ID: 1059734550

View in Genome Browser
Species Human (GRCh38)
Location 9:117088282-117088304
Sequence TACGTGGTACACTGGGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 82}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059734550_1059734559 2 Left 1059734550 9:117088282-117088304 CCCCTTCCCCAGTGTACCACGTA 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1059734559 9:117088307-117088329 ATCCGCCCTCACACCTTGGCAGG No data
1059734550_1059734557 -2 Left 1059734550 9:117088282-117088304 CCCCTTCCCCAGTGTACCACGTA 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1059734557 9:117088303-117088325 TACCATCCGCCCTCACACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059734550 Original CRISPR TACGTGGTACACTGGGGAAG GGG (reversed) Intronic
902467309 1:16626137-16626159 TGTGTGGGACACTGGGGAGGGGG + Intergenic
902583768 1:17425763-17425785 TCCCTGGTACCCTCGGGAAGTGG - Intronic
904362889 1:29989847-29989869 TACGTGATATACTGAGGAACAGG + Intergenic
905309698 1:37040904-37040926 TAGGTGGTACACTGTGTGAGTGG + Intergenic
906191252 1:43900835-43900857 TAGGTGGGACAGTGGGGAAGGGG + Intronic
911102666 1:94106505-94106527 TGGTTGGTACACAGGGGAAGGGG + Intronic
917421653 1:174869813-174869835 TACATGGTAGAATGAGGAAGGGG - Intronic
920446423 1:206022070-206022092 AGCCTGGTACTCTGGGGAAGGGG - Intronic
922239634 1:223747243-223747265 TACGTTGTACACAGGAGCAGTGG - Intronic
1063757623 10:9032700-9032722 AACGTAGAAAACTGGGGAAGTGG - Intergenic
1076586595 10:131552732-131552754 CACGAGGTGCACTGGGGCAGGGG - Intergenic
1076622950 10:131804366-131804388 TTTGTGGTTCACTGTGGAAGAGG - Intergenic
1077334597 11:1997787-1997809 AACGGGGGAAACTGGGGAAGTGG - Intergenic
1079218345 11:18536022-18536044 TACTTGGGACACTGAGGCAGGGG + Intronic
1084944925 11:72633280-72633302 GACGTGGGACAATGGGGAGGCGG - Intronic
1087195038 11:95296783-95296805 TAAGTGATACACAGGGCAAGTGG + Intergenic
1088972945 11:114789618-114789640 TGGGTGGTACAATGGGGCAGTGG + Intergenic
1202817580 11_KI270721v1_random:52969-52991 AACGGGGGAAACTGGGGAAGTGG - Intergenic
1097890247 12:64770811-64770833 TACGTGGGAGGCTGAGGAAGGGG - Intergenic
1098324466 12:69287350-69287372 TACTTGGTACACTGGTGACCAGG - Intergenic
1099893775 12:88620118-88620140 TTCGAGCAACACTGGGGAAGTGG - Intergenic
1104613534 12:130250032-130250054 TACGTGGTTCATGGGGGAAAAGG - Intergenic
1108186176 13:47890844-47890866 TACATGGTACACTGCAGAACTGG - Intergenic
1122311473 14:100798376-100798398 TACTTGGTATACTGAGGCAGGGG + Intergenic
1126007729 15:44274322-44274344 TACTTGGGAGACTGAGGAAGGGG - Intergenic
1126841444 15:52721220-52721242 TACCTGGTTCAGTGGGGAAGAGG + Intergenic
1127780376 15:62307983-62308005 TAAGTGGGACACTGAGGCAGAGG - Intergenic
1130796791 15:87218182-87218204 CACTTGGTCCAATGGGGAAGTGG - Intergenic
1131615465 15:94013011-94013033 TACTCGGGACACTGAGGAAGGGG - Intergenic
1133125562 16:3643633-3643655 AACCAGGTACACTGGGAAAGGGG + Intronic
1134584473 16:15397968-15397990 AACCTGGTACACTGGTGAAGGGG + Intronic
1137898542 16:52239547-52239569 TACTGGGTAGACTGGGGTAGGGG - Intergenic
1143296633 17:5876260-5876282 CAGGTGGGACACTGGGGATGGGG + Intronic
1144269457 17:13602136-13602158 AATGGGGGACACTGGGGAAGGGG - Intergenic
1149927166 17:60712914-60712936 TAAGTGATTCACTTGGGAAGTGG + Intronic
1150646085 17:66978370-66978392 TACGTGGTACATGGGGACAGGGG + Intronic
1156240265 18:35247052-35247074 AAGGTGGTACTCTAGGGAAGTGG + Exonic
1157390626 18:47299797-47299819 TACTTGGGAGACTGGGGCAGAGG - Intergenic
1160726195 19:618823-618845 GTGGTGGTACACTGGGGTAGTGG + Intronic
1162337920 19:10073078-10073100 TGTCTTGTACACTGGGGAAGGGG - Intergenic
1163302857 19:16458526-16458548 TGCGAGGTGCAGTGGGGAAGCGG - Intronic
1166325401 19:42047187-42047209 AAATTGTTACACTGGGGAAGGGG - Intronic
938872248 2:135491621-135491643 TACCTGGGACACTGAGGCAGGGG - Intronic
1174045071 20:47727513-47727535 TCTGTGGTCCACTAGGGAAGTGG + Intronic
1175815958 20:61883371-61883393 TTCTTGGGACACTGGGCAAGTGG + Intronic
1179356275 21:40663442-40663464 TACGTGGTCCAGTGTTGAAGCGG - Intronic
1180997729 22:19973783-19973805 TACGTGGCCCACTGCGGAGGCGG + Exonic
950577258 3:13839680-13839702 TTGGTGGTAGAGTGGGGAAGGGG - Intronic
955872217 3:63451301-63451323 TTCCTGGTAGACTGGGGAAATGG - Intronic
957127382 3:76179372-76179394 CATCTGGAACACTGGGGAAGAGG - Intronic
959130599 3:102351356-102351378 AACCTGGTACATTGTGGAAGGGG - Intronic
963114383 3:141713926-141713948 TACTTGGCCCACTGGGGATGTGG - Intergenic
966727627 3:183121418-183121440 TCTCTGGTACACTGTGGAAGGGG - Intergenic
969129887 4:4983547-4983569 TACGTGGTTCACTGGCCATGTGG - Intergenic
970539917 4:17067387-17067409 TCCGTGGAACTTTGGGGAAGAGG - Intergenic
973606976 4:52597543-52597565 TTAGTGGGCCACTGGGGAAGAGG + Exonic
980101663 4:128547470-128547492 GAGGTGGTACACAGGGGATGGGG + Intergenic
983634444 4:169883003-169883025 TCCTAGGTACACTGGAGAAGGGG - Intergenic
993543642 5:89183795-89183817 TATTTGGTACACTGGGGTATGGG + Intergenic
995888509 5:116922819-116922841 CATGTAGTATACTGGGGAAGAGG + Intergenic
997283143 5:132661025-132661047 TACCTTGAACACTGGGGGAGGGG + Exonic
1004959675 6:20772841-20772863 TACCTGGTGGACTGGGGAGGAGG - Intronic
1005880942 6:30060632-30060654 GAAGTGGTACACTTGAGAAGGGG - Intronic
1012085624 6:94822806-94822828 TATTTGTGACACTGGGGAAGAGG + Intergenic
1014488025 6:122025017-122025039 TATGTGGTACACTGGTGTGGAGG - Intergenic
1016527733 6:145021462-145021484 TACAGGGTACTCTGGAGAAGTGG - Intergenic
1016912109 6:149209306-149209328 TACATGTTACACTGTGGATGGGG + Intergenic
1019310971 7:360478-360500 TGCGTTGTGCACTGGGGAATGGG - Intergenic
1023100868 7:36717083-36717105 AATATGGTAAACTGGGGAAGGGG + Intronic
1024142948 7:46480610-46480632 TTTCTGTTACACTGGGGAAGAGG + Intergenic
1024675772 7:51636714-51636736 TTCTTGGTGCACTGGGAAAGGGG - Intergenic
1024716835 7:52088493-52088515 TAAGTCCCACACTGGGGAAGGGG + Intergenic
1024971825 7:55078373-55078395 GGCGTGGTACCCTGGGGATGGGG - Intronic
1029777421 7:102692676-102692698 TAAATGGTACACTGCAGAAGAGG - Intergenic
1031361171 7:120850476-120850498 GAGCTGGGACACTGGGGAAGTGG - Intronic
1041589558 8:59561005-59561027 TACTTGGGAGACTGGGGCAGGGG + Intergenic
1048264215 8:132971281-132971303 CACGTTGTACACTGAGTAAGAGG + Intronic
1050361965 9:4838617-4838639 GACATGGAACATTGGGGAAGGGG + Intronic
1052916249 9:33926214-33926236 TATATGGTACTCTGAGGAAGAGG + Intronic
1057313663 9:93956037-93956059 TACATGGTAAACTGAGGCAGAGG - Intergenic
1058536014 9:105960968-105960990 TAGAGGCTACACTGGGGAAGTGG + Intergenic
1058749087 9:108021302-108021324 CACCAGATACACTGGGGAAGTGG + Intergenic
1059734550 9:117088282-117088304 TACGTGGTACACTGGGGAAGGGG - Intronic
1059986514 9:119825236-119825258 TACATAGTGCACTGGGGAGGTGG - Intergenic
1186896333 X:14008087-14008109 TACGTGGGAGACTGAGGCAGGGG - Intergenic
1195080367 X:101364662-101364684 TCCTTGGTACACTGGTGAAGAGG - Intronic
1197310574 X:124900366-124900388 TACGTGGTTGCCTGGGGAAAAGG + Intronic