic
912186519 1:107283029-107283051 ATGATCTGATCACCTCTCAAAGG + Intronic
912364256 1:109120059-109120081 AGGATATAATCACCTCCCAAAGG - Intronic
913144175 1:115972970-115972992 ATGATTTAATCACTTCTCAAGGG - Intergenic
917846331 1:179023526-179023548 AGGCTTTCTTCATCTCTGCATGG + Intergenic
918354669 1:183696236-183696258 TGGCTTTCTTCCCATCTCAAAGG + Intronic
919687646 1:200499215-200499237 AGGATCTAATCACCTCCCAAAGG - Intergenic
920021805 1:202962023-202962045 ATGATTTCTTCAGATCTCAAAGG - Exonic
921249203 1:213280776-213280798 AGTATATTTTGACCTCTCAATGG + Intergenic
921250983 1:213297859-213297881 ATGATCTTTTCACCTCCCAAAGG + Intergenic
923645813 1:235819348-235819370 AGGATTTTATCACTTCTAAAAGG - Intronic
924303330 1:242662005-242662027 GGGATTTAATCACCCCTCAAAGG - Intergenic
1063066508 10:2615291-2615313 AGGACCTTCTCACCTCTCAAAGG + Intergenic
1064383998 10:14874772-14874794 ATGATTTAATCACCTCCCAAAGG + Intergenic
1065271663 10:24039324-24039346 AGGATTTTTTCACTTTACAATGG + Intronic
1065357667 10:24858281-24858303 AGGATTTCTTGAGCTCCCACTGG - Intronic
1065689183 10:28315708-28315730 AGGTATTCTTCACCTCTCTGAGG - Intronic
1065835086 10:29649841-29649863 ATGACTTAATCACCTCTCAAGGG - Intronic
1066535302 10:36384444-36384466 ATGATTTAATCACCTCTTAAAGG - Intergenic
1068093522 10:52461969-52461991 AGTCTTGCTTCAACTCTCAAAGG - Intergenic
1070725234 10:78783152-78783174 ATGACTTCATCACCTCCCAAAGG - Intergenic
1072937377 10:99726444-99726466 ATGATTTCTTTACCTGTAAATGG - Intronic
1072988955 10:100171350-100171372 ACGAATTCTACCCCTCTCAAAGG + Intronic
1074200975 10:111234915-111234937 AGAATTTCTTCTCCTCCCCAAGG - Intergenic
1076494891 10:130890637-130890659 AAGTTTTCCTCACCTATCAAGGG - Intergenic
1077704377 11:4470223-4470245 AGGATATGTTTACGTCTCAATGG + Intergenic
1078875615 11:15392555-15392577 AGGTTTTCTTGGCCTCTCAATGG - Intergenic
1079242519 11:18730507-18730529 ATGACTTCATCACCTCGCAAAGG - Intronic
1079321150 11:19452557-19452579 AGGATGTTTTCAACTCACAATGG - Intronic
1079387040 11:19989715-19989737 AGGATAACATCTCCTCTCAAAGG - Intronic
1079676294 11:23231120-23231142 AGGATTTCCCCACCACGCAATGG + Intergenic
1080801414 11:35613708-35613730 ATGATTTGATCACCTCCCAAAGG + Intergenic
1081079265 11:38719224-38719246 TGCATTTCTTAACCTCACAAAGG + Intergenic
1081407309 11:42712946-42712968 AGTTTTTCTACAGCTCTCAAGGG - Intergenic
1081615096 11:44586127-44586149 AGGGTTTCTTCAGTTCTCCAGGG - Intronic
1082964665 11:58954710-58954732 ACTTTTTCTTCACCTCTCACTGG - Intronic
1084433581 11:69124804-69124826 AGGATCTCTTGACTTCACAATGG + Intergenic
1085358226 11:75859599-75859621 ACAATTTCTTCATCTTTCAAAGG - Intronic
1086184702 11:83999254-83999276 AGGATTTTTTCACCTACCAATGG - Intronic
1087300966 11:96434914-96434936 AGGATTTCTTCATTTTTTAATGG + Intronic
1087429438 11:98033673-98033695 ATGATTTAATCCCCTCTCAAAGG - Intergenic
1087634759 11:100689604-100689626 AAGATTTCTTCACTTATGAATGG - Intronic
1088177062 11:107065701-107065723 AGGATGTCCACACATCTCAAAGG + Intergenic
1088424797 11:109691764-109691786 CCACTTTCTTCACCTCTCAAAGG - Intergenic
1088659715 11:112033533-112033555 GAGATTTCTTCAGCTCTTAATGG + Intronic
1088920396 11:114256751-114256773 AGGATTTCCACAACACTCAATGG + Intergenic
1089908720 11:122073611-122073633 ATGATTTCCTCACCTGTAAAAGG + Intergenic
1090810729 11:130239775-130239797 AGCATTTCGTTACCTCTTAAGGG - Intronic
1091848351 12:3675437-3675459 ATGATCTAATCACCTCTCAAAGG - Intronic
1091924548 12:4334384-4334406 AGGATCTAATCACCTCCCAAAGG + Intronic
1092112678 12:5975027-5975049 TGGTTTTCTTCTCCTCTCACAGG - Intronic
1093852992 12:24063691-24063713 AGTATTTCTTCACCTGTGACAGG - Intergenic
1094237616 12:28186680-28186702 ATGATTTAATCACCTCCCAAAGG - Intronic
1095288033 12:40439498-40439520 AGAATTCCTACACCTCTCTATGG - Intronic
1097289987 12:57906566-57906588 AGGATTTCATCATCACTCACTGG - Intergenic
1097815993 12:64074208-64074230 AAGGTTTCATCATCTCTCAATGG + Intronic
1098869752 12:75803333-75803355 AGGATTTTCTCAACTCTCTAGGG + Intergenic
1099513529 12:83567722-83567744 AGGACTTCTTTACCTCTCGCTGG - Intergenic
1099731783 12:86513377-86513399 ATGATTTCTTCATGTCTGAATGG + Intronic
1100015325 12:90003385-90003407 AGTTTTTCTTCACCTCTTATGGG + Intergenic
1101953771 12:109196543-109196565 ATGATCTCATCACCTCCCAAAGG + Intronic
1102614812 12:114144455-114144477 AGACTTTCTTCACCTGTCATTGG + Intergenic
1104513122 12:129399503-129399525 ATGATCTTCTCACCTCTCAAAGG + Intronic
1104647631 12:130508570-130508592 AGGGTTTCGTCACCTTGCAAGGG - Intronic
1105453433 13:20520344-20520366 ATGATTGCTTCCCCTCTCCAGGG - Intronic
1105791556 13:23805272-23805294 AGGCTTTTTTCATCACTCAAAGG - Intronic
1106362491 13:29045416-29045438 AGGACCTAATCACCTCTCAAAGG + Intronic
1106387467 13:29302000-29302022 ATGATTTAATCACCTCCCAAAGG + Intronic
1106554487 13:30798105-30798127 AGGGTTTCTTCACCTGTCTGTGG - Intergenic
1106885164 13:34176605-34176627 TGAATTTCTTCACCTCCCCAGGG - Intergenic
1108091843 13:46857510-46857532 ATGATTTAACCACCTCTCAAAGG + Intronic
1111654833 13:91139426-91139448 AGGATTTCATTACATCTCACTGG - Intergenic
1112325779 13:98442014-98442036 AAGCTTTCTTCATCTCTCACTGG + Intronic
1112604630 13:100891707-100891729 AGGATTCTTTCACCTATCAAAGG - Intergenic
1112855484 13:103764680-103764702 AGTGTCTCTTCAACTCTCAAAGG - Intergenic
1114350534 14:21845564-21845586 ACCATTTCTACACCTCTCACAGG + Intergenic
1114908841 14:27166662-27166684 ATGATTTATTCACCTCCAAAAGG + Intergenic
1115171436 14:30512266-30512288 ATGATTTATTCACCTCCCAAAGG + Intergenic
1117180410 14:53185583-53185605 ATGATTTAATCATCTCTCAAAGG + Intergenic
1117831619 14:59757186-59757208 ATGATCTCCTCACCTCCCAAAGG - Intronic
1117833907 14:59781987-59782009 ATGATCTCATCACCTCCCAAAGG - Intronic
1119744848 14:77036871-77036893 TCCATTTCTTCACCTGTCAAAGG + Intergenic
1120811433 14:88807646-88807668 AGGATATTTTCCCCTCTCTAGGG - Intergenic
1121207928 14:92185072-92185094 AGGATCTCTTGACCTGTCACAGG - Intergenic
1125296486 15:38208850-38208872 CAGATTTCTTCACCTCTCTAAGG - Intergenic
1128171601 15:65518169-65518191 ATAATTTCTTTACCTCTAAAAGG + Intergenic
1128361446 15:66964610-66964632 GGGATTTCTTCCTCTCTCAGAGG + Intergenic
1128728681 15:70006320-70006342 AGGATTTCTCCACCTGTCAGGGG - Intergenic
1130209081 15:81906755-81906777 ATGATTTGTACACTTCTCAAAGG + Intergenic
1130585061 15:85174249-85174271 AGGAACTTTTCACCCCTCAAGGG + Intergenic
1130971536 15:88737525-88737547 ATGATCTCATCACCTCCCAAAGG - Intergenic
1131689817 15:94814612-94814634 ATTAATGCTTCACCTCTCAACGG - Intergenic
1131752812 15:95527625-95527647 ATGACTTAATCACCTCTCAAAGG + Intergenic
1133639721 16:7705085-7705107 AGCATCTCTTCATCTCTCTAGGG + Intronic
1133717573 16:8464364-8464386 ATGATTTCTCCAACTCTCTATGG + Intergenic
1134638548 16:15811054-15811076 ATGATCTCATCACCTCCCAAAGG - Intronic
1137266128 16:46870475-46870497 AGCATTTCTTCATCTCTGAGAGG + Intergenic
1138261963 16:55630253-55630275 AGAATATCTTCTCCTCCCAAAGG - Intergenic
1138395753 16:56703468-56703490 AGGATTTCTTGACTTTACAATGG - Intronic
1138798743 16:60000810-60000832 ATGATTTAATTACCTCTCAATGG - Intergenic
1140971641 16:80019326-80019348 AGGCTTTGTTCACATCTCATTGG - Intergenic
1142170220 16:88617963-88617985 AGGGTTTCTTAACCTTTCTAGGG - Intronic
1144000178 17:11046687-11046709 AGGGTTTCTTTAACTCTAAAAGG + Intergenic
1144535662 17:16087483-16087505 AGGATTTCTTAACTTCTCTGTGG - Intronic
1148334152 17:46830488-46830510 AGGAGATCCTCCCCTCTCAAAGG + Intronic
1150220098 17:63491243-63491265 ATGATTTCTTCACCTCCCTGGGG + Exonic
1154495946 18:14961247-14961269 ATGATCTAATCACCTCTCAAAGG + Intergenic
1155259310 18:24025962-24025984 AGGGGCTCTTTACCTCTCAAGGG - Intronic
1155293931 18:24368575-24368597 TCGATGTCTTCACCTCTAAAGGG + Intronic
1156249515 18:35338992-35339014 AGGTTTTCTTCACATCTGAGGGG - Intronic
1157923175 18:51734510-51734532 AGGATTTATTCATCTCTCAATGG - Intergenic
1158474362 18:57766838-57766860 AGGCTTTCTTGACCTCTCCTAGG - Intronic
1160235149 18:77079704-77079726 TTGATTTCTTTATCTCTCAAAGG + Intronic
1161179667 19:2871444-2871466 AGAATTTATTCACCTTACAATGG - Intronic
925098184 2:1224140-1224162 AGGACCTCATCACCTCTCAAAGG + Intronic
927614901 2:24583353-24583375 AGGATTATTTCACCTCAGAATGG + Intronic
930986899 2:57600323-57600345 TGGTTTCCTGCACCTCTCAAGGG - Intergenic
932941312 2:76170067-76170089 ATGATCTATTCACCTCCCAAAGG - Intergenic
933795263 2:85914503-85914525 ATGACCTATTCACCTCTCAAAGG + Intergenic
935609598 2:105007295-105007317 AGGCTCTCTTCTCCTCTCAGAGG - Intergenic
936287491 2:111191967-111191989 ATGACGTCTTCACCTCCCAAAGG - Intergenic
936613967 2:114030412-114030434 AAGGTTTCTTCACTTCTTAAGGG + Intergenic
937494167 2:122400418-122400440 ATGATCTAATCACCTCTCAAAGG - Intergenic
937998680 2:127714603-127714625 GGGTTTTCTGCACCTCTCTATGG + Intronic
938174504 2:129112419-129112441 AGGATTTCATCACCTCCCAGAGG + Intergenic
938649840 2:133371592-133371614 AATATTTCTTCAACTCTGAATGG + Intronic
938713769 2:133999900-133999922 AGGATCTAATCACCTCTTAAAGG + Intergenic
938856503 2:135317701-135317723 AGGATTTCCTCACTGCTCCAGGG + Intronic
939283605 2:140099366-140099388 ATCCTTTCTTCAGCTCTCAAGGG - Intergenic
940786919 2:157991115-157991137 ATGATTTAATCACCTCCCAAAGG + Intronic
940848945 2:158670416-158670438 ATGATCTAATCACCTCTCAAAGG + Intronic
940936620 2:159502641-159502663 AGAATATCTGCATCTCTCAATGG + Intronic
941696604 2:168559590-168559612 ATGATCTCATTACCTCTCAAAGG + Intronic
942163962 2:173223105-173223127 TGGTATTTTTCACCTCTCAAGGG - Intronic
942836750 2:180308280-180308302 ATCTTTCCTTCACCTCTCAAAGG - Intergenic
944116425 2:196191865-196191887 AGGATCTAGTCACCTCTCGAAGG + Intergenic
944135523 2:196395076-196395098 ATGACCTCATCACCTCTCAAAGG + Intronic
944326849 2:198415921-198415943 AGGAATTTTTCACATTTCAATGG + Intronic
947336151 2:229086215-229086237 ATGATATTTTCACCTTTCAATGG - Intronic
948215649 2:236228269-236228291 TGGATTTCTCAACCTCCCAAAGG + Intronic
948606689 2:239140436-239140458 AAGATCCCTTCACCTCTGAAGGG + Intronic
948668386 2:239550766-239550788 ATGACTTCATCACCTCCCAATGG + Intergenic
1169972161 20:11279628-11279650 AGAATTTCTTCACCCCCAAAAGG - Intergenic
1170409917 20:16077917-16077939 AGGATCCCAGCACCTCTCAAAGG - Intergenic
1174184091 20:48693362-48693384 CTGACTTCTTCATCTCTCAAAGG - Intronic
1174634552 20:51987749-51987771 ATGATGTAATCACCTCTCAAAGG - Intergenic
1174902740 20:54517739-54517761 ATGACTTCATCACCTCCCAAAGG - Intronic
1178279849 21:31272017-31272039 AGGATATTTTCACCTTACAATGG - Intronic
1178776377 21:35554940-35554962 AGGGTTTCTGTACCTCTAAATGG - Intronic
1179350060 21:40600444-40600466 ATGATTTAATCACCTCTCAAAGG + Intronic
1179801827 21:43814806-43814828 AGGTTTTCCCCACATCTCAATGG - Intergenic
1180943894 22:19679166-19679188 ACGACCTCTTCACCTCCCAAGGG - Intergenic
1183803606 22:40189565-40189587 AGGATTTCTTAACGTCTTTAGGG + Intronic
949181483 3:1136484-1136506 AGGATTTCTGTATCTCTCCAGGG - Intronic
953579038 3:44136783-44136805 AGGATTTCTTCAAATGCCAAAGG + Intergenic
953965425 3:47301461-47301483 AGAGTTTCTTCAACTATCAATGG - Intronic
954406636 3:50348892-50348914 AGGATTTCTTCAACTCACAGTGG - Exonic
954469476 3:50679765-50679787 ATGATGTCTTTACCTCTAAAGGG - Intronic
955942416 3:64158922-64158944 AACATATCTTCAGCTCTCAAGGG + Intronic
956011643 3:64838082-64838104 AAGATTTCTTAACCTCTTATGGG - Intergenic
957737979 3:84226694-84226716 AGAATTTCCCCTCCTCTCAAAGG + Intergenic
957927932 3:86839203-86839225 ATGATTTAATCACCTCTCAAAGG + Intergenic
960217239 3:115056344-115056366 AAGAATTCTTTACCTCTCACAGG - Intronic
960402696 3:117222641-117222663 ATGATCTAATCACCTCTCAAAGG + Intergenic
962674173 3:137741517-137741539 AGAGTTTCTTTAACTCTCAATGG + Intergenic
964605386 3:158555286-158555308 CGTAGATCTTCACCTCTCAATGG - Intergenic
965099248 3:164275434-164275456 AAGATTTCTACACCTGGCAAAGG + Intergenic
966097067 3:176216776-176216798 TTCATTCCTTCACCTCTCAATGG + Intergenic
967123444 3:186404454-186404476 AGGACTTCATCACTTCCCAAAGG - Intergenic
967570579 3:191023548-191023570 AAGATTTAGTCACCTCTTAAAGG - Intergenic
969144795 4:5113140-5113162 AAGATCTGATCACCTCTCAAAGG - Intronic
969425656 4:7122376-7122398 ATGATGTCCTCACCTCTGAATGG + Intergenic
970726089 4:19046538-19046560 ATGAACTCTTCACATCTCAAGGG + Intergenic
971868402 4:32203702-32203724 ATGATGTCATCACCTCTAAAAGG - Intergenic
972712791 4:41614771-41614793 ATGATTACTTAACTTCTCAAAGG - Intronic
972840128 4:42921102-42921124 AGGATCTCATCATCTCCCAAAGG - Intronic
973186917 4:47340648-47340670 ATGATTTAATCACCTCCCAAAGG + Intronic
973764372 4:54149775-54149797 AGCATGTTGTCACCTCTCAATGG + Intronic
974162316 4:58155786-58155808 AGGATTTTTTCTTCTCTCTAAGG - Intergenic
974304610 4:60117600-60117622 AGGACCTCATCACCTCCCAAAGG + Intergenic
975140539 4:70914023-70914045 AAGATCTCTTCACCACCCAAAGG - Intronic
975667037 4:76742179-76742201 AGGAAGTCACCACCTCTCAATGG + Intronic
975715412 4:77200946-77200968 AAGATTTCTATACCTCTCACAGG + Intronic
977876581 4:102157067-102157089 ATGACTTAATCACCTCTCAAAGG - Intergenic
978105017 4:104891869-104891891 AATATTTCTCCAGCTCTCAATGG + Intergenic
978442366 4:108746851-108746873 AGTTTTTCTTCACCTCTCGCAGG - Exonic
978667977 4:111209675-111209697 AGCATTTCTTCCCATCTCCATGG - Intergenic
979935342 4:126687043-126687065 AGTAGTTCTTCAGCTATCAAAGG + Intergenic
980841325 4:138264878-138264900 ATGATTTATTCACCTCTCTGAGG - Intergenic
980880468 4:138704898-138704920 AGGTTTTCTTCTCCTCTTGAAGG - Intergenic
984389054 4:179103630-179103652 AGGATTTATTCAGCTTTAAAAGG + Intergenic
984820887 4:183881168-183881190 AAGATTTCCTCACCTCTTGATGG - Intronic
986322456 5:6643808-6643830 AGGATTTCTTCACAAAACAAAGG - Intronic
986503659 5:8427823-8427845 AGGATTCAATCACCTCTCACTGG + Intergenic
986662550 5:10072401-10072423 AGGACCTCATCACCTCCCAATGG + Intergenic
987860564 5:23482125-23482147 AAGATTTCTTCACATCTTTAAGG - Intergenic
988288579 5:29255001-29255023 AAGATTTAGTCACCTCCCAAGGG + Intergenic
988420374 5:30998822-30998844 AGCATTTCTTAATCTATCAATGG + Intergenic
989718969 5:44502329-44502351 AGGTTTTCATCTCCTCTCAGTGG - Intergenic
990365691 5:55067859-55067881 AGGAGAACTTCCCCTCTCAATGG + Intergenic
990969867 5:61493511-61493533 AAGATTTCTTGAGTTCTCAATGG + Intronic
992458070 5:76934544-76934566 ATGATTTAGTCACCTCCCAAGGG - Intergenic
993148488 5:84128212-84128234 ATGATTTCCTGAGCTCTCAAGGG - Intronic
996966784 5:129315944-129315966 AGCATGTCTTTACCTCACAAAGG + Intergenic
997995380 5:138581741-138581763 ATGATTTAATCACCTCCCAAAGG - Intergenic
998908737 5:146935179-146935201 ATGATCTAGTCACCTCTCAAAGG - Intronic
999017744 5:148126908-148126930 AGGATTGCTTAACTTCTCACTGG + Intronic
999905753 5:156139855-156139877 ATGATTTAGTCACCTCCCAAAGG - Intronic
1000310958 5:160044272-160044294 AGGATTCCTGGACCTCTCACAGG + Intronic
1000344659 5:160304703-160304725 TGGATTTCTGCATCCCTCAAGGG - Intronic
1003973482 6:11321503-11321525 AGATTTTCTTTGCCTCTCAAGGG + Intronic
1004653943 6:17639977-17639999 AGGATTTCTGCAGGTCTAAAAGG + Exonic
1004657711 6:17680331-17680353 AGGATTTCAAGACCACTCAATGG + Intronic
1005173259 6:23012691-23012713 AGTCTTTGTTCACCTCTTAATGG - Intergenic
1005787451 6:29260448-29260470 ATGATTTAATCACCTCCCAAGGG + Intergenic
1006214421 6:32427861-32427883 AGGATTTTTTGACTTTTCAATGG - Intergenic
1008189019 6:48431636-48431658 AGGATCTCATCACCTCCTAAAGG - Intergenic
1009633445 6:66231376-66231398 ATGATTTAATCACCTCTGAAAGG + Intergenic
1009679070 6:66868538-66868560 TGGATTTCTTCATCTATGAAAGG + Intergenic
1010551930 6:77234278-77234300 ATGATTTGATCACCTCCCAAAGG - Intergenic
1011221311 6:85057187-85057209 AAGATATAATCACCTCTCAAAGG + Intergenic
1011627979 6:89298814-89298836 AGGATCTCATCACCTTCCAAAGG - Intronic
1012414593 6:98999476-98999498 ATGATTTAATCACCTCCCAAAGG - Intergenic
1012471007 6:99572093-99572115 AGGATTTCTTCAACTCTCTCAGG + Intergenic
1012664553 6:101951231-101951253 AGGATTTCTTCACACTTCATGGG - Intronic
1012864785 6:104605580-104605602 AATATTTCATCACCTCTCTATGG - Intergenic
1013260543 6:108437112-108437134 AGGACTTAATCACCTCCCAAAGG + Intronic
1014028742 6:116678038-116678060 ATGATGTAATCACCTCTCAAAGG + Intergenic
1014252983 6:119133709-119133731 AGAATTACTTCACCTCAGAAGGG + Intronic
1014489458 6:122044285-122044307 AGAGTTTGTTCATCTCTCAAAGG - Intergenic
1014539590 6:122658459-122658481 TGGATTTATTAACATCTCAAGGG - Intronic
1017624350 6:156332929-156332951 AGAATTTCTTCACTTCTCTGTGG + Intergenic
1017953338 6:159157170-159157192 AGGTTTTTTTGACCTCTCACTGG + Intergenic
1018170719 6:161141093-161141115 AGGCTTTCTTGGCCTCTCAGAGG + Intronic
1018388359 6:163324719-163324741 AGGATTTTTACAGCTCTCATAGG + Intergenic
1018502837 6:164430732-164430754 TGATTTTCATCACCTCTCAAGGG - Intergenic
1019199765 6:170305094-170305116 ATGATTTATTCACTTCCCAAAGG + Intronic
1021846789 7:24770792-24770814 AGGATTTCTTCTTTTCTCAGTGG - Intergenic
1022634424 7:32118756-32118778 ATGACTTAATCACCTCTCAAAGG + Intronic
1023262520 7:38372458-38372480 AGAATTTCCTCACCTCTAAATGG + Intergenic
1023428670 7:40067145-40067167 ACGAATTCTTCACCTCTCTAAGG - Intronic
1024800916 7:53077004-53077026 ATGTTTTCTTCATCTCTCACGGG - Intergenic
1025244425 7:57305521-57305543 AGAAATTCTGCACCCCTCAAGGG - Intergenic
1026186482 7:68085620-68085642 ATGATGTAATCACCTCTCAAAGG - Intergenic
1026467830 7:70669704-70669726 ACGATGACTTCAACTCTCAAAGG - Intronic
1026627597 7:72010196-72010218 AGGATCTAATCAGCTCTCAAAGG - Intronic
1028721266 7:94034654-94034676 ATGACTTAATCACCTCTCAAAGG - Intergenic
1030253998 7:107486265-107486287 TTGATTTCTTCACCTCACAGTGG - Intronic
1030326903 7:108229537-108229559 ATGAGTTCTTCACCTCTGGAGGG + Intronic
1030712119 7:112761558-112761580 AGGATTTCTTTACTACTAAAAGG + Intergenic
1031684916 7:124721431-124721453 ATGATCTAATCACCTCTCAAAGG + Intergenic
1032741696 7:134746197-134746219 ATGATTTAGTCACCTCCCAAAGG - Intronic
1033498969 7:141928459-141928481 AGCCTTTCTTCCCTTCTCAACGG + Exonic
1034318609 7:150158455-150158477 ACAATTTCTTCATCTATCAATGG - Intergenic
1034774142 7:153808773-153808795 ACAATTTCTTCATCTATCAATGG + Intergenic
1034998816 7:155595163-155595185 ATGATCTCATCACCTCCCAAAGG - Intergenic
1035910159 8:3557553-3557575 AGGACTTGCTCACCTCTAAAAGG - Intronic
1037571674 8:20163280-20163302 ATGATCTCATCATCTCTCAAAGG + Intronic
1038036658 8:23691805-23691827 AGGCTCCCTTCCCCTCTCAAGGG + Intergenic
1039014425 8:33130031-33130053 AGGACCTAATCACCTCTCAAAGG + Intergenic
1039265923 8:35823714-35823736 AAGATTTGTTGACATCTCAAAGG + Intergenic
1040794720 8:51276493-51276515 ATGACTGCTTCTCCTCTCAATGG + Intergenic
1042004168 8:64162582-64162604 AGCATACCTTTACCTCTCAAAGG + Intergenic
1043345285 8:79291067-79291089 AAGGTTTCTTCATCTCTGAAGGG + Intergenic
1043726053 8:83611644-83611666 AGCATGTTGTCACCTCTCAAAGG + Intergenic
1043788605 8:84433960-84433982 ATGATGTCTTCCCTTCTCAAGGG + Intronic
1044083912 8:87920037-87920059 AGGATTCTTTCACCTCTGAGTGG - Intergenic
1044398935 8:91747377-91747399 AAGTTTTCTTCACCTCACCAAGG - Intergenic
1044484478 8:92735008-92735030 AGGGTGTCTGCACCTCTAAATGG + Intergenic
1046359765 8:113135038-113135060 ATGATTTAATCACCTCTTAAAGG + Intronic
1047553288 8:125900321-125900343 ATGATTCCATCACCTCTTAAAGG - Intergenic
1048431359 8:134374526-134374548 ATGATATCATCACCTCCCAAAGG - Intergenic
1050494968 9:6230930-6230952 ACTATTTCTTCACTTCTAAAAGG + Intronic
1050853684 9:10322804-10322826 TGGATTTCTTCACCTTTCCCAGG - Intronic
1050971613 9:11883786-11883808 ATGATCTAATCACCTCTCAAAGG - Intergenic
1052124090 9:24754602-24754624 AGTTTTCCTTCACCTCTCATTGG + Intergenic
1055836939 9:80454945-80454967 ATGATTTATTCATCTCCCAAAGG + Intergenic
1056775807 9:89511888-89511910 ACAACTTCATCACCTCTCAAAGG - Intergenic
1057692563 9:97298352-97298374 TGAATTTCTTCTTCTCTCAAAGG - Intergenic
1057896077 9:98909733-98909755 AGGATTTCCTCCCCTCTGGATGG + Intergenic
1059725505 9:117004577-117004599 AGGATTTCTTCACCTCTCAATGG - Intronic
1061532851 9:131228467-131228489 AGGATTCCTGTACCTCTCCAGGG + Intronic
1185575047 X:1164651-1164673 CGGTTTTCTTCATCTCTGAATGG + Intergenic
1185842414 X:3404285-3404307 AGCATTTCTTCTCTGCTCAAGGG + Intergenic
1185860962 X:3578995-3579017 AGAATCTCATCACCTCCCAAAGG - Intergenic
1186268957 X:7864383-7864405 ATGATCTCATCACCTCCCAAAGG - Intergenic
1186313914 X:8348612-8348634 ATGATCTCATCACCTCCCAAAGG + Intergenic
1187178163 X:16915697-16915719 ATGATCTCATCACCTCCCAAAGG - Intergenic
1187476721 X:19617799-19617821 GTGATTTCTTCAGCTCTCCAGGG - Intronic
1188382062 X:29507032-29507054 AGAGTTTCTTCACTTCTCTATGG + Intronic
1188959601 X:36474480-36474502 AGGATTACTTCACCTATCTCTGG + Intergenic
1189875669 X:45433677-45433699 AGCATTTCTTCACCTGTCCTGGG - Intergenic
1190226123 X:48546577-48546599 AGGACTTAATCACCTCTTAAAGG + Intronic
1190346655 X:49343550-49343572 AGGATTTAATCACCTCCTAAAGG - Intronic
1190347903 X:49534578-49534600 AGGATTTAATCACCTCCTAAAGG - Intronic
1190349004 X:49544134-49544156 AGGATTTAATCACCTCCTAAAGG - Intronic
1190350107 X:49553690-49553712 AGGATTTAATCACCTCCTAAAGG - Intronic
1190351210 X:49563249-49563271 AGGATTTAATCACCTCCTAAAGG - Intronic
1190352310 X:49572801-49572823 AGGATTTAATCACCTCCTAAAGG - Intronic
1190353411 X:49582350-49582372 AGGATTTAATCACCTCCTAAAGG - Intronic
1190354512 X:49591872-49591894 AGGATTTAATCACCTCCTAAAGG - Intronic
1190355617 X:49601427-49601449 AGGATTTAATCACCTCCTAAAGG - Intronic
1190603686 X:52118665-52118687 AGTATTCCTTTACCTCTCCAAGG - Intergenic
1192295321 X:69841695-69841717 ACTATTTATTCAGCTCTCAATGG - Intronic
1193732195 X:85115240-85115262 AGGATTTCTCCTCCTCCCAAAGG + Intergenic
1195511765 X:105723825-105723847 ATGATTTAATCACTTCTCAAAGG + Intronic
1198746966 X:139900887-139900909 ATGATCTAATCACCTCTCAAAGG - Intronic
1200972624 Y:9171373-9171395 AGGTTTTCTTCATTTCTCCAAGG + Intergenic
1201233029 Y:11883976-11883998 AGCATTTCTTCTCTGCTCAAGGG - Intergenic
1201308978 Y:12577324-12577346 AGGATCCCTTCAGGTCTCAAAGG - Intergenic
1201492287 Y:14555456-14555478 ATGACTTCATCACCTCCCAAGGG + Intronic
1201746877 Y:17385882-17385904 ATGACTTCTTCACCTCCAAAAGG - Intergenic
1202138390 Y:21692840-21692862 AGGTTTTCTTCATTTCTCCAAGG - Intergenic