ID: 1059728008

View in Genome Browser
Species Human (GRCh38)
Location 9:117028202-117028224
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059728005_1059728008 -4 Left 1059728005 9:117028183-117028205 CCAGAGTTAAAGCCAGGGAGTGA 0: 1
1: 0
2: 0
3: 15
4: 111
Right 1059728008 9:117028202-117028224 GTGAATAAACAGAAGGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr