ID: 1059733701

View in Genome Browser
Species Human (GRCh38)
Location 9:117081217-117081239
Sequence GAGAACAGCTGAGAGACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 308}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059733701_1059733702 -6 Left 1059733701 9:117081217-117081239 CCTGCAGTCTCTCAGCTGTTCTC 0: 1
1: 0
2: 1
3: 30
4: 308
Right 1059733702 9:117081234-117081256 GTTCTCATGACAAATGCCCCTGG No data
1059733701_1059733708 21 Left 1059733701 9:117081217-117081239 CCTGCAGTCTCTCAGCTGTTCTC 0: 1
1: 0
2: 1
3: 30
4: 308
Right 1059733708 9:117081261-117081283 TGGCATCTGTTTTCTTCACGTGG No data
1059733701_1059733703 -5 Left 1059733701 9:117081217-117081239 CCTGCAGTCTCTCAGCTGTTCTC 0: 1
1: 0
2: 1
3: 30
4: 308
Right 1059733703 9:117081235-117081257 TTCTCATGACAAATGCCCCTGGG No data
1059733701_1059733704 1 Left 1059733701 9:117081217-117081239 CCTGCAGTCTCTCAGCTGTTCTC 0: 1
1: 0
2: 1
3: 30
4: 308
Right 1059733704 9:117081241-117081263 TGACAAATGCCCCTGGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059733701 Original CRISPR GAGAACAGCTGAGAGACTGC AGG (reversed) Intronic
901345337 1:8535797-8535819 GAGAAAAGCGGACAGCCTGCAGG + Intronic
901439218 1:9267387-9267409 AAGAACAGATGGGAGAGTGCTGG - Exonic
901492664 1:9604470-9604492 GGCAACAGCTGAGAGAGTGCAGG + Intronic
901970870 1:12906886-12906908 GAGATCAGCTGATAGTCTGATGG - Intronic
902014295 1:13294884-13294906 GAGATCAGCTGATAGTCTGATGG + Intergenic
904382055 1:30118262-30118284 TGGAACATCTGGGAGACTGCTGG - Intergenic
904859131 1:33521571-33521593 GAGAGCAGGTGGGAGGCTGCTGG + Intronic
904969253 1:34406221-34406243 GAGCACAGATGACAGACTGGGGG + Intergenic
905178062 1:36150425-36150447 TTGACCAGCTGAGAGACCGCGGG - Intronic
905242658 1:36590915-36590937 CAGAACAGCTGACAGATTGCAGG + Intergenic
905455830 1:38087329-38087351 GAGAGCACCTGAGACACAGCTGG - Intergenic
905841003 1:41178017-41178039 GAGAACAGCTGTTAGTCTGATGG - Intronic
906203739 1:43975890-43975912 GAGAAAAGAAGAGAGGCTGCAGG - Intronic
909075832 1:71048893-71048915 GAGAATTGCTGAGAGACTTCAGG - Intergenic
910150201 1:84133682-84133704 GAGCACAGCTGAGCCAGTGCAGG + Intronic
910265265 1:85331878-85331900 GAAAACACCTGAGATACTGAAGG + Intronic
911429102 1:97760687-97760709 AAGAACAACTGAGATACTTCAGG + Intronic
912023413 1:105137536-105137558 AAGAACACTTGAGAGACAGCAGG + Intergenic
912023644 1:105138980-105139002 AAGAACACTTGAGAGACAGCAGG - Intergenic
912373430 1:109191282-109191304 GACAACAGCAGAGCGTCTGCTGG - Intronic
912681037 1:111729302-111729324 GAGAACAGCTGAGAGAGGACAGG - Intronic
912683984 1:111747632-111747654 GAGCACAGCTGAGATACTGTTGG - Intronic
915642576 1:157240496-157240518 GCTAGCAGCTGTGAGACTGCAGG + Intergenic
917142737 1:171853684-171853706 GAGGACAGCTGAGACTCTGATGG - Intronic
917724036 1:177812824-177812846 GAGCACAGCAGACACACTGCCGG - Intergenic
918897948 1:190372090-190372112 GGGAAGAGGTGAAAGACTGCAGG + Intronic
919538628 1:198820480-198820502 GAGTTCAACTGAGAGACAGCAGG + Intergenic
920117153 1:203629040-203629062 GGCTACAGCTGAGACACTGCGGG + Intronic
921240217 1:213172679-213172701 GAGAAGAGTTGTGAGACTGTGGG + Intronic
922629235 1:227087833-227087855 AAAAACAGCTGATAGACTTCTGG - Intronic
922780009 1:228244517-228244539 GAGTACAGCTGTGAGGCTGGGGG + Exonic
922780128 1:228245634-228245656 GAGTACAGCTGCGAGGCTGGGGG + Exonic
922783564 1:228272167-228272189 GAGTACAGCTGCGAGGCTGGGGG + Exonic
1063128216 10:3154063-3154085 GAGAGCAGATGAGAAGCTGCTGG - Intronic
1063182092 10:3612540-3612562 GGGAACAGCTGATACACTGTTGG + Intergenic
1063611176 10:7563197-7563219 GGGAAGAGCAGATAGACTGCTGG - Exonic
1065070234 10:22015663-22015685 GACAACAGATGAGAGACAGAAGG + Intergenic
1066540362 10:36440214-36440236 GAGAAAAGATGAGAGACTTTAGG - Intergenic
1067230954 10:44410068-44410090 GAGATCAGCTGTGAGTCTGATGG + Intergenic
1068296820 10:55081138-55081160 GAGATCAGCTGGGAGCCTGAAGG - Intronic
1068577519 10:58700752-58700774 GGGAGCAGCTCAGAGCCTGCTGG + Intronic
1069107556 10:64402117-64402139 GAGAAGACCTGAAAGAGTGCTGG - Intergenic
1071051885 10:81460222-81460244 GAGCACAGCAGAGACCCTGCTGG - Intergenic
1072805072 10:98418959-98418981 GAGGAAAGCTGGGAGCCTGCAGG + Intronic
1072958255 10:99906019-99906041 GAGAACAACTGAGATCCAGCTGG + Intronic
1073042873 10:100619145-100619167 GAGATCTCCTGAGAGTCTGCAGG - Intergenic
1073311593 10:102546695-102546717 GAGAACTTCTGACAGACTTCAGG + Intronic
1073520081 10:104120655-104120677 GAGAACTGGTGAGAGGCAGCTGG - Intergenic
1075618945 10:123911611-123911633 GAGAGAAGCTGAGAGACTTCAGG + Intronic
1075705336 10:124497190-124497212 GAGGACAGCTGAGGGCCTGAGGG - Intronic
1075875970 10:125805945-125805967 GGGAACAGCAGAGATACTGCTGG - Intronic
1076501836 10:130943331-130943353 AAGAACAGCTGGAAGACTACTGG + Intergenic
1076532743 10:131155574-131155596 GAGGAAAGCTGGGACACTGCTGG - Intronic
1077322625 11:1949130-1949152 GTGACCAGCTGTGGGACTGCAGG - Intronic
1077515196 11:2997299-2997321 GGCCACAGCTGGGAGACTGCAGG + Intergenic
1078448928 11:11425998-11426020 GAGCACAGCTCTGAGCCTGCTGG - Intronic
1078463526 11:11533318-11533340 TTGACCAGCTGTGAGACTGCTGG - Intronic
1078917723 11:15795628-15795650 CAGAGCAGCTGACAGGCTGCTGG + Intergenic
1079129956 11:17741533-17741555 GAGAGCAGCTGGGGGGCTGCCGG - Intronic
1080168645 11:29271709-29271731 CAAAAAGGCTGAGAGACTGCAGG - Intergenic
1081763525 11:45593421-45593443 GAGCACAGCTTTGAAACTGCTGG - Intergenic
1083328949 11:61888259-61888281 GAGAACAGCTGATGGGCAGCCGG + Intronic
1083433882 11:62629755-62629777 GAAAACAGCCCAGAGACTGAGGG - Intronic
1084080298 11:66818915-66818937 TACAACAACTGAGATACTGCAGG - Intronic
1085037112 11:73307513-73307535 GAGAAGAGCCGCCAGACTGCAGG + Intergenic
1088318595 11:108532055-108532077 GAGAACAAATGGAAGACTGCAGG - Intronic
1088529560 11:110793837-110793859 GGGAAGAGCTGAGAGTCTGCAGG + Intergenic
1089189837 11:116645600-116645622 AAGAACAGTTGAGAGTATGCTGG + Intergenic
1089393383 11:118117276-118117298 GAGACCAGAACAGAGACTGCTGG - Intronic
1089653889 11:119933137-119933159 GAGAGCAGGTGAGATTCTGCAGG - Intergenic
1089756823 11:120693464-120693486 GAGACCAGTTAAGAGACTGTTGG + Intronic
1090542409 11:127722625-127722647 TAGAACAGCTAAGAGACAGTAGG + Intergenic
1091052469 11:132385180-132385202 GAGATCAGCTGTTAGTCTGCTGG - Intergenic
1202805642 11_KI270721v1_random:4443-4465 GTGACCAGCTGTGGGACTGCAGG - Intergenic
1091427098 12:400593-400615 GAGAAAGGCAGGGAGACTGCTGG + Intronic
1094661767 12:32476179-32476201 GACAACAGCTAGAAGACTGCTGG - Intronic
1095239534 12:39840278-39840300 GAGCCCAGCTGAGAGATGGCTGG - Intronic
1096419279 12:51442494-51442516 GAGATCAGCTGAGTAACTGGCGG + Intronic
1099996537 12:89785373-89785395 CCCAACAGCTGAGAGACTGAGGG - Intergenic
1100533996 12:95488553-95488575 AAGAAAATCTGAGAGACTACTGG - Intronic
1105425783 13:20293641-20293663 GAGAACAGATGAGTGACTGCGGG - Intergenic
1108518911 13:51227189-51227211 CAGAGCATCTGAGAGACTACAGG + Intronic
1109523576 13:63545085-63545107 GAGCACAGCTGACACCCTGCTGG + Intergenic
1111485769 13:88896430-88896452 GAGAAAAGCTGTGGGACTTCAGG + Intergenic
1112123952 13:96444065-96444087 AAGAAAAGCTGAGAGATGGCAGG + Intronic
1113314822 13:109167452-109167474 GAAAACAGCTGAGTGGTTGCTGG + Intronic
1114217700 14:20669230-20669252 GAGATCAGCTGATAGAGTGGAGG - Intergenic
1115879468 14:37899025-37899047 GGGAAGAGCTGAGTGACTGATGG + Intronic
1116482940 14:45413179-45413201 GAGATCAGCTGATAGTCTGATGG - Intergenic
1116978869 14:51146710-51146732 GAGAGCAGCTGAGTGGCTGAAGG + Intergenic
1117691666 14:58313734-58313756 GAGAAGATCTGAGGGACTGCTGG + Intronic
1118987320 14:70767628-70767650 GAGATAAGCTGAGAGTCTTCAGG - Intronic
1120940527 14:89943867-89943889 GAGTACAGCTGGGAGAATACAGG + Intronic
1121631044 14:95422193-95422215 GAGAACAGCTCGCAGACAGCAGG - Intronic
1121633234 14:95436708-95436730 GAGAACAGCTCACAAACTGTGGG + Intronic
1125529909 15:40406236-40406258 GAGAGCTCCTGAGAGACTGATGG + Intronic
1127059047 15:55163376-55163398 GAAAACAGCTAAGAGAATGGAGG + Intergenic
1128360694 15:66959540-66959562 GAGACCAGCTCAGAGACTAGAGG - Intergenic
1129170519 15:73804656-73804678 GGGAACAGCTCAGCCACTGCTGG + Intergenic
1130536037 15:84785646-84785668 AAGAACAGCTGTGTCACTGCAGG - Intronic
1130800090 15:87254107-87254129 GAGAACAGCTGTTAGTCTGATGG + Intergenic
1131182446 15:90249776-90249798 GAGGAGAGCTGAGGGGCTGCTGG - Exonic
1131814849 15:96211686-96211708 GAGAACAGGTGAGTGGGTGCAGG - Intergenic
1131839869 15:96425626-96425648 TAGAACAGTTGAGAGACAACTGG + Intergenic
1132604142 16:786669-786691 GTGAGAAGCTGAGAGGCTGCAGG + Intronic
1133516073 16:6510476-6510498 GAGACCAGGTGAGGGACAGCAGG + Intronic
1134015042 16:10882397-10882419 GAGGGCAGCTGAAAGACTTCAGG + Intronic
1135045221 16:19149828-19149850 GAAAAAAGGTGAGAGATTGCAGG + Intronic
1135570971 16:23549172-23549194 GTGAAGAGCTGAGACAGTGCTGG + Intronic
1136025893 16:27469018-27469040 GAGCCCACCTGAGTGACTGCTGG + Intronic
1138149427 16:54642154-54642176 GACCACAGCAGAGAGACTGTGGG - Intergenic
1138910616 16:61393813-61393835 AGGAACAGCTGAGAAACTTCTGG + Intergenic
1139958727 16:70705667-70705689 GAGAGCAGCTGAGGGCATGCCGG - Intronic
1141126539 16:81404585-81404607 GAGGACAGTTAGGAGACTGCTGG - Intergenic
1141838062 16:86555575-86555597 GTGAGCACCTGAGAGTCTGCAGG - Intergenic
1143400263 17:6638730-6638752 GAGAAGAGCTGAGCCACAGCGGG - Intronic
1146866387 17:36338508-36338530 GAGAACAGAAGAGAGCCTACTGG + Intronic
1147069257 17:37939120-37939142 GAGAACAGAAGAGAGCCTACTGG + Intergenic
1147080785 17:38018657-38018679 GAGAACAGAAGAGAGCCTACTGG + Intronic
1147096728 17:38142617-38142639 GAGAACAGAAGAGAGCCTACTGG + Intergenic
1147981198 17:44275236-44275258 GAGGCCAGGTGAGAGACTCCTGG - Intergenic
1148215443 17:45831699-45831721 GAGAACCACTGAGAGAGAGCGGG + Intronic
1149845080 17:60004350-60004372 GAGAACAGAAGAGAGCCTACTGG - Intergenic
1149890147 17:60381851-60381873 GAGAACAGGAGAGAGCCTACTGG - Intronic
1150873477 17:68942382-68942404 GAGGACAGTAGAGACACTGCAGG + Intronic
1152874187 17:82776785-82776807 GAGAGCAGCTGAGAGCCACCAGG - Intronic
1153569488 18:6454549-6454571 AAGAACATCTGAGACACTGAAGG + Intergenic
1154168565 18:12034589-12034611 AAGAAGAGCAGAAAGACTGCAGG + Intergenic
1155689816 18:28605808-28605830 GAGAACAGCCAAGAGACTTGTGG + Intergenic
1155802156 18:30120406-30120428 GAGAACAGCTGAGTGGTTGCTGG + Intergenic
1156393548 18:36675598-36675620 GGCAACAGCTGAGTGAATGCAGG - Intronic
1156997127 18:43482149-43482171 TAGAACAGTCGAGAGACAGCAGG - Intergenic
1157783537 18:50461524-50461546 GAAAAAAGCTGAGAGACAGGAGG - Intergenic
1157818516 18:50748704-50748726 GAGAACAGCTGGGGAGCTGCAGG - Intergenic
1157877606 18:51288071-51288093 GAGAGCAGCAAAGTGACTGCTGG - Intergenic
1159014958 18:63093848-63093870 TATAGCAGCTGAGAAACTGCCGG - Intergenic
1159777629 18:72621893-72621915 GAAAACAGCTGAGAAACCGATGG + Intronic
1161099800 19:2415964-2415986 GAGGGCAGCTGAGAGACAGGAGG + Intronic
1162510626 19:11116057-11116079 GAGAATAGCTGTGAGGCTGGAGG - Intronic
1162592432 19:11601126-11601148 GTGAGCAGCTGGGACACTGCAGG - Intronic
1162648743 19:12068948-12068970 GTGAGCAGCTGGGACACTGCAGG - Intronic
1162857125 19:13477264-13477286 GAGAACAGCAGAGAAAGGGCTGG - Intronic
1163955231 19:20632151-20632173 GAGATCAGCTGTTAGTCTGCTGG + Intronic
1164570272 19:29369475-29369497 GAGACCAGCTGAGATGCTGCTGG + Intergenic
1167235999 19:48315676-48315698 GAAAACAGATGAGTGATTGCTGG - Intronic
1167534680 19:50042107-50042129 GAGACCAACTGAGAGAGTGGAGG - Intronic
1168215618 19:54923215-54923237 GAGAGCTGATGAGAGACCGCGGG + Intergenic
1202670499 1_KI270709v1_random:45565-45587 GAGATCAGCTGATAGTCTGATGG - Intergenic
925448158 2:3945722-3945744 TAGAAAAGCTGAGAGAAGGCAGG - Intergenic
926180127 2:10635335-10635357 GAGAACAGTAGAGAGAATGTTGG - Intronic
926961206 2:18360299-18360321 GAGGAAAACTGAGAGACTGTTGG + Intronic
928126616 2:28620831-28620853 GAGCACAGGTGAGAGCCTGCAGG - Intronic
928132697 2:28664668-28664690 AAGAACACTTGAGAGACAGCAGG - Intergenic
928374244 2:30762154-30762176 GATAGCATCTGAGAGACAGCTGG - Intronic
932320020 2:70815129-70815151 GAGGGCAGCTGAGAGACAGAAGG - Intronic
932423177 2:71613215-71613237 GAGAAATGTGGAGAGACTGCAGG + Intronic
934982238 2:98852266-98852288 GATAACAGCTGGGAGGCTGAGGG + Intronic
935185353 2:100726804-100726826 GAGAACATCTTAAAAACTGCTGG + Intergenic
937497129 2:122432544-122432566 ATGAAGAGCTGAGAGACTGAAGG - Intergenic
937741417 2:125359125-125359147 GAGATCAGCTGATAGTCTGATGG - Intergenic
938689681 2:133776175-133776197 GAGGGCAGCTGAGAGCCAGCGGG + Intergenic
939628089 2:144503120-144503142 GATAACAGCTAAGAGGCTACTGG + Intronic
939676271 2:145076251-145076273 CAGCACAGCAGGGAGACTGCAGG + Intergenic
940898075 2:159100209-159100231 GGGAAAACCTGAGAGACTTCAGG + Intronic
940986374 2:160056032-160056054 GAGAATAGCGGGGAGTCTGCTGG - Intronic
942461132 2:176169634-176169656 AAGAACAGCTGTGCCACTGCAGG + Exonic
945064784 2:205939602-205939624 GAGAACAGCGGACACCCTGCTGG - Intergenic
1169012988 20:2266227-2266249 GAGATCAGCTGTTAGACTGATGG - Intergenic
1169145115 20:3247526-3247548 CAGAAAAGCTCAGAAACTGCAGG + Intergenic
1173071837 20:39775565-39775587 GAGAACAGCAAAGAAACTCCAGG + Intergenic
1174670538 20:52303518-52303540 TAGGACAGCTGAGAGTCTCCAGG - Intergenic
1174926064 20:54761395-54761417 GAGAACAGATTAGTGACTGATGG + Intergenic
1175812006 20:61863496-61863518 GGGCACAGGTGAGGGACTGCTGG + Intronic
1175815481 20:61881203-61881225 GAGAACTGCTCAGGGGCTGCAGG - Intronic
1177262999 21:18753065-18753087 GAGCACAGCGGACAGCCTGCCGG + Intergenic
1178403490 21:32306504-32306526 GGTAACAGCTGAGAGGCTGGAGG + Intronic
1178585938 21:33870861-33870883 AAGAACACTTGAGAGACAGCAGG + Intronic
1179444713 21:41423182-41423204 GAGCACAGCGGACACACTGCCGG + Intronic
1179521268 21:41946924-41946946 GAGAAACCCTGACAGACTGCAGG + Intronic
1179655530 21:42842169-42842191 ATGAACAGCTGAGCAACTGCAGG + Intergenic
1179985610 21:44919024-44919046 ATGAACAGCTGAGCAACTGCAGG - Intronic
1180577018 22:16786463-16786485 GACAACAGATGAGAAACTGTGGG + Intronic
1180858765 22:19064737-19064759 GAGCACAGCTGGCAGACAGCAGG - Intronic
1181159176 22:20947074-20947096 GAGAATGGCTGAGAGACTTCTGG - Intronic
1181298514 22:21861761-21861783 GAGAAGAGCTGAGTGACTTGGGG - Intronic
1182953767 22:34401757-34401779 GAGAACAGCTGAAGGATAGCTGG + Intergenic
1183265580 22:36823246-36823268 GGCGGCAGCTGAGAGACTGCTGG - Intergenic
1185068752 22:48644911-48644933 GGGATCAGCAGAGAGTCTGCGGG - Intronic
1185096741 22:48811095-48811117 GAGAATGGGTGAGAGAGTGCTGG - Intronic
952515115 3:34095839-34095861 GAGATCAGCTGATAGTCTGATGG - Intergenic
953119348 3:40024665-40024687 GAGAACAGCTGCGAGAAAGCTGG - Intronic
953461076 3:43081521-43081543 GAGAACTGGTGAAAGCCTGCAGG + Exonic
953610783 3:44445712-44445734 GAGAAGAGCAGAGGGAGTGCTGG - Exonic
953773036 3:45793270-45793292 GAGAACAGTTGTGTGACTGGTGG - Intronic
953889807 3:46743375-46743397 CAGCAGAGCTGAGAGTCTGCAGG - Intronic
955316601 3:57944231-57944253 GAGAAAATCTGAAAGCCTGCAGG - Intergenic
955438753 3:58932552-58932574 GAGAACAGCTGTTAGTCTGATGG - Intronic
957130367 3:76215939-76215961 GAGATCAGCTGTTAGTCTGCTGG - Intronic
958100274 3:88999744-88999766 GAGCACAGGTGAGAGGGTGCAGG - Intergenic
958803463 3:98782259-98782281 GAAAACAGCTGAGAAGCTACTGG - Intronic
958869154 3:99536764-99536786 GGGAACAGCTTGGAGACTGAAGG - Intergenic
960068379 3:113400186-113400208 GAAAACAGATGATTGACTGCTGG + Intronic
960530138 3:118755158-118755180 AACAACAGCAGAGAGACTGAGGG - Intergenic
961332996 3:126153983-126154005 GAGGACAGCAGAGAGGCTTCTGG + Intronic
963287412 3:143446542-143446564 GCTAACAGCTGAGAGACAGAGGG + Intronic
963934917 3:151042663-151042685 GGGAAGACCTGAGGGACTGCGGG - Intergenic
965374573 3:167907279-167907301 GAGAACACCTGAGAATCTGGCGG - Intergenic
966883993 3:184364843-184364865 GAGAGCAGATGAGAGACCACTGG + Intronic
969469694 4:7380349-7380371 GGAAACAGCTGTGAGACTGTTGG - Intronic
969511444 4:7620335-7620357 CTAAAAAGCTGAGAGACTGCCGG - Intronic
969839295 4:9868879-9868901 GAGAACAGCTCTGTGTCTGCAGG + Intronic
970390038 4:15599684-15599706 TAAAACAGCTGGGAGACTACAGG + Exonic
970432968 4:16006008-16006030 GAGAACAGGTGTGAGGCAGCAGG - Intronic
972225660 4:37008197-37008219 AAGAACACTTGAGAGACAGCAGG + Intergenic
974536653 4:63183505-63183527 GAGATCAGCTGATAGTCTGATGG - Intergenic
975155565 4:71068447-71068469 GAGCACACCTGAGAGTCTGACGG - Intergenic
976014991 4:80542151-80542173 GAGAGCCGCTGGGAGGCTGCTGG - Intronic
977423494 4:96834655-96834677 GAGAGCAGCAAAAAGACTGCAGG + Intergenic
977447805 4:97153508-97153530 GAGAACATCTGAGAGGTTGGGGG + Intergenic
978728907 4:112001996-112002018 GAGAACAGCAGAGAGATTAAAGG + Intergenic
978954823 4:114599690-114599712 GAGAAGAGGTGAGCGCCTGCGGG + Intronic
979656489 4:123200478-123200500 GAGAGTAGCTGAGGGACTGATGG + Intronic
979864438 4:125736270-125736292 GACTAAAGCTGAGAGACTGCAGG + Intergenic
980084708 4:128379288-128379310 CACAAGAGCTCAGAGACTGCTGG - Intergenic
980386294 4:132090713-132090735 GAGCACAGCAGACACACTGCCGG + Intergenic
980852943 4:138405396-138405418 AAGTAGATCTGAGAGACTGCAGG + Intergenic
981530026 4:145743384-145743406 GAGAACACATGAGAGACAGAAGG + Intronic
981638897 4:146912748-146912770 AAGAACAGATGGGAGACTGGTGG + Intronic
981681884 4:147408622-147408644 GTTATCAGCTGAGAGACTTCAGG + Intergenic
985233747 4:187850056-187850078 TAGAAGAGCTGAGAGACAGCGGG - Intergenic
985532193 5:440552-440574 GGCAACAGCACAGAGACTGCAGG - Intergenic
985807114 5:2054037-2054059 GAGAGCAGCTGTGAGGCTGAAGG + Intergenic
985926241 5:3021431-3021453 CATAATAGCTGAGAGACTGCTGG - Intergenic
986030488 5:3888771-3888793 GAAAACAGCTGGGAGGCTGCTGG - Intergenic
986405002 5:7416798-7416820 GAGAACAGTTAAGATCCTGCTGG + Intronic
986723275 5:10575817-10575839 GAGAACTGATCAGAGGCTGCTGG + Intronic
986739363 5:10692612-10692634 GAGAATAGCTGAGAGAGTGAAGG - Intronic
987268273 5:16278636-16278658 GAGATCAGCTGTGGGACAGCCGG + Intergenic
987923090 5:24308799-24308821 GAGACATGCTGAGAAACTGCTGG - Intergenic
989295944 5:39826765-39826787 GTGAACAGCTGTGATACTGAGGG + Intergenic
989566214 5:42903979-42904001 GAGAACAGCTCTGAGCCTGCTGG - Intergenic
990951167 5:61299938-61299960 GAGAACATGTGAGAGAATGTAGG + Intergenic
992336315 5:75773912-75773934 GAGATCAGCTGTTAGTCTGCTGG + Intergenic
994882019 5:105510201-105510223 GAGAACACATGAGATACTGTAGG + Intergenic
996880548 5:128292129-128292151 GACATCAGTTGAGAGACTGGTGG - Intronic
996890474 5:128412654-128412676 TAGAACAGCTGGGAAACTGATGG + Intronic
996989537 5:129611872-129611894 GAGAACAGCTGTGAGTTTGACGG - Intronic
997411136 5:133691835-133691857 GAGAACATCTCAGTGACGGCAGG + Intergenic
997880852 5:137588196-137588218 CAGAAAAGCAGAGAAACTGCAGG + Intronic
1002693654 5:181070101-181070123 GAGGACGGCGGAGAGGCTGCTGG - Intergenic
1003336753 6:5180666-5180688 CAGAGCAGCTGAGAGGCTGGAGG - Intronic
1004064616 6:12231000-12231022 GAGAACTGCAGACAGATTGCTGG - Intergenic
1004325652 6:14671829-14671851 GACAACATGTGAGAGACTGTGGG - Intergenic
1004665110 6:17742080-17742102 GAAAATAACTGAGAGACTGCTGG - Intergenic
1007199674 6:40096396-40096418 GAGATGAGCTTAGACACTGCTGG + Intergenic
1007583096 6:42971102-42971124 GAGAGCAGCTTTGAGACTGTGGG - Intronic
1008414713 6:51226107-51226129 GAGATCAGCTGTGAGTCTGATGG - Intergenic
1009816529 6:68743883-68743905 GAGGACTGCTTAGAAACTGCTGG + Intronic
1010176761 6:73036520-73036542 GAGAACAGATTAGTGGCTGCTGG - Intronic
1010735416 6:79438200-79438222 GAGAACAGCTGGGTGTGTGCAGG - Intergenic
1010851714 6:80784792-80784814 GAGATCAGCTGTGAGTCTGATGG - Intergenic
1011149866 6:84259112-84259134 GAGAACAGCTGAAAGAGGGCTGG - Intergenic
1011262110 6:85480612-85480634 GAGCACAGCACAGAAACTGCTGG - Intronic
1011336820 6:86270881-86270903 GAGATCAGCTGTGAGTCTGATGG + Intergenic
1011934271 6:92754868-92754890 GACAACAACTGAGAGAGTGCTGG - Intergenic
1012120028 6:95354790-95354812 GAGCACAGCAGAGACCCTGCTGG - Intergenic
1012967957 6:105695855-105695877 AATCACAGCTGAGAAACTGCTGG + Intergenic
1014932405 6:127349663-127349685 TAGAAAAGCTCAGTGACTGCCGG + Intergenic
1015590755 6:134820855-134820877 TAGAACCTCTGAGAGACTGAAGG - Intergenic
1017287337 6:152691010-152691032 GAGGACGGCTGTGAGACTTCAGG - Intergenic
1017367601 6:153663208-153663230 GAGAACAAAGGAGAGACTGGTGG - Intergenic
1018174793 6:161169135-161169157 GAGAACATCACAGAGACTTCTGG + Intronic
1019453486 7:1112268-1112290 AAGAACTGCTGAGAAACTGGAGG - Intronic
1019647277 7:2137783-2137805 GAGCACAGTTCAGAAACTGCTGG - Intronic
1019724767 7:2595436-2595458 GTGCACAGCTGAGTGACGGCAGG - Intronic
1021188438 7:17592619-17592641 GAGAACAGAAGAGACAATGCAGG + Intergenic
1021804553 7:24342229-24342251 GAGACCAGCTAAGAGACTGTGGG - Intergenic
1021885329 7:25131892-25131914 GAGCACAGCTGACACCCTGCTGG + Intergenic
1023074880 7:36472764-36472786 AAGAACACTTGAGAGACAGCAGG + Intergenic
1024966553 7:55027065-55027087 GAGAACTGCTGATATACTCCAGG + Intronic
1026447136 7:70494659-70494681 GAGAACAGACTGGAGACTGCTGG + Intronic
1026483445 7:70798092-70798114 GAGACCAGGTCAGAGGCTGCTGG - Intergenic
1027459392 7:78434391-78434413 GAGAAGAGATGACAGCCTGCTGG + Intronic
1029111714 7:98216128-98216150 AAAAGCAGCTGAGAGACTGCGGG + Exonic
1029167175 7:98600616-98600638 AAGACCAGCTGAGACACTGCAGG - Intergenic
1030329607 7:108257162-108257184 GAGAACAGATTAGTGGCTGCTGG + Intronic
1032342886 7:131092093-131092115 AAGAAAAGCTGAAAGACTGGAGG - Intergenic
1033833691 7:145283275-145283297 CAGGACAGCTGAGGGAATGCTGG - Intergenic
1038345522 8:26728607-26728629 TAAGGCAGCTGAGAGACTGCAGG + Intergenic
1040137073 8:43867094-43867116 GAGAACAGCTGTTAGTCTGATGG + Intergenic
1040293514 8:46137500-46137522 GTGAGAAGCAGAGAGACTGCAGG - Intergenic
1040313457 8:46248776-46248798 GGGAAAAGCAGCGAGACTGCAGG + Intergenic
1040314374 8:46253234-46253256 GGGAGAAGCGGAGAGACTGCAGG + Intergenic
1040315351 8:46258001-46258023 GAGAAAAGCGGCGAGACTGCAGG + Intergenic
1040315848 8:46260544-46260566 GGGAGAAGCGGAGAGACTGCAGG + Intergenic
1040332142 8:46391147-46391169 GGGAAAAGCAGAGAGACTGCAGG + Intergenic
1040340583 8:46438538-46438560 GGGAAAAGCGGGGAGACTGCAGG - Intergenic
1040694220 8:49976916-49976938 GAAAGCAGCTCAGAGACTGGAGG + Intronic
1041022845 8:53656211-53656233 GAGAACAGATGAGTAAATGCTGG + Intergenic
1042823085 8:72952963-72952985 CAGAATAGCAGAGAGAATGCTGG + Intergenic
1043512859 8:80966828-80966850 GCAAACTCCTGAGAGACTGCTGG - Intergenic
1047087090 8:121529815-121529837 GAGAACGACTGAAAGACTCCTGG + Intergenic
1047493952 8:125396581-125396603 GAGCAGAGCCGAGAGAGTGCCGG + Intergenic
1048288495 8:133161769-133161791 GAGAAGACCTCAGAGGCTGCTGG + Intergenic
1048969396 8:139636321-139636343 GAGAACAGCTGAGGTGCTGGGGG - Intronic
1049310774 8:141932706-141932728 GAGAAAAGCTGAGGGCCTGTGGG - Intergenic
1049746582 8:144265697-144265719 GAGCACAGCTGGGAGCCTGCCGG + Intronic
1051941149 9:22507229-22507251 GAGATCAGCTGTTAGACTGATGG + Intergenic
1051982514 9:23039973-23039995 GAGAGCACTGGAGAGACTGCAGG + Intergenic
1054766822 9:69049003-69049025 GAAAGCAGCAGAGAGTCTGCTGG - Intronic
1054812788 9:69447914-69447936 GAGAACTGCTGAGGGGCTGTGGG - Intronic
1056379893 9:86047497-86047519 GAGAACAGCTGGGTGGGTGCTGG + Intronic
1057627586 9:96691627-96691649 GATACCAGCTGAAAGACTTCAGG - Intergenic
1058793565 9:108474707-108474729 CAGACCTACTGAGAGACTGCAGG - Intergenic
1059005270 9:110395131-110395153 GAGATCAGCTGTTAGTCTGCTGG - Intronic
1059733701 9:117081217-117081239 GAGAACAGCTGAGAGACTGCAGG - Intronic
1060315473 9:122506225-122506247 TAGAACAGAAGAGAGACTGAGGG + Intergenic
1060651091 9:125327897-125327919 GAGAACAGATGAAAGAAAGCTGG - Intronic
1061360953 9:130142034-130142056 GGGACCAGGTGAGAGACCGCAGG + Intergenic
1061495897 9:130974021-130974043 GAGATCAACTGTGAGGCTGCAGG - Intergenic
1185714436 X:2330054-2330076 GAGAGAAGCAGAGAGACGGCGGG + Intronic
1187470687 X:19566857-19566879 GAGATCAGACCAGAGACTGCAGG + Intronic
1189882838 X:45509611-45509633 GAGAACAGGTGAGAGAGAGGAGG + Intergenic
1191589751 X:62869579-62869601 GAGATCAGCTGATAGTCTGATGG + Intergenic
1191840749 X:65512228-65512250 GAGAACAGCAGGAAGCCTGCTGG + Intergenic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1193021288 X:76796698-76796720 AAGAACACTTGAGAGACAGCAGG - Intergenic
1193022277 X:76803055-76803077 AAGAACACTTGAGAGACAGCAGG - Intergenic
1193306262 X:79956097-79956119 GAGAACAGCAGACACCCTGCTGG - Intergenic
1194669183 X:96708908-96708930 GAGAGCAGCAGAGAGGCTTCCGG + Intronic
1196774655 X:119327238-119327260 TAGAGCAGATGAAAGACTGCTGG - Intergenic
1196783252 X:119400873-119400895 GAGAACTGTTTACAGACTGCAGG - Intronic
1197622640 X:128767873-128767895 GATAACAGCTGAGAGTTTGCTGG - Intergenic
1198844179 X:140892068-140892090 GAGAACAGCTGGAAGATGGCAGG + Intergenic
1199471228 X:148198486-148198508 GACACCTGGTGAGAGACTGCGGG - Intergenic
1200743015 Y:6875736-6875758 GAGAAGAGGTGAGAGAGTGAGGG + Intergenic
1201905239 Y:19080375-19080397 GAGCACAGCTGACACCCTGCTGG - Intergenic
1201906123 Y:19087171-19087193 GAGCACAGCTGACACCCTGCTGG - Intergenic
1202626000 Y:56859095-56859117 GAAAACAGAAGAGAGACTTCTGG + Intergenic