ID: 1059739219

View in Genome Browser
Species Human (GRCh38)
Location 9:117133372-117133394
Sequence ATCCTAGCTCTGCCACTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1321
Summary {0: 1, 1: 7, 2: 58, 3: 312, 4: 943}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059739219 Original CRISPR ATCCTAGCTCTGCCACTGAC TGG (reversed) Intronic
900387298 1:2416501-2416523 GTCCTGGGTCTGCCACAGACGGG - Intergenic
900546520 1:3232293-3232315 ATCCCAGCTCTGCCATTTGCTGG + Intronic
900745009 1:4355117-4355139 ATCCCAGCTCTGCCACCTTCTGG - Intergenic
900865835 1:5268000-5268022 ATCCTAGTTCTGACACTTGCAGG + Intergenic
900910669 1:5594819-5594841 ATCCCAGCTCTGCCCCTCCCTGG - Intergenic
901002794 1:6156918-6156940 ATCCTGGCTCTGCCACATACCGG + Intronic
901518813 1:9768087-9768109 ATCGTAGCTCTGCTACTTATTGG - Intronic
902080432 1:13816759-13816781 ATCCCAGCTCTGCCACTTGCTGG + Intronic
902159416 1:14518042-14518064 GCCCAAGGTCTGCCACTGACTGG + Intergenic
902186693 1:14730806-14730828 GTCCCAGCTCTGCCACTTACTGG - Intronic
902230672 1:15025471-15025493 TTGCCAGCTCTGCCCCTGACAGG - Intronic
902408667 1:16200214-16200236 ATCCCAGTTCTGCCGCTTACTGG + Intronic
902556807 1:17251642-17251664 ATCCTGGCTCTGCCACTCACTGG - Intronic
902722517 1:18313381-18313403 ATCCCAGCTCTGCCGCTTCCTGG + Intronic
902773552 1:18660211-18660233 ATCCTGGCTCTGCCACTTGCTGG + Intronic
902785716 1:18731426-18731448 ATCCCAGCTCTGCCACTTACCGG + Intronic
902931603 1:19735364-19735386 CTCCTAGCTTTGCCACTGACTGG - Intronic
903004342 1:20288843-20288865 ATCCCAGCTCTGCCACTTCTTGG + Intergenic
903032079 1:20471164-20471186 ATCCCAACTCTGCCACTTACTGG - Intergenic
903139758 1:21332513-21332535 ATCCCAGCTCTGCCATTTACTGG - Intronic
903180457 1:21602536-21602558 ATCCTAGCTCTGCCCATCACTGG + Intronic
903272089 1:22196001-22196023 GTCCTGGCTCTACCACTGACTGG - Intergenic
903447867 1:23433792-23433814 ATCCTGGCTCTGCCATTTTCTGG + Intronic
903472874 1:23599471-23599493 TTCCCAGCTCTGCCACTTGCTGG + Intronic
903642038 1:24866877-24866899 GTCCCAGCTCTGCCACTTTCTGG + Intergenic
903666807 1:25013025-25013047 ATCCCAGCTCTGCCACTTACCGG - Intergenic
903934988 1:26889532-26889554 AATCTGGCTCTGCTACTGACTGG - Intronic
904005959 1:27363422-27363444 ACCCTTGCTCTGCCACTCACCGG + Exonic
904200145 1:28814211-28814233 ATCCCTGCTCTGCCACGAACTGG + Intronic
904205025 1:28848751-28848773 ATACCAGCTCTGCCACTTACTGG + Intronic
904279831 1:29411121-29411143 ATCCTGGCTCTGCTACTCCCTGG - Intergenic
904280121 1:29413173-29413195 AACCCAGCTCTGCCACTCACAGG - Intergenic
904291637 1:29489844-29489866 ATCCCAGTTCTGCCACTTACTGG + Intergenic
904316366 1:29668618-29668640 ATCCTGGCTCTGTCACCTACTGG - Intergenic
904392306 1:30194119-30194141 ATCCCAGCTCAGCCACACACTGG - Intergenic
904392556 1:30195570-30195592 ATCCCAGCTCAGCCACACACTGG + Intergenic
904415879 1:30360841-30360863 GTCCCAGCTCTGCCACCAACTGG - Intergenic
904447704 1:30588276-30588298 GACCCAGCTCTGCCAATGACTGG - Intergenic
904474478 1:30756096-30756118 ACCCCAGCCCTGCCACTAACTGG - Intronic
904598600 1:31661826-31661848 AGCCTGGCTCAGCCTCTGACTGG + Intronic
904608605 1:31712878-31712900 ATCCTGGCTCTGCTACTTCCTGG + Intergenic
904644472 1:31955462-31955484 GTCTTAGCTCTTCCAGTGACTGG + Intergenic
904675100 1:32194236-32194258 ATGCTAGCTGTGTCACTGATGGG - Intronic
904791398 1:33024638-33024660 AACCTGGCCCTGCCACTTACTGG + Intronic
904839191 1:33360445-33360467 ATCTTGGCTCTGACACTGATAGG + Intronic
904894489 1:33803997-33804019 ATCCCAGTTCTGCCACTTACTGG + Intronic
905342663 1:37289956-37289978 TTCCTGACTCTGCCACTGAATGG - Intergenic
905531318 1:38681141-38681163 GTTCTAGCTCTGCCACTTCCTGG + Intergenic
905586652 1:39124872-39124894 ATCCTGATTCTGCCACTGACTGG - Intronic
905766124 1:40602594-40602616 ACCCTGGCTCTGCCACTTACTGG + Intergenic
905775222 1:40664013-40664035 ACCCAAGCTCTGCCACTTTCTGG - Intronic
905801959 1:40849970-40849992 GTCCTGGCTCTGTCACTTACTGG - Intergenic
905804230 1:40864146-40864168 ATCATATCTCTGCCACCCACAGG + Intergenic
905972854 1:42154423-42154445 ATCCCACCTCTGCCCATGACCGG - Intronic
906163873 1:43671368-43671390 ATCCTGGCTCTGTCACTGAGGGG - Intronic
906250882 1:44309964-44309986 ATCCTGGCTGTGTCACTGATGGG + Intronic
906477380 1:46178774-46178796 ATCCTGGCTCTGCCACTTACAGG + Intronic
906659757 1:47573922-47573944 ATCCCAGCTCTGCCATTTTCTGG - Intergenic
906666257 1:47624219-47624241 ATCCCAGCTCTACCACTTCCTGG - Intergenic
906780775 1:48571214-48571236 ATCCTAGTTTTGCCACTTCCAGG - Intronic
906952205 1:50344085-50344107 ATTCTAGCTCTGCCAGTTAATGG + Intergenic
907125831 1:52050041-52050063 GTCCCAGCTCTGCCACTTAGTGG - Intronic
907173290 1:52492596-52492618 ATTTTAGTTCTGCCACTTACTGG - Intronic
907237203 1:53061015-53061037 ACCCCAGCTCTGCCAGTGAATGG + Intergenic
907286617 1:53384499-53384521 ATCCTGGCTTTCCCACTTACCGG + Intergenic
907304103 1:53504333-53504355 AACCCAGCTCTACCACTCACAGG + Intergenic
907389942 1:54151638-54151660 ATCCCATCTCTGCCAGTGACTGG + Intronic
907391519 1:54161346-54161368 ATCCTGGTTCTGCCACTTAGAGG - Intronic
907487591 1:54788236-54788258 GTCCTGGTTCTGCCCCTGACTGG + Intronic
907674066 1:56502586-56502608 ATCCTAGATCTGCCATTGCATGG + Intronic
907802678 1:57786691-57786713 AGCCTCACTCTACCACTGACGGG - Intronic
908124712 1:61018864-61018886 ATCCTGGTTCTGCCACTTACTGG - Intronic
908172924 1:61525655-61525677 ATCCTAGCTCTACCACTTCCTGG + Intergenic
908172967 1:61526291-61526313 ATCCTAGCCCTACCACTTCCTGG - Intergenic
908385152 1:63634421-63634443 ATCCCAGCTCTGCCAGTCATTGG - Intronic
908418074 1:63932729-63932751 ATCCTGCCTCTGTCACTTACTGG - Intronic
908449324 1:64236058-64236080 ATCCTGGGTCTGCCATTTACTGG + Intronic
908528370 1:65009800-65009822 ATCCCAGCTCTGCCACTTACTGG - Intergenic
908549624 1:65195608-65195630 ATCCCCGCTCTGCCACTTTCTGG + Intronic
908816717 1:68042724-68042746 ATCCTGGCTCTGCTACTTACCGG + Intergenic
908916956 1:69139247-69139269 AGCCTAGATCTGCCACTGAAGGG - Intergenic
909494133 1:76259361-76259383 ATCCTGGTTCTGTCACTGAGTGG + Intronic
909523983 1:76601675-76601697 ACCCTGGCTTGGCCACTGACTGG - Intronic
910213517 1:84818029-84818051 ATCCTGGCTCTTCCACTGATCGG + Intronic
910432658 1:87174382-87174404 GTCCCAGCTCTGCCACACACTGG - Intergenic
910734497 1:90437696-90437718 GTCCCAGCTCTGCCACTCACTGG - Intergenic
910834357 1:91493437-91493459 ATTTCAGCTCTGCCACTTACTGG + Intergenic
911173842 1:94798650-94798672 ATCCTAGCTCTGCAACTTCCCGG + Intergenic
911186154 1:94907054-94907076 ATCCTGGCTCTACCAATGAGTGG + Intronic
911373660 1:97024630-97024652 ATACTAGCTCAGCCACTGGGGGG + Intergenic
911922169 1:103778993-103779015 CTCCTGGCTCTGATACTGACTGG + Intergenic
911976726 1:104507204-104507226 ATCCTACCTCTGACAATGTCAGG + Intergenic
912299378 1:108498435-108498457 ATCCCGGCTCTGCCACTTACTGG - Intergenic
912523903 1:110266625-110266647 ATCCCAGCCCTGCCACTTAAAGG - Intronic
912566571 1:110591956-110591978 ATCCCAACTCTGTCACTCACCGG - Intergenic
912823946 1:112888497-112888519 AGCCTGGTTCTACCACTGACTGG - Intergenic
913174243 1:116259453-116259475 ATCCTGGCTCTGCTACTCTCTGG - Intergenic
913192845 1:116428154-116428176 CTCCTCGCTCTGCCACTGAAAGG - Intergenic
913196897 1:116464562-116464584 ATCCTAGCTCTGCCTCTCACAGG - Intergenic
913225079 1:116691950-116691972 AGCCTGGCTCTGCCACTTTCTGG + Intergenic
913278569 1:117163262-117163284 GTCCCAGCTCTGCCACTTATTGG + Intronic
914878813 1:151532205-151532227 ATCCTGGCTCTACCACTTACTGG - Intronic
915129452 1:153686789-153686811 GCCCTGGCTCTGCCCCTGACTGG + Intronic
915453316 1:156021908-156021930 ATCCCAGTTCTGTCACTTACTGG + Intergenic
915902599 1:159857164-159857186 ATCCTGGCTGGGACACTGACTGG - Intronic
915938814 1:160105437-160105459 ATCCTAGGTCTACCACTAATTGG - Intergenic
915997113 1:160574683-160574705 ATCCTGGCTCTGTCAGGGACTGG + Intronic
916183645 1:162110074-162110096 ATCCCAGCTATCCCACTCACTGG - Intronic
916185667 1:162130282-162130304 ATCCTAGTTCTGCCACTTACAGG - Intronic
916444213 1:164856951-164856973 ATCCCAGCTCTGCTACTGCCAGG + Intronic
916653035 1:166848632-166848654 TTCCCAGCTCTGCCACTTTCTGG + Intronic
917121666 1:171649842-171649864 ATTCGAGCTTTGCCACTAACTGG + Intronic
917148443 1:171918351-171918373 ATATTAGCTCTACCACTGAATGG - Intronic
917492000 1:175505621-175505643 ATCCCAGCTCTGCCATTGATTGG + Intronic
917525807 1:175787566-175787588 ATCCCAGCTCTACCACTGACTGG - Intergenic
917626312 1:176850070-176850092 ATCCTGGCTCTGCCACTTACTGG - Intergenic
917722791 1:177802122-177802144 ATGCCAGTTCTCCCACTGACAGG + Intergenic
917740852 1:177960824-177960846 GTCCCAGCTCTCCCACTGACGGG - Exonic
918429051 1:184439305-184439327 GTCCTGGCTCTGCCACTCATTGG + Intronic
918570711 1:185988721-185988743 ACCCCAGCTCTACCACTGATGGG + Intronic
918712873 1:187752828-187752850 ATCCAAGTTCTGACACTTACAGG - Intergenic
918974091 1:191458405-191458427 ACCCTAGATCTGCCACATACTGG - Intergenic
918984448 1:191605696-191605718 ATCCTGGCTTTGCTACTTACTGG + Intergenic
919094224 1:193010466-193010488 ATCCTAGATCTACTACTTACTGG + Intergenic
919269132 1:195316076-195316098 AACCCAGCTCTACCACTAACTGG - Intergenic
919438550 1:197596010-197596032 ATCCCAGCTTTGCCACTTATTGG - Intronic
919572394 1:199265039-199265061 ATCCTGGTTCTACCACTTACTGG + Intergenic
919930208 1:202216349-202216371 TTTCCAGCTCTGCCACTTACTGG - Intronic
920068989 1:203289192-203289214 ACCTTAGCTCTGCCACTTGCTGG - Intergenic
920113827 1:203605606-203605628 ATCCTGGCCCTGCCACTGATGGG + Intergenic
920211640 1:204332786-204332808 ATCCTGGCTCTGCCCCTTGCTGG + Intronic
920259091 1:204676900-204676922 ATTCTGGCTCTGCCACTTGCTGG + Intronic
920447498 1:206029874-206029896 GTCCTGGCTCTGCCACTAACTGG + Intergenic
920827646 1:209436641-209436663 ATCTTAGCTTTGCCACTCGCAGG - Intergenic
920982683 1:210853152-210853174 CCCCTAGCTCTGCCACTTACTGG + Intronic
921123060 1:212153369-212153391 ACCCTAGCTCAACCACTTACTGG + Intergenic
921124929 1:212169003-212169025 ATCCTGACTAGGCCACTGACAGG - Intergenic
921324672 1:213978993-213979015 ATTCTGGCTGTGCCACTTACTGG + Intergenic
921639823 1:217539552-217539574 ATCATAGGTCTGCTACTGAGGGG - Intronic
922053767 1:222020747-222020769 ATCCTGCCTCTTCCACTAACAGG - Intergenic
922130151 1:222769689-222769711 ATCTTAGATCTGCCACTTGCTGG - Intergenic
922216546 1:223524639-223524661 AGTCTATCTCTGCCACTCACTGG - Intergenic
922225184 1:223639866-223639888 GTCCTGGCTCTGACACTGCCTGG - Intronic
922329094 1:224557984-224558006 ATCCTAGCTCTTCCTCTTAGTGG - Intronic
922452730 1:225749986-225750008 CTCCTAGCTCTGCCACAGACTGG + Intergenic
922548354 1:226475313-226475335 ATACCAGCTCTGCCACACACTGG + Intergenic
922852783 1:228747937-228747959 ATTCTGGCTCTGCCACTTACTGG + Intergenic
922967121 1:229699605-229699627 ATCCTTGCTTTGCTACTTACTGG + Intergenic
923017814 1:230140353-230140375 TTCCTACCCCTGCCACTGCCTGG + Intronic
923169402 1:231399744-231399766 AACCCAGCTCTGCCATTGGCTGG - Intronic
923512623 1:234665495-234665517 ATCCAGCCTCTGACACTGACTGG - Intergenic
923658202 1:235936736-235936758 ATCCCAGCTCTTCCACTTACTGG - Intergenic
924067524 1:240240241-240240263 TTCCTAGCTCTGCCACTTTATGG + Intronic
924069872 1:240265672-240265694 ATCTCAGCTCTGCCACTGGCTGG + Intronic
924208778 1:241743418-241743440 ATCCCAGCTCTACCACTTCCCGG + Intronic
1063153164 10:3355065-3355087 GTCCTTGCTCTGTCACTCACAGG - Intergenic
1063437688 10:6047989-6048011 GTCCTAGCTCCACCACTGAGGGG - Intronic
1063503595 10:6576810-6576832 AACCTGACTCTACCACTGACTGG + Intronic
1063873544 10:10446281-10446303 ATCTGGGCTCTGCTACTGACAGG - Intergenic
1064277174 10:13916619-13916641 ATTCTAGCTCTACCACACACTGG - Intronic
1064391671 10:14947534-14947556 ATCCTGGTCCTGCCACTTACTGG + Intronic
1064427836 10:15245647-15245669 ATGCCAGCTCTGCCACCCACTGG - Intronic
1064470883 10:15634496-15634518 ATTCTAGCTCTAACACTGGCTGG - Intronic
1065412701 10:25447353-25447375 ATATTGGCTCTGCCACTTACTGG - Intronic
1065485680 10:26234425-26234447 AATCTTGCTCTGCCATTGACTGG - Intronic
1066300531 10:34091823-34091845 ATCCCAGCTTTGCCACTGACCGG - Intergenic
1066756471 10:38717257-38717279 AGCCCAGCTCAGCCACTCACAGG - Intergenic
1067091497 10:43267819-43267841 AGCCTTGCTCTGCCACTTATAGG - Intergenic
1067197363 10:44133640-44133662 ATCATGGCTCTGCCACTTATTGG - Intergenic
1067511309 10:46897128-46897150 AGCCTGGCCCTGCCACTCACTGG + Intergenic
1067650940 10:48154734-48154756 AGCCTGGCCCTGCCACTCACTGG - Intergenic
1067927746 10:50527489-50527511 ATCTCAGCTCTGCCAATTACAGG - Intronic
1068718187 10:60211419-60211441 ATCCTTGTTCTGCCACTAATTGG + Intronic
1068842510 10:61631185-61631207 ATCCTTCCTCTGCCACTTACTGG + Intergenic
1069431178 10:68335817-68335839 ATCCCTACTCTGCCACTCACTGG - Intronic
1069549341 10:69351717-69351739 ATGCTGACTCTGCCACTTACTGG + Intronic
1069564976 10:69457725-69457747 ATCCCAGCTCTGACACTTAAAGG + Intronic
1069881466 10:71596350-71596372 ATCCTGGCTCTGCCACTTCTTGG - Intronic
1069950276 10:72013866-72013888 GTCCCAGCTTTGCCACTGTCTGG + Intergenic
1070160082 10:73861257-73861279 ATCCCAGCTCTGCTGCTCACTGG - Intronic
1070509282 10:77145836-77145858 ATCCCAGCTCTGCCATTAATTGG + Intronic
1070581005 10:77719528-77719550 ATCTTTGCTCTGCCACAGCCTGG - Intergenic
1070616216 10:77971347-77971369 ATCGTATCTCTGCCTCTGATGGG - Intronic
1070689035 10:78511174-78511196 GTCCTGGCTCTGCCACTTAGAGG - Intergenic
1070750796 10:78962923-78962945 ATCCCAGCTCTGCTACCTACTGG + Intergenic
1070791040 10:79189581-79189603 ATCCTGGCTCTGACACTTGCTGG - Intronic
1070834646 10:79440608-79440630 GATCTAGCTCTCCCACTGACTGG + Intronic
1070904030 10:80055926-80055948 ATCCTGGCTCTGAGACTGACAGG + Intergenic
1071255308 10:83866998-83867020 ATTCTAGCTCTACCACTTAATGG + Intergenic
1071463455 10:85919753-85919775 ATCCCAGTTCTGCCACTTCCTGG + Intronic
1071895694 10:90064219-90064241 ATCCTAGTTCTCTCACTAACTGG + Intergenic
1072237674 10:93467097-93467119 AGCTCAGCTCTGCCACTTACTGG - Intronic
1072459220 10:95604306-95604328 TTTCCAGCTCTGTCACTGACTGG - Intergenic
1072792180 10:98326329-98326351 ATGCAAGCTCTGCCACTTCCTGG - Intergenic
1073044811 10:100630669-100630691 ATCCTTTCTCTGCCATTGACTGG + Intergenic
1073084760 10:100881025-100881047 ATCCTGGCTCTGCCACTCACTGG - Intergenic
1073140534 10:101244302-101244324 ATCCTTACTCTGCCACTTCCTGG - Intergenic
1073204495 10:101761741-101761763 ACCCTGGCTCTGTCACTGCCTGG - Intergenic
1074161938 10:110842755-110842777 ATCCCAACTCTGCCACTTACTGG - Intergenic
1074290540 10:112135294-112135316 CTCCCAGCTCCACCACTGACCGG + Intergenic
1074513098 10:114137374-114137396 GTCCTAGCACTGTCACTGAGGGG + Intronic
1074549514 10:114429551-114429573 ATTCTAGCTCTGCTGCTCACTGG + Intergenic
1074852746 10:117451822-117451844 TTCCTGGATCTGTCACTGACTGG - Intergenic
1074893901 10:117758144-117758166 ATCCTGGTTCTGCCACCTACTGG + Intergenic
1075103850 10:119524345-119524367 GTCCTAGCTCTGCCACGGTGCGG + Intronic
1075306732 10:121374637-121374659 ATCCTAGCTCTGCCACTGTGAGG - Intergenic
1075347773 10:121696905-121696927 AACCCAGCTGTGCCACTCACTGG - Intergenic
1075518224 10:123126680-123126702 ATTCCAACTCTGCCACTTACAGG - Intergenic
1075598877 10:123752737-123752759 ATCATAGCTCTGCCACTCACTGG + Intronic
1076201932 10:128566067-128566089 ATCCTGGCTCCGTCACTCACAGG + Intergenic
1076397946 10:130155161-130155183 TTCCTAGCTCTCCCAATGGCTGG - Intronic
1076990387 11:270603-270625 CTCCTGGCTCTGCCACTCACTGG - Intergenic
1077297699 11:1833896-1833918 CTCCTTGCTCTGCCCCAGACTGG + Intronic
1077474551 11:2780215-2780237 GTCCTTGCCCTGCCACTGACTGG + Intronic
1077674207 11:4182858-4182880 ATCCCAGCTCTGCTACTTCCTGG - Intergenic
1077747026 11:4918180-4918202 ATTCCAGCTCCGGCACTGACTGG - Intronic
1078141205 11:8694212-8694234 ATCCTTCCTCTCCCACTGACAGG - Intronic
1078202303 11:9194539-9194561 AGTCTAGCTCTGTCACTGGCTGG - Intronic
1078307814 11:10208095-10208117 ATCTTAGCTCTGTCACTAACTGG + Intronic
1078483555 11:11701414-11701436 GTCCTGGCTCTGCCATTTACAGG - Intergenic
1078513714 11:12006420-12006442 GTCCCTGCTCTGCCACTTACTGG - Intronic
1078747928 11:14133019-14133041 ATCCTAGCATTACCACTTACTGG - Intronic
1078873731 11:15373165-15373187 ATCCTAATTCTGCCACTGATTGG - Intergenic
1079017338 11:16880294-16880316 ATCCCAGCTCTGCCACACACTGG + Intronic
1079099220 11:17530400-17530422 ATCCTGGCTCTGCCACTTACTGG + Intronic
1079100940 11:17541943-17541965 ATCTTAGCCCTGTCACTGTCAGG - Intronic
1079116146 11:17641780-17641802 ACCCTGGCTCTCCCACTGCCTGG - Intronic
1079305532 11:19317993-19318015 ATCCTAGCTCTGCCACTTACTGG + Intergenic
1079314093 11:19392935-19392957 ATCCCTGCTCTGGCACTCACTGG - Intronic
1079697668 11:23503083-23503105 ATCCCAGCTTTGCCACTTATTGG + Intergenic
1080263497 11:30376103-30376125 CTCCTGGCTTTGCCACTTACTGG - Intergenic
1080308930 11:30867296-30867318 ATCCCAGTTCTGCCACTTATTGG + Intronic
1080430771 11:32196954-32196976 AGCCTGGCTCTTTCACTGACTGG - Intergenic
1080684058 11:34501100-34501122 CTCCTAGCTCTGCCACTTACGGG - Intronic
1080778982 11:35413317-35413339 AGCCTAGCTTTGCCACTCACTGG + Intronic
1080826638 11:35854126-35854148 ATCCTAACTATCCCACTCACTGG + Intergenic
1080857142 11:36122052-36122074 ATCCTGGCTCTGCCATTTACTGG - Intronic
1080891102 11:36409866-36409888 ATCCCAGCTCAGGCACTTACTGG - Intronic
1081076416 11:38679519-38679541 TTCCTAACTCTGCCTCTGACGGG - Intergenic
1081415382 11:42808761-42808783 ATCCTACCTCTGCCACTATGTGG + Intergenic
1081581956 11:44358700-44358722 ATTCCAGCTCTACCACTTACCGG - Intergenic
1081755530 11:45541645-45541667 GTTCCAGCTCTGCCACTGACTGG + Intergenic
1081760622 11:45574322-45574344 CTCCTGGCCCTGCCACTGACTGG - Intergenic
1081771857 11:45655089-45655111 ATCCCAGCTCAGCCACTTACTGG + Intronic
1081912905 11:46711579-46711601 GTCCTGGTTCTGCTACTGACTGG - Intergenic
1081954772 11:47081508-47081530 ATCTGAGCTCTGCCACTTATTGG - Intronic
1082009771 11:47442147-47442169 ATCCCAGCTTTGTCACTTACTGG - Intronic
1082195997 11:49306529-49306551 ATGCTTCCTCTGCCACTTACTGG - Intergenic
1082828064 11:57595656-57595678 ATCCTGGCTCTGTCACTTACTGG + Intergenic
1083050615 11:59773016-59773038 ATCCTAGCTCTACCAATTGCTGG - Intronic
1083052554 11:59790253-59790275 ATCCTTGCCCTGGCACTTACTGG - Intronic
1083096171 11:60253761-60253783 GACCCAGCTCTGCCAGTGACTGG + Intergenic
1083106305 11:60361588-60361610 GACCCAGCTCTGCCAGTGACTGG - Intronic
1083196192 11:61090036-61090058 ATCCTGGCTCAGCCCCTCACTGG - Intergenic
1083236186 11:61352241-61352263 GTCCCAGCTCTGCCACTTACTGG + Intronic
1083257146 11:61503534-61503556 ATCCTGGCTCCGCCCCTTACCGG + Intergenic
1083275893 11:61596947-61596969 ATCCCTGCTCTGCCATTCACTGG - Intergenic
1083295807 11:61715092-61715114 GTCTTGGCTCTGCCACTTACTGG - Intronic
1083634020 11:64110480-64110502 ATCCTGCCTCTGCCACTTTCAGG - Intronic
1083676806 11:64330578-64330600 ATCTTGGCTCTGCCACTTCCTGG + Intergenic
1083709671 11:64540445-64540467 ACCCTGGCTCTGCCACTCACCGG - Intergenic
1083830203 11:65226600-65226622 ATCTCAGCTCTGCCACTTACTGG + Intergenic
1084033847 11:66496132-66496154 ATCCTGGCTCTGCCACTTAGTGG - Intronic
1084181471 11:67448734-67448756 ATCCTGGCTCCACCACTCACAGG - Intergenic
1084418728 11:69049583-69049605 ATCCCACCTCGGCCACTTACTGG - Intronic
1084687057 11:70702837-70702859 AACCCAGCTCTGCCACTTACTGG + Intronic
1085043088 11:73338286-73338308 ATCCTGGCTTGGCCACTTACTGG - Intronic
1085044440 11:73344890-73344912 GTCCTTGCTTTGCCACTCACAGG + Intronic
1085299996 11:75452266-75452288 ATCCTGGCTCTGCTACCTACTGG + Intronic
1085311035 11:75516835-75516857 ATCCTGGCTTTGTCACTTACTGG - Intronic
1085554471 11:77407476-77407498 AGCCTAGGGTTGCCACTGACAGG - Intronic
1085636161 11:78161017-78161039 ATCTTAGCTCTGCCACATTCTGG + Intergenic
1085718983 11:78896793-78896815 ACCCTGGTTCTGCCACTTACTGG + Intronic
1085724790 11:78944875-78944897 ATCCCAGCCATGCCACTTACTGG - Intronic
1085770416 11:79320588-79320610 AACCTGGCTCTGCCATTTACTGG - Intronic
1085840854 11:80010174-80010196 ATCCTGGCTCTGCCACTTAGAGG + Intergenic
1086141915 11:83508786-83508808 ATCCCAGTTCTGCCACTTGCCGG - Intronic
1086430292 11:86730817-86730839 ATTTCAGTTCTGCCACTGACTGG + Intergenic
1086659832 11:89401704-89401726 ATGCTTCCTCTGCCACTTACTGG + Intronic
1086914897 11:92518350-92518372 ATCCTATCTCTGCAAAAGACAGG - Intronic
1086917714 11:92550004-92550026 ATCCTAACTCTTCCATTTACAGG - Intronic
1087085622 11:94215637-94215659 GTCCCAGCTCTGCCACTTGCAGG - Intergenic
1087104940 11:94399455-94399477 ATCCTGGCTCTGCCAACTACTGG + Intronic
1087187844 11:95220792-95220814 ATCCTAAGTCTGTCACTTACTGG + Intronic
1087658815 11:100961259-100961281 ATCCTAGCTCAGCCACTTACAGG + Intronic
1087748289 11:101975495-101975517 ATCCCAGCTTTGCCCCTTACTGG + Intronic
1087927034 11:103930587-103930609 ACTCTGGCTCTACCACTGACTGG - Intronic
1088327184 11:108612967-108612989 GTCCCAGCTTTGCCACTTACTGG - Intergenic
1088437587 11:109832303-109832325 ATCCTATCTCTCCTACTTACTGG - Intergenic
1088463209 11:110104652-110104674 ATCCCAGCTCTGCCATTTACTGG + Intronic
1088690247 11:112320573-112320595 ATCCTAGCTCTGCCTCTTGCTGG - Intergenic
1088943323 11:114483232-114483254 ACCCCAGCTCTGCCACTCGCTGG + Intergenic
1088990026 11:114945437-114945459 ATCACAGCTCTGCCACTTACTGG + Intergenic
1089147169 11:116337564-116337586 GTTCTATCTCTGCCACTTACAGG + Intergenic
1089256028 11:117194474-117194496 ATGCCAGCTGTGCCACTCACTGG - Intronic
1089278918 11:117358903-117358925 ATCCCATCTCTGCCCCTCACTGG + Intronic
1089283910 11:117393608-117393630 ATCCTAGCTCTTCTACTTATTGG - Intronic
1089364990 11:117915997-117916019 ACCCTGGCTCTGCCACCGACAGG - Intronic
1089442683 11:118530418-118530440 GTCCCAGCTCTGCCACTAAGTGG + Intronic
1089459302 11:118643455-118643477 GTCCTAGCTCTGCCACTAACAGG - Intronic
1089745126 11:120611251-120611273 ATCCTAGCTCTGCTGATTACTGG + Intronic
1089907980 11:122065120-122065142 ATCTGAGCTCTGCCATTTACTGG - Intergenic
1090131120 11:124143042-124143064 AATCTGGCTCTGCCACTGATGGG - Intronic
1090233518 11:125128007-125128029 ATCCTGGCTCTACCCCTTACTGG + Intergenic
1090416931 11:126547151-126547173 AGCCCAGATCTGCCACTAACTGG - Intronic
1090864640 11:130688498-130688520 ATCACAGCTCTGCCACTTACTGG - Intronic
1090917938 11:131182813-131182835 ATCCCAGCTCTGCTACTTACTGG + Intergenic
1090985748 11:131764536-131764558 ATTTTGGCTCTGCCACTAACTGG + Intronic
1091448123 12:556418-556440 GTCCTAGCTTTGCCACTGGCTGG - Intronic
1091825001 12:3505685-3505707 ATTCCAGCTCTGCTACTTACTGG - Intronic
1091904554 12:4173797-4173819 GTCCTGGCCCTGCCACTAACTGG - Intergenic
1091914208 12:4256505-4256527 ATCCTGGCTCTACCACTTATTGG - Intergenic
1091983187 12:4883209-4883231 ATCTCAGCTCTGCAACTGAGTGG + Intergenic
1092051273 12:5472323-5472345 ATTCTAGCTCTGTCACCTACTGG + Intronic
1092126341 12:6077527-6077549 AGCCCAGCTCTGCCACTTACTGG + Intronic
1092194147 12:6539075-6539097 CCCCTGGCTCTGCCACTGAACGG + Intronic
1092236281 12:6812062-6812084 ATCCTAGCTCCACCACTTACGGG + Intronic
1092725741 12:11483961-11483983 ATCCCAGCTCTGCTTCTGTCCGG - Intronic
1092761071 12:11811826-11811848 ATCCCAGCTCTGTTCCTGACTGG - Intronic
1093062835 12:14625242-14625264 ATCCCAGCTCTGCCATTCACTGG + Intronic
1093987782 12:25556387-25556409 ATCTTGGCTCTGCCATTTACTGG - Intronic
1094464597 12:30738372-30738394 ATCTTGGCTCTACCACTTACTGG + Intronic
1094569620 12:31630180-31630202 GTCCCAGCTCTGTCACTCACTGG - Intergenic
1095507593 12:42913986-42914008 AGCCTGGCTCTGGCACTGACTGG - Intergenic
1095954888 12:47800248-47800270 ATGCTAGCTCTGCCCCTAGCAGG - Intronic
1096088798 12:48884390-48884412 ATCCCAGCTCTTCCACTTACCGG - Intergenic
1096428189 12:51521736-51521758 ATCTTAGCTCTGCCATCTACTGG - Intergenic
1096551244 12:52373347-52373369 ATCCCAGGTCTTCCACTTACTGG - Intergenic
1096926267 12:55151298-55151320 ATTCATGCTCTGCCACTCACTGG - Intergenic
1097168391 12:57098309-57098331 ATTCTAGCTCCACCACTTACTGG - Intronic
1097262996 12:57729963-57729985 ATCCTGGTTCTGCCACTTACTGG + Intronic
1097702462 12:62834423-62834445 ATCCCAGCTGTGCCACTTCCTGG - Intronic
1097840956 12:64320675-64320697 ATCCTGGCTCTGCCACTTAATGG + Intronic
1098055461 12:66500251-66500273 TTCCTGGCTCTGCAACTTACTGG - Intronic
1098113562 12:67150361-67150383 CTTCTAGCTCTATCACTGACTGG - Intergenic
1098234297 12:68403686-68403708 ATCCTTGCTCTGTCACTTACTGG - Intergenic
1098448421 12:70591365-70591387 ATTCTAGCTCTACCACTTACTGG + Intronic
1099660590 12:85554493-85554515 ACCCTCGCTCTGCCTCTTACTGG + Intergenic
1099935387 12:89119022-89119044 ATCCCAGCTCTGTCACTCACTGG - Intergenic
1099948550 12:89273693-89273715 ATCCTAGCTCCACCACTTACTGG - Intergenic
1100079397 12:90829152-90829174 ATCCCAGTTCTGCCACTGACTGG + Intergenic
1100096779 12:91048963-91048985 ATCCCAGCTTTGCCACTTACTGG - Intergenic
1100197175 12:92260215-92260237 ATCCTAGCTCCGCCATTAATTGG - Intergenic
1100252120 12:92837306-92837328 ATCTCAGCTTTGCCACTTACTGG - Intronic
1100757038 12:97762833-97762855 AACCTGGCTCTACCACTTACTGG - Intergenic
1100876839 12:98971085-98971107 ATCCTAACTCTGCCCCTTGCTGG + Intronic
1101406784 12:104435796-104435818 TTCCTAGTTCTACCACTTACTGG - Intergenic
1101646960 12:106640246-106640268 TTCCTGCCTCTGCCACTGATTGG - Intronic
1101806913 12:108072135-108072157 ATCTTGTCTCTGCCACTCACCGG + Intergenic
1101898188 12:108771100-108771122 ATCTTTGCTCTGCCACTTCCTGG - Intergenic
1102009115 12:109607146-109607168 ATCTCAGCTCTGCCACTTGCTGG + Intergenic
1102034098 12:109761147-109761169 GTCCCAGCTCTGCCACACACTGG - Intronic
1102076168 12:110061890-110061912 ATCTCAGCTCTACCACTTACTGG + Intronic
1102203807 12:111076475-111076497 ATCCCGGCTCTGCCACTTCCTGG - Intronic
1102216208 12:111163092-111163114 ATCTCAGCTCTGCTGCTGACTGG + Intronic
1102241116 12:111325489-111325511 ATCCTAGGTCTGCCACTCACTGG - Intronic
1102282169 12:111627014-111627036 ATCCCAGCCCTGCTACTGCCTGG - Intergenic
1102401703 12:112635356-112635378 ATCTCAGCTTTGCCACTTACAGG + Intronic
1102499075 12:113338791-113338813 ATCCCAGCTCTGCCATTTACTGG + Intronic
1102517243 12:113458034-113458056 AACCTAGCTTTGCCACTCCCTGG + Intergenic
1102620069 12:114187288-114187310 ATCCTGCCTCTGCCTCTCACTGG - Intergenic
1102759878 12:115375915-115375937 ATTCTGGCTTTGCCACTTACTGG - Intergenic
1102894297 12:116586295-116586317 ATCTTGGCTCTGCCACTTACTGG + Intergenic
1103217810 12:119216254-119216276 ATCCTATTTCTGCTGCTGACTGG + Intronic
1103236121 12:119374146-119374168 ATCCCAGCTCTGCCACTTAATGG + Intronic
1103405885 12:120674950-120674972 ACCCCAGCTCTGCCACTTAAGGG + Intergenic
1103428994 12:120865403-120865425 ATCCTGGGTCTACCACTTACTGG + Intronic
1103441499 12:120966214-120966236 ATCCCAGCTCTGCCATTTCCTGG + Intergenic
1103485309 12:121278963-121278985 ATCCTAGAGCTGCCTCTGATAGG + Intronic
1103548316 12:121717517-121717539 ATCCTGGCTCCTGCACTGACAGG - Intronic
1103715373 12:122942135-122942157 ATCCTGGCTCTGCCACTTCTAGG - Intronic
1103970988 12:124671315-124671337 ATCCCAGATCTGCCACTCACTGG - Intergenic
1104047603 12:125174122-125174144 ATCCCAGCTCTGCCACTCACTGG - Intergenic
1104128811 12:125873106-125873128 TTCCAGGCTCTGCCACTTACAGG + Intergenic
1104554203 12:129785320-129785342 ATCTCAACTCTGCCACTAACTGG + Intronic
1104586587 12:130052823-130052845 ATCCCAGCTTGGCCACCGACAGG - Intergenic
1105778857 13:23689098-23689120 ATTACAGCTCTGCCACTTACTGG - Intergenic
1106050802 13:26187639-26187661 ATCCTGACTTTGCCACTGATTGG - Intronic
1106188030 13:27425746-27425768 AGCCTAGCTCTGCCAAAAACTGG - Intronic
1106223924 13:27771003-27771025 ATCGCAGCTCTGCCACCTACTGG - Intergenic
1106234744 13:27852370-27852392 ATCCTGGCTCTGCCACGTCCTGG - Intergenic
1106296217 13:28416224-28416246 GTCCTGGCTCTGCCACCTACTGG - Intronic
1106630908 13:31471850-31471872 GTCCTAGCTGTGCCACTAACTGG - Intergenic
1106766077 13:32915302-32915324 ATCCCAGCTCAGCCACTTGCTGG - Intergenic
1107293125 13:38879917-38879939 GTCCTGCCTCTGCCACTAACTGG + Intronic
1107434732 13:40372350-40372372 ATCCCAGCTCTCCCAGTAACTGG + Intergenic
1107832530 13:44387003-44387025 ATCCTGGCTCTGCCAGTCCCGGG + Intronic
1108006269 13:45949839-45949861 ATTCTAACTCTGCCACAAACTGG - Intergenic
1108246815 13:48524490-48524512 ATACTGGCTCTGACACTGATTGG - Intronic
1108461219 13:50669322-50669344 TGCCTTCCTCTGCCACTGACTGG - Intronic
1108580883 13:51827288-51827310 ATCCTGGCCCTGTCACTCACTGG + Intergenic
1110664442 13:78100310-78100332 TTCCTTGCTCTGCCACTTGCTGG + Intergenic
1110752438 13:79130633-79130655 AACAAAGCTCTGCCATTGACAGG - Intergenic
1111437429 13:88228412-88228434 ATCCCAGCTCAGGCAGTGACTGG - Intergenic
1111892605 13:94102807-94102829 CTCTCAGCTCTGCCACTAACAGG + Intronic
1112647192 13:101347669-101347691 ATCCCAGCTCTGCCATTTACTGG + Intronic
1112921583 13:104619753-104619775 ATGACAGCTCTGCCACTGATTGG - Intergenic
1113284160 13:108828380-108828402 ATCCTGGCTCTGCCATTTACTGG + Intronic
1113287980 13:108874578-108874600 ATGCTAGCTCTGCCACTCATGGG - Intronic
1113850321 13:113414055-113414077 AGCCCAGCACAGCCACTGACTGG - Intergenic
1113856642 13:113449892-113449914 GTCCAAGCTCTGCCACTCGCTGG + Intronic
1113930396 13:113965219-113965241 AGCCCAACTGTGCCACTGACTGG + Intergenic
1114003093 14:18282612-18282634 ATCCCAGCTCTTCCACTTTCTGG - Intergenic
1115302292 14:31897979-31898001 ATCCTGGCTCTGTCACTTGCTGG - Intergenic
1115332902 14:32217328-32217350 ATCCTATCTGTGCCACTGACTGG - Intergenic
1115429207 14:33297173-33297195 ATCCTAGCTCTGCCATTTACTGG + Intronic
1115451805 14:33556690-33556712 ATCCTGGCTCTGCCACTGACTGG + Intronic
1115506656 14:34099764-34099786 ATCCTGGCCCTGGCACTGGCAGG - Intronic
1115604779 14:34989967-34989989 ATCCTAGCTCTGTTACATACTGG - Intronic
1115630853 14:35243681-35243703 AACCTAGTTCTGCTACTTACTGG + Intronic
1115650088 14:35396914-35396936 AGCCTGGCTCTGCCATTTACTGG + Intergenic
1115882887 14:37939874-37939896 ACCCTGGCTCTGCCACTCACTGG + Intronic
1117496590 14:56311719-56311741 ATCCCAGCTCTGCCACTTGCGGG + Intergenic
1117601998 14:57385728-57385750 ATCCTGGCTCTGCCAATTACTGG - Intergenic
1117621542 14:57592224-57592246 ATCCTAGCCCTGCCATTGTATGG + Intronic
1117831352 14:59754490-59754512 ATTCTGGCTCTACCACTAACTGG + Intronic
1118020153 14:61703533-61703555 GGCCTTACTCTGCCACTGACAGG + Intronic
1118334471 14:64841240-64841262 ATCCTGGCTCTGTCATTTACAGG - Intronic
1118335606 14:64851258-64851280 ATTCCAGCTCTGCCACTTACTGG + Intronic
1118372108 14:65146085-65146107 ATCCTGCCTCTGCCACTTATTGG - Intergenic
1118611311 14:67542438-67542460 AACTTGGCTCTGCCACTTACTGG + Intronic
1118704367 14:68466865-68466887 AATCTAGCTCTTCCACTGATTGG - Intronic
1118758312 14:68861647-68861669 GTCCTAGCTCTGTCACTCACTGG + Intergenic
1118801786 14:69196503-69196525 AACCTAGCAATGCCACTGGCAGG - Intronic
1118838559 14:69494302-69494324 GTTAGAGCTCTGCCACTGACTGG - Intronic
1118906541 14:70027637-70027659 ATCCCAGCTCTGACAATTACCGG + Intronic
1119702358 14:76763641-76763663 ATCTCAGTTCTGCCACTTACTGG - Intronic
1119720314 14:76885551-76885573 ATCCCGGCTCTGCCACTCCCTGG + Intergenic
1120009562 14:79398283-79398305 ATCCTAGGTCTGCAAGGGACTGG - Intronic
1120417116 14:84233478-84233500 ATCCTAGCTCCATTACTGACTGG - Intergenic
1120532910 14:85655982-85656004 AGCCTAGCTCTACCACTTCCTGG + Intergenic
1120815548 14:88853604-88853626 ATTCTTGTTCTGCCACTTACTGG - Intronic
1120951402 14:90045272-90045294 ATCTCAGCTCTGCCACTTACTGG + Intergenic
1120960798 14:90123004-90123026 GTCCCAGCTCTGCCACTAACTGG - Intronic
1121017954 14:90559862-90559884 ATTCTAGCTCTGCCATACACTGG - Intronic
1121102435 14:91259176-91259198 ATCCTGGCTCCTCCACTTACTGG + Intergenic
1121258311 14:92548309-92548331 ATCCCAGTTCTGCCACTTATTGG + Intronic
1121439524 14:93939935-93939957 AGCCCAGCTCTGCCCCTTACTGG - Intronic
1121444629 14:93970758-93970780 ACCCTAGCTCTGCCACCTCCTGG + Intronic
1121584784 14:95055770-95055792 ATCCTGGCTCTGCTCCTTACAGG + Intergenic
1121829265 14:97035497-97035519 ATCCTGGCTCTGCCATTTACCGG - Intergenic
1121884464 14:97530702-97530724 ATTTTAGATCTGCCACTTACTGG + Intergenic
1122254787 14:100468812-100468834 ATCCCAGCTCTGTCACTCCCTGG - Intronic
1122254964 14:100469826-100469848 ATCCTGGCTCTGTCACTTGCTGG - Intronic
1122298162 14:100717113-100717135 ATCCCAGCTCTGCCATGGAAAGG + Intergenic
1122548459 14:102537775-102537797 ATCCCAGCTCTGCCACTTCCAGG + Intergenic
1123388206 15:19840895-19840917 ATCCCAGCTCTTCCACTTTCTGG - Intergenic
1123425550 15:20167861-20167883 AACCTCACTCAGCCACTGACAGG - Intergenic
1123440739 15:20289322-20289344 AGCCCAGCTCAGCCACTCACAGG - Intergenic
1123534772 15:21174379-21174401 AACCTCACTCAGCCACTGACAGG - Intergenic
1124353513 15:28977960-28977982 ATCCCAGCTCTGCCACTCAGGGG + Intronic
1124901548 15:33827781-33827803 ATCCTGGTTCTGCCACTTACTGG + Intronic
1125098826 15:35886293-35886315 ATCTTGGTTCTGCTACTGACTGG + Intergenic
1125118564 15:36124832-36124854 ATCCCAACTTTGCCACTTACTGG - Intergenic
1125124326 15:36201837-36201859 ACCCAAGCTCTGGCACTTACTGG - Intergenic
1125524475 15:40366480-40366502 GCCCTTGCTCTGCCACTAACTGG - Intronic
1125753093 15:42043711-42043733 ATCTTGGCTCTGGCACTTACTGG + Intronic
1125859727 15:42987185-42987207 ATCCCGGCTCTGCCCCTGCCGGG - Intronic
1125988763 15:44084084-44084106 GTTCCAACTCTGCCACTGACTGG + Intronic
1126007897 15:44276169-44276191 ATCCTATGTCTGCCTTTGACTGG + Intergenic
1126700776 15:51365611-51365633 ATTCTAGCTCGTCCACTCACTGG - Intronic
1126771487 15:52060971-52060993 ATCCTAGCTCTGCAAGTCACTGG - Intronic
1126859974 15:52873920-52873942 AATCTAGCTCTGCCATTGAAAGG - Intergenic
1127293528 15:57591162-57591184 ATCCTACCTTTGCCACTGAGAGG + Intergenic
1127334710 15:57972199-57972221 GTCCTGGCTCTGCCACTCAGTGG - Intronic
1127367960 15:58309302-58309324 GTCCCAGCTCTGTCACTCACAGG + Intronic
1127602617 15:60553520-60553542 ATTTTAGCTCTGCAACTAACTGG + Intronic
1127807541 15:62534931-62534953 ATCCTGGCTCTGCCCCTAAGTGG + Intronic
1127837165 15:62799188-62799210 ATCCCAACTCTGCCACTGCTGGG + Intronic
1127982155 15:64043052-64043074 ATCCCAGCTCTGTCACTTACTGG + Intronic
1127982559 15:64045794-64045816 ATCCTAGCTCTACCCCAGGCCGG + Intronic
1128353267 15:66906212-66906234 ATCCTTCCTCTGCTACTTACTGG + Intergenic
1128359874 15:66954469-66954491 ACCCCAGCTCTGCCACCCACCGG - Intergenic
1128532415 15:68463582-68463604 ATCCTAGCTCTGCCTCGAACTGG + Intergenic
1128566126 15:68701256-68701278 ATCCTGGCTCTGCCACTTCCAGG + Intronic
1128569074 15:68720201-68720223 ATCCTGGCTCTGCCATTTCCTGG + Intronic
1128581843 15:68816325-68816347 ATCCTGGTTCTGCCACTCACTGG + Intronic
1128600294 15:68990185-68990207 ATCCTGGCTCTGCCCCTTACTGG + Intronic
1128648723 15:69395354-69395376 ATCCTAGCTCTGCTTCTTATTGG + Intronic
1128796960 15:70473112-70473134 ATCCTGGCCCTGCCATTCACTGG + Intergenic
1128966959 15:72069000-72069022 ATCCTAGCTCTGCCATGTACTGG - Intronic
1129261606 15:74371488-74371510 ATCCTAGTTCAACCACTGAGTGG + Intergenic
1129294106 15:74590328-74590350 ATCTCAGCTCTACCACTTACTGG - Intronic
1129296747 15:74604067-74604089 GTCCCAGCTCTGCCACAAACTGG - Intronic
1129373314 15:75111313-75111335 ACTCCAGCTCTGCCACTCACTGG + Intronic
1129645555 15:77427927-77427949 ATCCTGTCTCTACCACTTACTGG - Intronic
1129667147 15:77585589-77585611 ATCCTCACTCTGCTACTTACTGG + Intergenic
1129704429 15:77786304-77786326 GTCCCAGCCCTGCCACTTACTGG - Intronic
1129734769 15:77953263-77953285 TTCCTGGCTCTGCCAATGATAGG + Intergenic
1129750883 15:78062911-78062933 ATCCCAGCTCTGCTACTGGCTGG + Intronic
1129764181 15:78150543-78150565 ATCCTAGCAATGCCACTGATTGG + Intronic
1129783045 15:78287246-78287268 ATACTGCCTCTGCCACTAACAGG + Intronic
1129794484 15:78365806-78365828 CTCCTGGCTCTGCCACTGACCGG + Intergenic
1129816972 15:78563993-78564015 ATTCTAGTTTTGCCACTGACAGG + Intergenic
1129840821 15:78742728-78742750 TTCCTGGCTCTGCCAATGATAGG - Intergenic
1129855972 15:78825450-78825472 GTCCTGGCTCTGCCAGTTACTGG - Intronic
1130316991 15:82804518-82804540 ATCCAAGCTCTTCACCTGACTGG - Intronic
1130809603 15:87363041-87363063 ATTCCAGCTCTGTCACTCACAGG - Intergenic
1130982125 15:88819951-88819973 ATTCTGGCTCTACCACTCACTGG + Intronic
1131020102 15:89090197-89090219 ATCCCAGCCCTGCCTCTTACTGG + Intronic
1131185785 15:90272815-90272837 GTCCCAGCACTGCCACTTACTGG - Exonic
1131319875 15:91377107-91377129 TTCCTAACACTGCCACTAACGGG - Intergenic
1131396168 15:92088088-92088110 GTCCCAGCTCTGCCACCAACTGG + Intronic
1131510454 15:93047079-93047101 ATCCCAGCTCTGCCTCTTGCTGG - Intronic
1131863444 15:96679398-96679420 ATCCCAGCTGTGCCACTTACTGG - Intergenic
1131990315 15:98086764-98086786 ATCCTGGCTTTGCTACTTACGGG - Intergenic
1132389740 15:101429514-101429536 ATCGCAGCTCTCCCACTTACTGG - Intronic
1133095803 16:3444283-3444305 CCCCAAGCTCTGCCACTGATTGG + Intronic
1133152224 16:3843194-3843216 AGCCTGGTTCTGCCACTCACTGG + Intronic
1133699094 16:8292433-8292455 ATTCTGGCTCTGCCACTTATTGG + Intergenic
1133711205 16:8402916-8402938 TTCCTCGCTCTGCCACTTACTGG + Intergenic
1133811243 16:9162592-9162614 ATCCCAGCTTTGACACTTACTGG + Intergenic
1133870659 16:9682620-9682642 ATCCCAGCTCTGCCCCTCACTGG + Intergenic
1133971004 16:10567963-10567985 CTCCCAGCTCTGCCACTTACTGG - Intronic
1134038176 16:11048143-11048165 AGCGTGGCTCTGCCACTCACCGG - Intronic
1134080142 16:11319359-11319381 ATTCTTGCTCTGCCACTTAATGG + Intronic
1134392959 16:13836717-13836739 ATTCCAGCTCTACCACTCACTGG - Intergenic
1134880395 16:17740903-17740925 ATTCTAGCTCTGTCACTAGCTGG - Intergenic
1135068663 16:19333263-19333285 ATCCCTGCTCAGCCACTGAACGG - Intergenic
1135185828 16:20314993-20315015 ATCCCAGCTCTGCTACTGACTGG - Intronic
1135210362 16:20520859-20520881 ATTCCAGTTCTGCCACTTACTGG + Intergenic
1135350808 16:21727398-21727420 ATCCTAGCCTTGCCACTAGCTGG + Intronic
1135398501 16:22149204-22149226 ATCCTATCTCAGCCAGTGACTGG - Intronic
1135796170 16:25444952-25444974 ATCCTGGCTCTGCCACTTACTGG - Intergenic
1135880687 16:26252906-26252928 ATCCTGGCTCTCCCACGTACTGG - Intergenic
1135968906 16:27058068-27058090 ATCCTATCTCTTCCAGTGAATGG + Intergenic
1136010379 16:27359628-27359650 ATCCTGACTCTGCCACTCACTGG + Intronic
1136018761 16:27426192-27426214 ATCCCAGCTCTGCCACTTATAGG - Intronic
1136019587 16:27431465-27431487 ATCCCAGCTCTGCCTCTTCCGGG - Intronic
1136090434 16:27915881-27915903 ATTCTGGTTCTGCCACTTACCGG + Intronic
1136427993 16:30182118-30182140 GTCCCACCTCTGCCACTGACTGG - Intergenic
1136526023 16:30831231-30831253 ATCCTAGCTCTGCCAGTTCCTGG - Intergenic
1136542544 16:30936174-30936196 ATCCCAGCTCTGCCACCTCCAGG - Intronic
1136726115 16:32359068-32359090 AGCCCAGCTCAGCCACTCACAGG + Intergenic
1136844448 16:33565113-33565135 AGCCCAGCTCAGCCACTCACAGG + Intergenic
1137382888 16:48014963-48014985 ATTCTGGCTTTGCCACTAACTGG + Intergenic
1137559962 16:49496172-49496194 ATCTTGGCTCTGCCACTTACTGG + Intronic
1137610102 16:49812201-49812223 ATCCCAGCTCTGCCACTTGCTGG - Intronic
1137684355 16:50375354-50375376 GTCCTGGCTCTGCCAAAGACTGG + Intergenic
1137688709 16:50404895-50404917 ACCCAAGCTCTGCCACTTGCTGG + Intergenic
1137904588 16:52307669-52307691 ATCCCAGCTCTACCACTTACCGG - Intergenic
1138166304 16:54804843-54804865 ATCCCAGCTCTGCCACTTGTTGG + Intergenic
1138190234 16:55008757-55008779 ATCCCAACTCTGCCACTTATGGG - Intergenic
1138206614 16:55130277-55130299 ATCCTAGTTGTGCCATTGGCTGG - Intergenic
1138276529 16:55738838-55738860 AGCCTGGCTCTGCTACTTACTGG - Intergenic
1138282454 16:55782196-55782218 AGCCTGGCTCTGCTACTTACTGG - Intergenic
1138286494 16:55814447-55814469 AGCCTGGCTCTGCTACTTACTGG + Intronic
1138344615 16:56312223-56312245 ATCCCAGCTCTACCACCTACTGG + Intronic
1138349203 16:56337558-56337580 GTCCTGGCTCTGCTACTCACTGG + Intronic
1138521120 16:57571365-57571387 GCCCCAGCTCTGCCACTGACTGG - Intronic
1138596326 16:58031169-58031191 ATCCAAGCTCTGCCACTCCCTGG - Intronic
1138735183 16:59242390-59242412 ATCCTATCTCAGCCACTTAATGG + Intergenic
1138845265 16:60557426-60557448 ATACTAGCCCTGCCACTTAATGG + Intergenic
1139192741 16:64883493-64883515 ATCCCAGCTGTGTCACTTACAGG - Intergenic
1139220753 16:65179085-65179107 ATCTTGGCTCTGCCACTAACAGG + Intergenic
1140117700 16:72057105-72057127 ATCCTGACTCTGCCTCTTACAGG - Intronic
1140117917 16:72058829-72058851 ATCCTGACTCTGCCTCTTACAGG - Intronic
1140119934 16:72074858-72074880 ATCCTGACTCTGCCTCTTACAGG - Intronic
1140137659 16:72222089-72222111 ACCCCAACTCTGCCACTTACTGG - Intergenic
1140212314 16:72980155-72980177 GTCCTAGCTCTGCCACTGACCGG - Intronic
1140545885 16:75808542-75808564 ATCCTAGCTTTGCCAATTATTGG + Intergenic
1140557028 16:75933578-75933600 ATCCTGGCTATGCCACTGGATGG - Intergenic
1140730489 16:77851802-77851824 AGCCTAGCTATGGCACTGACAGG - Intronic
1140959533 16:79898848-79898870 ATCCTAGCTCTGCCTTTTACCGG + Intergenic
1140959981 16:79902447-79902469 ATCCAAGGCCTGCCACTCACTGG - Intergenic
1140973625 16:80038014-80038036 ATCCTGGCTCTGTCACTTAGTGG - Intergenic
1141093452 16:81146439-81146461 GTCCTGGCTCTGCCACTAGCCGG - Intergenic
1141154674 16:81588940-81588962 ATCTCAGCTCTGCCTCTTACAGG - Intronic
1141283146 16:82647086-82647108 AGCCCAGCTCTGCCACTGTAGGG + Intronic
1141681984 16:85550263-85550285 ACCCCAGCTCTGCCACCCACTGG + Intergenic
1141760316 16:86024869-86024891 ATCCCCACTCTGCCACTTACTGG - Intergenic
1141826467 16:86484213-86484235 CTCCTGGCTCTTCCACTGACCGG - Intergenic
1141977546 16:87527468-87527490 ATCCTGGCTCTCCCATAGACTGG + Intergenic
1142118725 16:88375347-88375369 ATCCCAGCTCTGCCTCTTACTGG - Intergenic
1142137720 16:88459345-88459367 ACCACAGCTCTGCCACTTACTGG + Intronic
1203000316 16_KI270728v1_random:158688-158710 AGCCCAGCTCAGCCACTCACAGG - Intergenic
1203131918 16_KI270728v1_random:1695091-1695113 AGCCCAGCTCAGCCACTCACAGG - Intergenic
1203154615 16_KI270728v1_random:1865412-1865434 AGCCCAGCTCAGCCACTCACAGG + Intergenic
1142477970 17:200886-200908 ATCCTCGCTCTGTCACTCGCTGG + Intergenic
1142674416 17:1504922-1504944 GCCCCAGCTCTGCCACTCACTGG + Intronic
1142752021 17:1994649-1994671 ATCCCAGCTCCGCCACTGACAGG + Intronic
1142915188 17:3130864-3130886 ATCCAGGCTCTGCCACTTGCTGG - Intergenic
1143006595 17:3839832-3839854 ATCTCAGCTCTGCCACTAACTGG + Intronic
1143349493 17:6277048-6277070 AGCCTGGCTCTGCCACTGTCTGG + Intergenic
1143500545 17:7336341-7336363 ATCCTGGCTCTGTCACTTAGAGG - Intergenic
1143583084 17:7837586-7837608 ATTCTAGCTCTGTCACTTAGTGG + Intergenic
1143701514 17:8664114-8664136 ATCCTAGTTCTCCCACTTCCTGG - Intergenic
1144959211 17:19035474-19035496 ATGCTAGTTCTGCCACTTCCTGG - Intronic
1144966398 17:19079270-19079292 ATCCCAGCTGTGCCACTTTCTGG + Intergenic
1144975948 17:19139050-19139072 ATGCTAGTTCTGCCACTTCCTGG + Intronic
1144981520 17:19172787-19172809 ATCCCAGCTGTGCCACTTTCTGG - Intergenic
1144986704 17:19205452-19205474 ATCCCAGCTGTGCCACTTTCTGG + Intergenic
1145061852 17:19738716-19738738 ATCCCAGCTCTGCCACTAAATGG + Intronic
1145270001 17:21399787-21399809 ATCCCAGCTTTGCCATGGACTGG + Intronic
1145308229 17:21687236-21687258 ATCCCAGCTTTGCCATGGACTGG + Intergenic
1145772806 17:27505547-27505569 ATCCCAGCTTTGCCACTCCCTGG + Intronic
1145866488 17:28245343-28245365 ATCCTGGCTCCGCCATTGGCTGG - Intergenic
1146131136 17:30276339-30276361 ATCCTAATTCTGCCATTTACTGG - Intronic
1146373981 17:32281943-32281965 ATCCTGGCTCTGCCGCTTGCCGG + Intronic
1146550067 17:33772812-33772834 ATCCCAGCTTGGCCACTTACTGG + Intronic
1146570434 17:33948052-33948074 ATCCTGATTCTGCCACTTACAGG - Intronic
1146695224 17:34903784-34903806 ATTCCAGCTCTGCCATTGCCTGG - Intergenic
1146944018 17:36862164-36862186 ATCCTGGCTCTGCCATTTACTGG + Intergenic
1147127442 17:38381590-38381612 ATCCTGGTTCTGCAACTCACTGG - Intronic
1147383034 17:40066804-40066826 ATCCCAGCTCTGTCACTTGCTGG + Intronic
1147647304 17:42041313-42041335 ATCCTGGCTTTGCCACTTACTGG + Intronic
1147651661 17:42065867-42065889 ATCTCAGCTCTGTCACTCACTGG + Intergenic
1148195582 17:45710399-45710421 ATCCCTGCTCTGCCTCTGGCCGG - Intergenic
1148354562 17:46967246-46967268 ATCCCAGCTCTGCCACTTATTGG + Intronic
1148753055 17:49956938-49956960 ATCCCAGCTCTGTCACTTACTGG + Intergenic
1148847893 17:50539934-50539956 ATCCCAGCTCTGCCTCTCCCTGG + Intronic
1148901437 17:50881309-50881331 ATCTCAGCTCTGCCACTTACTGG - Intergenic
1148914226 17:50960938-50960960 ATCCTAGCTCTGACCCTCCCTGG - Intergenic
1149003619 17:51781962-51781984 ATCCCAGTCCTGCCACTTACTGG - Intronic
1149538895 17:57453882-57453904 ATCCTGGCTCTGCCAATTCCTGG - Intronic
1149541728 17:57472570-57472592 ATCCTAGCTCTGCTGCCAACTGG + Intronic
1149993463 17:61395468-61395490 ATCCCAGCTCTGCCACCAGCAGG + Intergenic
1150186992 17:63192618-63192640 ATCCTGGCTCTGCCATTTACTGG + Intronic
1150493150 17:65588083-65588105 ATCCAAGGGCTGCCACTGACTGG + Intronic
1151557828 17:74855489-74855511 GTCCCAGTTCTGCCACTAACTGG + Intronic
1151574891 17:74947982-74948004 GTCCCAGCCCTGCCACTTACAGG - Intronic
1151814971 17:76467352-76467374 ATCCCTGCTCTGTCACCGACTGG - Intronic
1151911771 17:77088289-77088311 AACCCAGCTCTGCCACTTCCTGG + Intronic
1152037607 17:77883127-77883149 GTACCAGCTGTGCCACTGACTGG + Intergenic
1152979339 18:260689-260711 ATCCCAGCTCTACCACTTACTGG - Intronic
1152979784 18:266268-266290 TTCCTTGCTCTGCCACTAACAGG + Intronic
1154224148 18:12486573-12486595 ACCTCAGCTCTGCCACTAACTGG + Intronic
1154297369 18:13162476-13162498 GTCCCAGCTTTGCCACTAACTGG + Intergenic
1154534037 18:15379252-15379274 ATCCCAGCTCTTCCACTTTCTGG + Intergenic
1155060342 18:22222951-22222973 ATCATACCTCTGCCAATGGCTGG - Intergenic
1155203905 18:23540724-23540746 ATCCTGACTCTGCCACTTACGGG + Intronic
1155240026 18:23856138-23856160 ATCCCAACTCTACCACTTACTGG - Intronic
1155287279 18:24302936-24302958 ATCCTTACTCTTCCACTTACCGG - Intronic
1155547695 18:26931806-26931828 ATCCTCACTCTGGCTCTGACAGG + Intronic
1157819491 18:50755020-50755042 ATGCTAACTTTGCCACTGCCAGG - Intergenic
1157971948 18:52280571-52280593 ATCCTAGCTCTCCCACCTCCAGG + Intergenic
1158197804 18:54908519-54908541 ATCCTAGCACAGCCACTCACTGG + Intronic
1158535377 18:58303822-58303844 ATCCTAGTCCTGCCACTTTCTGG + Intronic
1158655504 18:59327369-59327391 ATCCTGGCTCTCTCACTTACTGG - Intergenic
1158930598 18:62321835-62321857 ATCACAGCTCTGCCACTGATTGG + Intergenic
1158944105 18:62433482-62433504 ATTCTGGCTCTGTCACTTACTGG - Intergenic
1159001111 18:62975942-62975964 ATCTTAGCTCTGCCACTTGTAGG + Intronic
1159380272 18:67647486-67647508 ATCCCAGCTCTGCCCCTAACTGG - Intergenic
1159491281 18:69138360-69138382 ATCTTATCTCTGCTACTTACTGG - Intergenic
1161642216 19:5431405-5431427 ATCCCAGCTTTGCCATTTACTGG + Intergenic
1161655580 19:5512609-5512631 ATTCTAGCTCTGCCGCCCACTGG - Intergenic
1161793845 19:6375527-6375549 GGCCTAGCTCTGCCACGGACAGG + Exonic
1161938976 19:7390669-7390691 ATGCTAGCTTTGCCGCTTACTGG - Intronic
1162196224 19:8986877-8986899 ATCCTAACTCTGCCACTTCCTGG - Intergenic
1162464833 19:10833358-10833380 ATCCTCACCCTGCCACTCACTGG + Intronic
1162736334 19:12748952-12748974 CTCCTCCCTCTGCCACTGCCTGG + Intergenic
1162922312 19:13910462-13910484 ATCCGAGCTCTGCCACTTACTGG + Intronic
1162955636 19:14096491-14096513 GTCCCAGCTCTGCCACCGACTGG - Intronic
1163318053 19:16555028-16555050 GTCAGAGCTTTGCCACTGACTGG - Intronic
1163491245 19:17618273-17618295 AGCCCAGCTCTGGCACAGACAGG + Intronic
1163499196 19:17665559-17665581 ATCCTGGCTCTGCCAGTTGCCGG + Intronic
1164451957 19:28373966-28373988 GTCCTGGCTCTGCCTCTAACTGG + Intergenic
1164633624 19:29777451-29777473 AACCTGACTCTGCCACTGCCTGG + Intergenic
1164861454 19:31565229-31565251 AGCTCAGCTCTGCCTCTGACTGG + Intergenic
1165184628 19:34007127-34007149 AGCCTATCTCTCCCACTGAACGG + Intergenic
1165356406 19:35306880-35306902 ATCCCAGCTCTGCCATCTACTGG - Intronic
1165744919 19:38224809-38224831 ATCCTAGCTCTGCCACTTGGTGG + Intronic
1165773978 19:38394505-38394527 ACCCCGGCTCTGTCACTGACTGG - Intronic
1166075381 19:40411114-40411136 GTCCTAGCTCTGCCCCTTTCTGG - Intronic
1166522588 19:43490833-43490855 ATCCCAGCTCTGCCACTTCCTGG + Intronic
1166562222 19:43740500-43740522 ATCCCAGCTCTGCCTCTTCCTGG + Intronic
1166625281 19:44346214-44346236 ATCCTGACTCTACCACTTACTGG + Intronic
1166704300 19:44900269-44900291 ATCCCAGCCCTGCCACAGGCTGG - Intronic
1166726716 19:45032878-45032900 ATCCTGGCTCTGCTGCTTACTGG + Intronic
1167289907 19:48618877-48618899 ATCCTGGCTCTGCCACTTCCTGG + Intronic
1167497283 19:49827069-49827091 ATCCTACCTCTCCCACAGGCGGG - Intronic
1167564623 19:50248655-50248677 ATCCCAGCTCTGCCACTTAGGGG - Intronic
1167565765 19:50255679-50255701 ATCCCAGCTCTGCCACTTACTGG - Intronic
1167748143 19:51364821-51364843 ATCGTAACTCTGCCACTTACTGG + Intronic
1167758397 19:51427450-51427472 ATCCTAGCCCTACCTCTGCCTGG - Intergenic
1168062894 19:53903461-53903483 ATCCTCACTTTGCCACTTACTGG + Intronic
1168245590 19:55111856-55111878 CTCCCAGCTCTGCCTGTGACTGG - Intronic
1168328257 19:55549819-55549841 ATCCCAGCTCTGCCTCTCCCTGG - Intergenic
1168594887 19:57667391-57667413 ATCCTAGCCCAGCCACTTACAGG + Intergenic
1168667481 19:58215341-58215363 ATCCTGGCTCTGCTCCTCACTGG + Intergenic
925064026 2:915153-915175 ATCCACGCTCTCCCAATGACTGG + Intergenic
925925957 2:8670783-8670805 ATCCCAGCACTGCCAATGGCAGG - Intergenic
925990261 2:9249128-9249150 AGCCTAGCTCCACCACAGACTGG - Intronic
926623300 2:15068133-15068155 ATTATAGCTTTGCCACTTACTGG + Intergenic
926691566 2:15738116-15738138 ATCCCAGCTCTGCCACTTACTGG + Intronic
926802276 2:16669040-16669062 ATCCTAATTCTGCCACTCACTGG + Intergenic
926961211 2:18360362-18360384 ATCCCAGCTCTGCTTCTTACTGG + Intronic
927123167 2:19988114-19988136 ATCCTTGTTCCGCCACTTACTGG + Intronic
927474497 2:23402085-23402107 GTTCTGGCTCTGCCCCTGACTGG - Intronic
927493736 2:23538132-23538154 ATCCTAGTTCTGCTACTTATTGG - Intronic
927727707 2:25439680-25439702 ATCCTAGCTTTGCTACTTTCTGG + Intronic
928080551 2:28308804-28308826 AACCTGTCTCTGCCACTCACAGG + Intronic
928084944 2:28340123-28340145 ATCCCAGCCCTGCCATTAACTGG + Intergenic
928266999 2:29820717-29820739 ACCCTGGCTTTGCCACTGACTGG + Intronic
928439535 2:31280452-31280474 ATCCTAGATCTGCCATTTATTGG - Intergenic
929084573 2:38155892-38155914 GTCCCACTTCTGCCACTGACTGG - Intergenic
929744354 2:44640482-44640504 ATCCTGGCTTTGCCACTCTCTGG + Intronic
929907152 2:46056041-46056063 ATCCTGGCTCTACCACCAACAGG + Intronic
930080600 2:47444658-47444680 ATCCCAGCTCTGCTACCTACTGG - Intronic
930084818 2:47488757-47488779 ATCCCAGCTCTGCCACTTACTGG - Intronic
930095309 2:47562023-47562045 GACCTGGCTCTGCCACTAACTGG - Intronic
930368675 2:50476365-50476387 ACCCTGGCTCTGCCACCTACTGG + Intronic
930784036 2:55253074-55253096 ATCCTGGCTATGCTACTTACTGG + Intronic
931577079 2:63729505-63729527 GTCCTGGCCCTGCCACTAACTGG - Intronic
931665422 2:64606926-64606948 GTCCCAGCTCTCCCATTGACTGG + Intergenic
931973412 2:67615623-67615645 ATCCTAGCTCCTACACTTACTGG - Intergenic
932099857 2:68889022-68889044 ATCCCAGCTTTGCCACTTACTGG - Intergenic
932407997 2:71526706-71526728 AGCCCAGCTCTGCCACTAGCAGG - Intronic
932411848 2:71552270-71552292 ATCCTGGCTCTAGCACTTACCGG + Intronic
932667599 2:73709499-73709521 ATCCTAGCTCTGCCTCCTGCAGG + Intergenic
933793473 2:85902172-85902194 TTCCTAGCTCTGGCACTCACAGG - Intergenic
934319770 2:91961513-91961535 AGCCCAGCTCAGCCACTCACAGG - Intergenic
934952811 2:98590391-98590413 ATCCTGGTTCTGCCCCTGACTGG + Exonic
935282621 2:101532311-101532333 ATCCTGGTTCTGCCATTTACAGG - Intergenic
935366125 2:102292738-102292760 GTCCTAGCTCTACTACTTACTGG - Intergenic
935495804 2:103780242-103780264 ATCCTAATTCTGTCACTTACTGG - Intergenic
936066128 2:109333726-109333748 ATCCCAGCTCTGCCACGTATTGG + Intronic
936681268 2:114775027-114775049 ATTCCATCTCTGCCACTTACTGG - Intronic
937277218 2:120692721-120692743 CTCCCAGCTCTAGCACTGACCGG + Intergenic
937680732 2:124641316-124641338 ATGCCAGCTCTGCCACCCACTGG - Intronic
937703679 2:124893176-124893198 ATCTCAGCTCTGCCACTTTCTGG + Intronic
938017240 2:127877315-127877337 ATTCTAGCGCTGCCACTTAGTGG - Intronic
938164169 2:129011641-129011663 ATCCCAACTCTGCCACGGACTGG - Intergenic
938244157 2:129764531-129764553 GTCCCAGCTCTGCCACCCACTGG - Intergenic
938532780 2:132206439-132206461 ATCCCAGCTCTTCCACTTTCTGG + Intronic
938577263 2:132616278-132616300 ATCCTGGCTCTGCCTCTCACTGG - Intronic
938689051 2:133769938-133769960 ATCTTGGCTCAGCCTCTGACTGG - Intergenic
938782536 2:134598503-134598525 ATCTGAGCTCTGCCACTAGCTGG - Intronic
939558672 2:143708084-143708106 GTCTTGGCTCTGCCACTTACTGG + Intronic
940003645 2:148991754-148991776 GTCCTAGCTCTGTCATTCACGGG - Intronic
940376049 2:152960130-152960152 TTCCTAGCTCTGCCTCTGAATGG + Intergenic
940585212 2:155639453-155639475 CTGCTATCTCTGCCACTGACAGG + Intergenic
941135446 2:161711778-161711800 ATCTTAGCTATGCTACTTACTGG + Intronic
941383657 2:164826608-164826630 ATCTGTGCTCTGCCACTTACTGG - Intronic
941625031 2:167822069-167822091 TTCCTTGGTCTGCCACTCACTGG - Intergenic
941746550 2:169092932-169092954 AATCTAGCTCTTCCACTTACTGG - Intronic
941800607 2:169655679-169655701 ATGCTAACTCTGCCATTTACTGG - Intronic
942441937 2:176045990-176046012 ATCTTGGCTCTGCCATTAACTGG - Intergenic
942611654 2:177747921-177747943 ATCCTGGCTCTGCCACCAACAGG - Intronic
943976901 2:194493434-194493456 ATCCTAGCTTTACCACTTGCTGG - Intergenic
944230459 2:197386936-197386958 AACCTGGCTATGCCACTAACTGG - Intergenic
944354332 2:198767867-198767889 ATCCTGGCTCTGCCACTTCCTGG - Intergenic
944990572 2:205230476-205230498 ATCCTAGCTCTACCACAGTAGGG - Intronic
945135719 2:206625705-206625727 ATCCCAGCTCTACCACTAACTGG - Intergenic
945137815 2:206647827-206647849 AACCTTGCTCTGCCACTGGGAGG + Intergenic
945221769 2:207490773-207490795 ATCCTATCTCTGCCACTTTACGG + Intergenic
945647448 2:212516440-212516462 TTCCAGTCTCTGCCACTGACTGG + Intronic
946147619 2:217742924-217742946 ATCCTGGCTCTGCCTCTTGCTGG - Intronic
946521882 2:220474745-220474767 ATCCCAGTTCTGCCACTAATCGG - Intergenic
946649844 2:221880317-221880339 ATCCTGGCTCTGCTACTCACTGG + Intergenic
947192537 2:227522637-227522659 ATCCCAGCTCTACCACTAAATGG - Intronic
947459977 2:230295597-230295619 ATCCTGGATCTGCCACTTAAGGG - Intronic
947837469 2:233185984-233186006 GCCATAGCTCTGCCACTGGCTGG - Intronic
947838060 2:233189361-233189383 ATCCCAGCCCTGCCCCTGTCTGG - Intronic
948084514 2:235236206-235236228 ATCCTAGCTTTGCCACTTCCTGG - Intergenic
948272430 2:236684828-236684850 ATCCCAGCTCTGCCAGTTACTGG - Intergenic
948692940 2:239718442-239718464 CTCCTGGCCCTGCCACTGCCTGG + Intergenic
1168876947 20:1178330-1178352 ATCCAGGCTCTGCCACTTACTGG - Intronic
1168957594 20:1845438-1845460 AATCTAGGTCTGCCACTTACTGG + Intergenic
1168969136 20:1918896-1918918 ATCCCAGCTCTGCCACCTCCTGG + Intronic
1169064444 20:2686643-2686665 ATCCCATCTCTGCCACTCACTGG - Intergenic
1169197450 20:3691197-3691219 ATCCTGGCTCTCCCGCTGTCTGG - Intronic
1169485866 20:6032034-6032056 ATCCTTGCTATGCCACTGCTAGG + Exonic
1169756315 20:9046692-9046714 ATCCCAGCTCTTCCACTGCCTGG - Intergenic
1169870614 20:10244528-10244550 ATCTTGGCTCTGCCACTCACTGG - Intronic
1170218686 20:13918290-13918312 ATCCTAGCTCTCTCATTTACTGG - Intronic
1170394651 20:15912982-15913004 ATCCCAGCTCTACCACTGACTGG + Intronic
1172040632 20:32042297-32042319 ATCCCAGCTCTGGCACTTATTGG + Intergenic
1172043846 20:32065138-32065160 ATAGCAGTTCTGCCACTGACTGG - Intronic
1172068911 20:32241986-32242008 GTCCCAGCTCTTCCACTCACAGG - Intergenic
1172174170 20:32962144-32962166 CTCCTGGCTCTGCCGCTGTCAGG + Intergenic
1172330742 20:34074639-34074661 ATCTCAGCTCTGCCACTGAATGG + Intronic
1172588349 20:36100642-36100664 ATCCCAGCTGTGCCACTTGCTGG - Intronic
1172608958 20:36235254-36235276 ATTCTAGCTCTGCCATTCTCTGG + Intergenic
1173011956 20:39191001-39191023 ATCCCAGCTCTGCCACTTACAGG - Intergenic
1173174951 20:40757571-40757593 AACCTAGCTATGCCACTCCCAGG - Intergenic
1173581163 20:44147823-44147845 ATCTCAGCTCTGTCACTTACTGG + Intronic
1173618958 20:44422091-44422113 ATCCAAGCTCTGCCATTTTCCGG - Intronic
1173662276 20:44742927-44742949 ATCCTGGCTCAGCCACAGCCTGG + Intergenic
1173666624 20:44767642-44767664 ATCCCAGCTCAGCCACTGACTGG + Intronic
1173833106 20:46105389-46105411 ATCCTGGCTCTACCATTTACTGG + Intergenic
1173968035 20:47128678-47128700 ATCCCAGCTCTGCCACTTATTGG + Intronic
1174072840 20:47910705-47910727 ATCTCAGTTCTGCCACTCACTGG - Intergenic
1174141081 20:48414040-48414062 ATTCTGGCTCAGCCACTCACCGG - Intergenic
1174170866 20:48617553-48617575 ATTCCAGCTCTGCCACTTGCTGG - Intergenic
1174174976 20:48638864-48638886 ATCCCAGCTCACCCACTTACTGG - Intronic
1174306297 20:49616440-49616462 ACCCTGGCTCTGCCACTTCCTGG - Intergenic
1174457030 20:50656267-50656289 ATCCTAGCTCTGCCACTTGCTGG + Intronic
1174551432 20:51365259-51365281 TTCCCACCTCTGCCACTTACTGG - Intergenic
1174565925 20:51464416-51464438 ATCCTGCCTCTGCCACTTACTGG - Intronic
1174570309 20:51496714-51496736 ATCCTGGTTCTGCCACTTATTGG - Intronic
1174580311 20:51566789-51566811 ATCCCACCTCTGCCACTTACTGG - Intergenic
1174580453 20:51567797-51567819 TTCCAATCTCTGCCACTTACCGG + Intergenic
1174776657 20:53349151-53349173 ATCCTTGCTCTACCACTAACTGG + Intronic
1175028343 20:55927266-55927288 ATCCCAGCTCAGTCACTCACTGG + Intergenic
1175154948 20:56964465-56964487 ATTCCAGCTCTGCCCCTTACCGG + Intergenic
1175669183 20:60887081-60887103 ATTCTAGCTCAGCCACTGCCTGG - Intergenic
1175765054 20:61586686-61586708 ATACCAGCTCTGCCACTCACTGG - Intronic
1176073135 20:63237037-63237059 GTCCCAGCTCTGCCACTTCCTGG + Intronic
1177185758 21:17794207-17794229 ATCCTTGATCTGCTACTGATTGG + Intronic
1178409524 21:32351874-32351896 ATCCTGACTCCGCCACTGACTGG + Intronic
1178464934 21:32839394-32839416 ATCCTGGCTCTGCCACTAAATGG - Intergenic
1178585838 21:33869804-33869826 TTCCCAGCTCTGCCACCGAGAGG - Intronic
1178711038 21:34916973-34916995 GTCCTGGCTCTGCCACTTGCTGG - Intronic
1179486891 21:41716214-41716236 TTCCTGCCTCTGCCATTGACTGG - Intergenic
1180308021 22:11145557-11145579 AGCCCAGCTCAGCCACTCACAGG - Intergenic
1180427608 22:15213407-15213429 ATCCCAGCTCTTCCACTTTCTGG - Intergenic
1180510862 22:16087794-16087816 ATCCCAGCTCTTCCACTTTCTGG - Intergenic
1180546497 22:16507370-16507392 AGCCCAGCTCAGCCACTCACAGG - Intergenic
1181185398 22:21099809-21099831 ATTCTAGCTTTGCCACTCCCTGG - Intergenic
1181623752 22:24108211-24108233 ATCCCAGATCTGCCACTTAGGGG - Intronic
1181742448 22:24932326-24932348 ATCCCAGCTCTGTCACTGATCGG + Intergenic
1181790229 22:25259646-25259668 GTCCCAGCTCTGCCACTAATCGG - Intergenic
1181826041 22:25516657-25516679 GTCCCAGCTCTGCCACTAATCGG - Intergenic
1181997767 22:26896304-26896326 ATCTTGACTCTGCCACTGAGTGG - Intergenic
1181999879 22:26911582-26911604 TTCCCAGCTCTGCCACTTACTGG + Intergenic
1182058530 22:27380108-27380130 ATCCTAACCCTTCCACTCACTGG + Intergenic
1182158695 22:28100258-28100280 TTCCTAACTCTGCCACTAATTGG + Intronic
1182212692 22:28690009-28690031 AGCCCAGCTCAGCCACTCACAGG + Intronic
1182275754 22:29187788-29187810 ATCCTGGCCCTGCCACTCGCTGG - Intergenic
1182451537 22:30424701-30424723 ATCCTAGCTGTGCCGCCTACTGG - Exonic
1182549229 22:31092003-31092025 GCCTTAGCTCTGCCACCGACTGG - Intronic
1182787808 22:32922269-32922291 ATCCTAGCTTTGCCACTTATTGG + Intronic
1182837549 22:33356399-33356421 ATCCCAGCTGTGCCACCAACCGG + Intronic
1182865193 22:33598208-33598230 ATCCTGGCTCTGCCATGTACCGG + Intronic
1183014646 22:34975910-34975932 ATCCTGGCTCTGCCACCTACTGG + Intergenic
1183194712 22:36345390-36345412 ATCCCAGCTCTGCCCCTTACTGG - Intronic
1183213653 22:36465963-36465985 ATCCCAGCTCAGCCACTCAGGGG + Intergenic
1183245302 22:36688697-36688719 ATCCCACCCCTGCCACTGGCGGG - Intronic
1183319329 22:37155587-37155609 ATCCTGGCTCTGCCACATTCTGG - Intronic
1183334015 22:37236477-37236499 AGCCTTGCTCTGCCACCCACTGG - Intronic
1183544504 22:38448438-38448460 ATCCCAGCTCAGCCCCTCACTGG - Intronic
1183625957 22:39001891-39001913 ATCCTGCTTCTGCCACTTACTGG + Intergenic
1183737674 22:39652943-39652965 ATCCTGGTTCTGCTATTGACTGG + Intronic
1184423703 22:44396643-44396665 GTCCCAGCTCTGCCATTTACCGG - Intergenic
949300029 3:2573078-2573100 ATCTTAGCTCGACCACTTACTGG - Intronic
949664002 3:6315847-6315869 ATCTAAGTTTTGCCACTGACTGG + Intergenic
949715255 3:6922930-6922952 ATCTTATCTTGGCCACTGACAGG + Intronic
949823570 3:8140872-8140894 ATCCCAGCTTTTCCACTGGCTGG - Intergenic
950187130 3:10952111-10952133 ATCCTGGCTCTGCCACTTCCTGG + Intergenic
950205516 3:11077170-11077192 ACACTAGCTCTGCCACTGACTGG - Intergenic
950217380 3:11169113-11169135 ATCACGGCTCTGCCACTGACTGG + Intronic
950217644 3:11170624-11170646 ATCCTGGCTCTGCCACTGACCGG - Intronic
950275882 3:11660221-11660243 ATCTTGGTTCTGCCACAGACTGG + Intronic
950458899 3:13109410-13109432 ATCCAAGCTCTGCCACTCCCCGG + Intergenic
950657824 3:14447984-14448006 ATCCCAGTTCTGCCACTTACTGG + Intronic
950755550 3:15168511-15168533 ATCCTAGATTTGGCACTTACTGG - Intergenic
950771845 3:15318034-15318056 ATCCTGGCTCTACCACTCCCTGG + Intronic
951064640 3:18249605-18249627 ATCCTAGCCCTGCCACTTCCTGG - Intronic
951528736 3:23679092-23679114 ATTCTGGCTCTACCACTCACTGG + Intergenic
951830010 3:26916058-26916080 AGCCTGGCTTTGCCACTGACAGG + Intergenic
952378883 3:32789128-32789150 ATCCCAGCTCTGCTACTCCCTGG + Intergenic
952506031 3:34007512-34007534 ACCCCAGCTCTGCCACTCACTGG - Intergenic
952818410 3:37465458-37465480 ATCCCAGCTCTGCCACTTACTGG + Intronic
952912980 3:38206848-38206870 ATCCCAGCTCTGTCACTAATTGG + Intronic
953002482 3:38948521-38948543 ATCCTAGCTCCACCACTCACTGG + Intronic
953012425 3:39039812-39039834 ATGGTAGCTCTGCCACTGGAGGG - Intergenic
953231706 3:41071118-41071140 ACCCCAGCTCTGCCACTTTCTGG + Intergenic
953369103 3:42372244-42372266 ATCCTAACTCTGCCACTTGCTGG + Intergenic
953374486 3:42417221-42417243 ATCCTATCTCTGTCACTGATTGG - Intergenic
953638592 3:44684866-44684888 ATGCTGGCTCTGCCACTTAGGGG + Intergenic
953777528 3:45833901-45833923 ATCCTGGCTCTGTCACTTCCTGG - Intronic
953799635 3:46012521-46012543 GTCCCAGCTCTGCCACTAGCTGG - Intergenic
954762844 3:52889494-52889516 TGCCTAGCTCTACCACTTACTGG + Intronic
954811048 3:53248243-53248265 ATCCTAGCTCTGCTGCTGGCAGG - Intronic
955065975 3:55533987-55534009 ATCCCAGCTTGGCCACTTACTGG + Intronic
955245033 3:57217226-57217248 TTCCTAGCTCTTCCACTGAGAGG - Intronic
955838225 3:63081906-63081928 ATCCTAGCTCTGCCTATAGCCGG - Intergenic
955868010 3:63406066-63406088 ATCCCAGCTCTGCCACCTTCTGG - Intronic
956005090 3:64770161-64770183 ATCTTGGCTCTGCCACTCACTGG - Intergenic
956009742 3:64817839-64817861 ATCCCAGCTCAGCCACCTACTGG + Intergenic
956051810 3:65256126-65256148 TTCCTAGTTCTACCACTTACTGG + Intergenic
956091126 3:65668093-65668115 ATCCTAACTCTGTCACTAACAGG + Intronic
956169769 3:66423766-66423788 ATCCCAGCTATCCCACTCACAGG + Intronic
956177797 3:66489753-66489775 GTCCCAGCTCTGCCACTGATTGG - Intronic
956188064 3:66581228-66581250 ATCCAAGTTTTGCCACTAACTGG - Intergenic
956425385 3:69129081-69129103 ATCCTGGTTGTGCCACTGACTGG + Intergenic
956591687 3:70922084-70922106 ATCTTAGCTCTGCTTCTCACTGG - Intergenic
956725026 3:72149930-72149952 ATCCCAGCTCTGCCGCTGTCTGG + Intergenic
956833159 3:73073242-73073264 ATCCCAGCTCTGCCATTTTCTGG + Intergenic
956923482 3:73956201-73956223 ATTCTAGTTCTGCCACTAACTGG + Intergenic
957951641 3:87135314-87135336 ATCCTGATTCTGCCACTTACCGG - Intergenic
958889615 3:99769081-99769103 ATCCTAGCTCTGTCAATATCAGG + Intronic
959249172 3:103918743-103918765 AGTCTGGCTCTGCCACTAACAGG - Intergenic
959423473 3:106156284-106156306 ATTCTAGCTGTGTCACTCACTGG - Intergenic
959445845 3:106438343-106438365 ATCCTGGCTCTCTCACTTACTGG - Intergenic
960034425 3:113088203-113088225 ATCCTGGCTCTGCCATTTATTGG - Intergenic
960329673 3:116343354-116343376 ACCCTAGATCTGCCACTGACTGG + Intronic
960571085 3:119185974-119185996 AGCCTAGCTCTGCCACTTACTGG + Intronic
960614184 3:119581868-119581890 ATCCCAGCCCTGCCACTTATTGG + Intronic
960719045 3:120607388-120607410 ATCTTTGCTCTGCCACTTACTGG + Intergenic
960815273 3:121665379-121665401 ATTCTGGCTCTGCCGCTTACTGG - Intronic
960936171 3:122904225-122904247 ATCCTAGGGCAGCCACTGAAAGG + Intergenic
960987595 3:123290831-123290853 ACCCCAGCTCTGCCACTTATTGG + Intronic
961122170 3:124382064-124382086 ATCCTGGTTCTGCCACTTACTGG + Intronic
961210268 3:125120181-125120203 ATCTCAGCTCTGCCGCTGATTGG - Intronic
961237440 3:125379358-125379380 ATCCTGACTCTACCACTTACTGG + Intergenic
961379470 3:126487696-126487718 CTCCCAGCTCTGCCCCTGCCCGG - Intronic
961455086 3:127020093-127020115 ATCCTGGCTCTGACACTTACTGG - Intronic
961569892 3:127790114-127790136 ATCCTGGATCTGCCCCTGACTGG + Intronic
961634131 3:128322223-128322245 ATCCCAGCTCTGCCACCTGCTGG + Intronic
961772443 3:129259946-129259968 ATCTTGGTTCTGCCACTTACTGG + Intronic
962464175 3:135641347-135641369 ATCCGAGCTCTACCACTCACTGG - Intergenic
962479976 3:135789354-135789376 GTCCTGGCTCTGCCACTTGCTGG + Intergenic
962889876 3:139662285-139662307 ATCCTGGTTCTGTCACTGATGGG + Intronic
963435782 3:145263823-145263845 TTCCAAGCTCTGTCACTTACTGG + Intergenic
963847938 3:150178839-150178861 ATCATTGCTCTGCCACTGGGAGG - Intergenic
964266207 3:154898336-154898358 GTCCCAGCTCTGCCACTTACTGG + Intergenic
964384211 3:156130018-156130040 ATCCTAGCTCTGTTTCTGGCTGG + Intronic
964444561 3:156745086-156745108 ATCCTAGTTCTGCCATTAAATGG - Intergenic
964447064 3:156770628-156770650 ATCCCAGCTCTGCCACTTTCTGG - Intergenic
964557924 3:157961252-157961274 ATCCTAGTTCTGATTCTGACAGG + Intergenic
964634072 3:158841876-158841898 ATCCTAGGGCTGCCACTAAATGG - Intergenic
964760732 3:160133153-160133175 ATCCGAGCTCTGCATCTTACTGG - Intergenic
964832018 3:160894611-160894633 AACTCAGCTCTGCCACTAACTGG - Intronic
965479971 3:169206153-169206175 ATCCCAGTCCTGCCACAGACAGG - Intronic
965835601 3:172848493-172848515 ATCCCAGCTCTGCTATTTACTGG + Intergenic
965841109 3:172906670-172906692 TTCCTAGCTCTGCCATTTACTGG + Intronic
966113556 3:176432933-176432955 ATCATAGCTCTGCCACTTAGGGG - Intergenic
966187111 3:177237455-177237477 ATCTTGGCTCTGCCTCTTACTGG + Intergenic
966420996 3:179733866-179733888 TTCCCAGCTCTGCCACTCACTGG - Intronic
966571668 3:181450964-181450986 ATCCCAACTCTGCCACTTATTGG + Intergenic
966780156 3:183577420-183577442 ATCCCTGCTCTGCCACTTACTGG - Intergenic
966784783 3:183613395-183613417 ATCCCAGTTCTGCTACTTACTGG - Intergenic
966851155 3:184165862-184165884 TTCCTGGCTCTGCCACTTACTGG + Intronic
967391205 3:188956562-188956584 ATCCTGGCCCAGCCATTGACTGG + Intronic
967428374 3:189353607-189353629 GTCCTAGCTCTGCCTCTTACTGG - Intergenic
967450980 3:189622399-189622421 ATCCTGGCTCTACCACTATCTGG + Intergenic
967489948 3:190078987-190079009 ATCCTAGCTCAGTCACTTGCTGG + Intronic
967748757 3:193089360-193089382 ATTCTGGCTCTGCCAGTGACTGG + Intergenic
967787790 3:193515888-193515910 AGACTAGCTCTGCCACTTACTGG + Intronic
967972048 3:195006268-195006290 AACCTGGCTCTACCGCTGACTGG + Intergenic
967981808 3:195070244-195070266 GTCCCAGCTCTGCCACTTGCTGG - Intronic
968236094 3:197030542-197030564 CAGCTGGCTCTGCCACTGACTGG - Intergenic
968313420 3:197702754-197702776 ATTCTAGCTAAGGCACTGACTGG + Intronic
968819053 4:2836510-2836532 GTCCCACCTCTGCCACTAACTGG + Exonic
968825314 4:2891735-2891757 ATCCTAGCTCTGCCAAGAACTGG - Intronic
969152463 4:5181115-5181137 ATCCTAGCTCTGCCTCTAGCTGG + Intronic
969286914 4:6208324-6208346 ATCCTGGCTCTACCACTTTCCGG - Intergenic
969377639 4:6773393-6773415 GTCCCAGCTCTGCCACTCCCTGG + Intergenic
969437620 4:7197834-7197856 ATCCTGGCCCTGCCACTCTCTGG + Intronic
969451585 4:7276900-7276922 ATCCTGGCCCTACCACTGAGCGG - Intronic
969473263 4:7402542-7402564 ATCCTAGCTCTCCCACAGCAGGG - Intronic
969608398 4:8213564-8213586 ATCTCAGCTGAGCCACTGACAGG + Intronic
969635891 4:8369398-8369420 ATCCTGGCTCTGCCACTCCCTGG + Intronic
969938688 4:10708455-10708477 ACTCCAGCTCTGCCACTGATGGG - Intergenic
970129623 4:12853105-12853127 ATTCCAGGTCTTCCACTGACAGG - Intergenic
970344881 4:15143795-15143817 ATTCTGGCTCTGCCACTAATAGG + Intergenic
970532210 4:16996327-16996349 ATCCTGGCTCTGCCACCTCCTGG + Intergenic
970647091 4:18134986-18135008 TTCTAAGCTCTGCCACTGATAGG - Intergenic
970754228 4:19404864-19404886 ATTCTATTTCTGCCAGTGACCGG - Intergenic
970898898 4:21135773-21135795 ACCCAGGCTCTGCCACTTACTGG + Intronic
970904943 4:21204504-21204526 ATCCAGGCTCTGCCAATGATTGG + Intronic
971140126 4:23915983-23916005 ATCCTGGCTCTGCCATTTATAGG + Intergenic
971276557 4:25203421-25203443 ATTCTAGCTCTGTCTCTTACAGG - Intronic
971396194 4:26229639-26229661 ATCCCATCTCTGCCACTTACTGG + Intronic
971401002 4:26275305-26275327 ATCGCAGCTCTGCCACTTGCTGG + Intronic
971426618 4:26522188-26522210 ATCCCAGTTCTACCACTCACTGG - Intergenic
971646425 4:29211385-29211407 ATTATTGCTCTGCCACTTACTGG + Intergenic
972306661 4:37837246-37837268 AGCCTGGCTCTGCCACTAAGTGG + Intronic
972519481 4:39840184-39840206 CTCTTGGCTCTGCCACTCACTGG - Intronic
972608758 4:40637781-40637803 ATCCCATCTCTGCCACTTACTGG + Intergenic
972710415 4:41589503-41589525 ATCCCAGCTCTGCCCCTTCCTGG - Intronic
972802661 4:42493670-42493692 ATCCTTGCTCTGCCGCGTACTGG + Intronic
973019950 4:45190567-45190589 ATCCTAGTTCTTCTACTGCCTGG - Intergenic
973197483 4:47462713-47462735 GTTCCAGCTCTGCCACTAACTGG + Intronic
973804154 4:54509328-54509350 ATTCCGGCTCTGCCACTCACCGG + Intergenic
974408028 4:61501106-61501128 ATTCCAGCTCTGCCACCTACTGG + Intronic
975448005 4:74490159-74490181 ATCCTGGCTTTATCACTGACTGG + Intergenic
976128613 4:81859737-81859759 ATCCCAGCTCTGCCACTTATTGG - Intronic
976146656 4:82047983-82048005 GTCCTTGCTCTACCAATGACAGG - Intergenic
976398041 4:84578761-84578783 ATCCCAGCTCTGCCACCTACTGG - Intergenic
977604503 4:98968815-98968837 ATCCTAGCTCTGCTGCTTACTGG - Intergenic
977621208 4:99139833-99139855 GCCCCAGCTCTGCCACTTACTGG - Intronic
977917303 4:102608399-102608421 TTCATAGCTCTGTCACTTACTGG - Intronic
978629538 4:110728043-110728065 ATCCTGGCTCTAGCACTTACTGG + Intergenic
979733778 4:124056461-124056483 ATCCCAGGTCTACCACTTACTGG - Intergenic
980069958 4:128233729-128233751 TTTCTGGCTCTGCCACTCACTGG - Intergenic
981041557 4:140227640-140227662 ATCCTTGTTCTGCAACTTACTGG + Intergenic
981053486 4:140335259-140335281 ATCCCAGCTCTGCCACTTCCTGG + Intronic
981196925 4:141932022-141932044 ATCCAGGCTCTGCCACTAACTGG - Intergenic
981546254 4:145897114-145897136 ATCTCAGTTCTGCCACTAACTGG - Intronic
981767210 4:148264580-148264602 GTTCTAGCTCTGCCATTAACTGG + Intronic
981943864 4:150317763-150317785 ATCCTACTTCTGCCACTGACTGG + Intronic
982129838 4:152218595-152218617 GTCCTAGCTCTGCCACTTGCTGG + Intergenic
983585380 4:169348666-169348688 GACCTAGCTCAGCCACTGAGAGG + Intergenic
983769340 4:171529621-171529643 ATCGTGGCTCTGCCATTCACTGG + Intergenic
984193041 4:176627077-176627099 ATCCTAGATCTGCCTCTTATTGG + Intergenic
984281849 4:177679813-177679835 ATCTTAGCTCTGCTACTTTCTGG - Intergenic
984504932 4:180605407-180605429 ATTCTGGCTCTGCCACTGCCTGG + Intergenic
984740201 4:183154218-183154240 ATCCTGGCTCTGCCTTTCACTGG + Intronic
984913705 4:184700486-184700508 ACCCAAGCTCTGCCACTTACTGG - Intronic
985252006 4:188033722-188033744 ATCCTGGCTCGGCCGCTTACTGG + Intergenic
986698377 5:10378398-10378420 ATCCTGGTTCTGCCACTAACTGG - Intronic
986820113 5:11457523-11457545 GTCCTGGCCCTGCCACTCACTGG - Intronic
987043565 5:14085668-14085690 ATCCAAGCTCTGCCACTTTCTGG - Intergenic
987144184 5:14975946-14975968 ATCCCTGCTCTGCCATTGGCTGG + Intergenic
987220525 5:15786365-15786387 AACCTAGGTCTACCACTGCCTGG + Intronic
989085025 5:37666804-37666826 ATCCTGGCTCTGCCCCTTACTGG + Intronic
989342913 5:40396575-40396597 ATTCTAGTTATGCCACTAACTGG + Intergenic
989531498 5:42513068-42513090 GTCCCAGCTCTGCCATTGACAGG + Intronic
990049579 5:51480970-51480992 ATCCCAGCTGTGCCACTTACTGG - Intergenic
990150671 5:52813987-52814009 ATCCCAGCTCAGCCACTTGCTGG + Intronic
990576501 5:57128518-57128540 ATCCCAGCTCAGTTACTGACTGG + Intergenic
990627112 5:57626477-57626499 ATTCTAGCTCTTCTACTAACTGG + Intergenic
990982515 5:61614858-61614880 ATAGCAGCTCTGCCACTCACTGG - Intergenic
991024583 5:62016145-62016167 GTCTTGGCTCTGCCACTTACTGG - Intergenic
991401238 5:66253963-66253985 ATCCCAGCTCTGCCACTTAGGGG - Intergenic
991411021 5:66345909-66345931 ATCCCAGCTCTGCCACTTACAGG + Intergenic
991438293 5:66618325-66618347 ATCCTAACCCTGTCACTTACTGG - Intronic
991492784 5:67199406-67199428 ATCCCAGCTTTGCCACTCACTGG + Intergenic
992089609 5:73305197-73305219 ATCCTAGCTGAGCCATTGGCTGG + Intergenic
992160777 5:73999061-73999083 ATTCTGGCTCTGCCACTTACTGG - Intergenic
992349933 5:75918183-75918205 ATCCCAGCTCTGCGAATAACTGG - Intergenic
992597909 5:78364726-78364748 ATCCTGGCTTTGACACTAACTGG + Intronic
992975588 5:82115565-82115587 ATCCTACCTCTGCCATTTAATGG - Intronic
994725231 5:103427529-103427551 ATTTTAGCTCTGCCACTTCCCGG - Intergenic
994759599 5:103836379-103836401 GTGCTGGCTCTGCCACTCACTGG - Intergenic
995248463 5:109962193-109962215 ATCCTGGCCCTGCCATTTACTGG + Intergenic
995458154 5:112373656-112373678 ACCCTGGCTCTGCCACTTGCTGG - Intronic
995625599 5:114072718-114072740 ATCCTGGATCTACCACTAACTGG + Intergenic
995786687 5:115838413-115838435 ATCCTGGCTCTGCCACTTGCTGG + Intronic
995797924 5:115961736-115961758 TTCTTAGCTCTGCAACTGCCTGG - Intergenic
997589686 5:135065117-135065139 GCCCTGGCTCTGCCACTGACTGG + Intronic
997598561 5:135123925-135123947 ATCCTGGCTCTGACACCAACTGG - Intronic
997639274 5:135437950-135437972 ATCCCAGCTCTACCACTTACTGG - Intergenic
997647598 5:135491455-135491477 ATCCTGGCTCTGCCACTGTTTGG - Intergenic
997813464 5:136994357-136994379 ATCCCAGCTTTGCCACTCACTGG + Intronic
997998413 5:138604934-138604956 ATCCTAGCTCTACCACTTGATGG - Intergenic
998166880 5:139849215-139849237 ATCCCAGCTCTGCCACTTCTTGG - Intronic
998437236 5:142121904-142121926 ATCCATGCTGTGCCACTCACTGG + Intronic
998753476 5:145351124-145351146 ATCCCATCTCTGCCATTTACTGG - Intergenic
998792685 5:145782322-145782344 ATTCCAGCTCTGCCACTTACTGG + Intronic
998825420 5:146096567-146096589 ATCCTAACTCTGGCTCTTACTGG - Intronic
998892033 5:146756575-146756597 ATCCTAGCTCTGTCATTTTCTGG + Intronic
999092535 5:148949855-148949877 ATCCAAGCTCTGACACTTACAGG - Intronic
999126359 5:149249128-149249150 ATCCTGGCTCAGTCACTTACTGG - Intronic
999175152 5:149626951-149626973 ATCCTAACTCTGCCACTGAAGGG - Intronic
999345058 5:150810604-150810626 GTCCTGGATCTGCCACTTACTGG - Intergenic
999407594 5:151320944-151320966 ATCCTACCTCTGACACTTTCTGG + Intronic
999440418 5:151596299-151596321 ATCCTAGCTCTACCATTTAAAGG - Intergenic
999472142 5:151864475-151864497 GTCCTAGCTCTGCCACTCACTGG - Intronic
999803353 5:155058389-155058411 ATCCTGGCTCTACCACTTACAGG + Intergenic
999837989 5:155394982-155395004 ATCCTGGCTCTACCACCTACTGG - Intergenic
1000106954 5:158068862-158068884 ATCCCGGCTCTGCCACTTATTGG - Intergenic
1000191634 5:158916612-158916634 ATCCCATCTCTGCCACTTCCTGG - Intronic
1000232154 5:159326206-159326228 GTCCTAGGTCTGTCAATGACTGG - Intronic
1000332672 5:160218341-160218363 ATCCCAGCTCTGTCACTTACTGG - Intronic
1000668435 5:164028067-164028089 ATCCTGGCCTTGCCACTTACTGG + Intergenic
1001082864 5:168679830-168679852 ATCCTAGCTCTGCCACTTACTGG + Intronic
1001204057 5:169745588-169745610 ATTCTGGCTCTGACACTCACTGG + Intronic
1001525003 5:172422603-172422625 GCCTTAGCTCTGCCAATGACTGG + Intronic
1001593499 5:172882530-172882552 ATCCTAGCTCTGCCACTCACTGG + Intronic
1001712190 5:173787826-173787848 ATTTTAGCTCTGCTACTTACTGG + Intergenic
1001787963 5:174430252-174430274 ATCCCAGCTCTGCCTCTTCCTGG + Intergenic
1002027268 5:176404119-176404141 ATCCTGGTTCTGCCACTTCCTGG - Intronic
1002872861 6:1183077-1183099 ATCCCAGCTCTGTGACTGACTGG - Intergenic
1003378520 6:5601621-5601643 ACCTTGGCTCTGCCACTTACTGG + Intronic
1003547450 6:7071965-7071987 ATCCTAGCTCCGCTCCTCACTGG + Intergenic
1003609143 6:7592654-7592676 ATTCCATCTCTGCCACTTACTGG - Intronic
1003826715 6:9960936-9960958 ATTCTAGATCTGCCACTGTCTGG + Intronic
1003871792 6:10410069-10410091 CTCCTGGCTCTGCCTCTGGCCGG + Exonic
1004115201 6:12759890-12759912 ATCCTCACTCTGCCACTTACTGG + Intronic
1004174086 6:13323862-13323884 ATCCTAGCTCTGCCACTTACAGG + Intronic
1004352613 6:14903407-14903429 GTCCTCGCTCTGCCACTTCCTGG + Intergenic
1004523905 6:16387993-16388015 ATCTTGGCTCCTCCACTGACTGG - Intronic
1004538773 6:16528766-16528788 AACCTAGCTTTGTCACTTACTGG - Intronic
1004612336 6:17255300-17255322 ATCCTAGCTCTGCCTCTTACTGG - Intergenic
1004676847 6:17851015-17851037 ATCCCAGCTCTACCTCTTACTGG - Intronic
1005399602 6:25418102-25418124 ATTCTGGCTCTGCCACTTTCTGG - Intronic
1005695675 6:28350466-28350488 ATCCTGCCTCTGCCACTTACTGG + Intronic
1006396292 6:33789433-33789455 ACCCTAGCTCTGCCTCTGGCAGG + Intergenic
1006495173 6:34417688-34417710 ATCCCAGCACTGCCCCTTACTGG + Intronic
1006573491 6:35025386-35025408 GTCCTGGCTCTGCAATTGACTGG + Intronic
1006805083 6:36782906-36782928 ATCCTAGCTCTGCCACCTCCCGG + Intronic
1007369760 6:41418723-41418745 ATCTTAGCTTTGCCACTTTCTGG - Intergenic
1007398186 6:41589148-41589170 ATCCCAGCTCTGCCACTCACAGG - Intronic
1007687859 6:43677663-43677685 ATCCCAGCTCTGATACTGGCTGG + Intronic
1007819466 6:44550337-44550359 ATCTGAGCTCTACCACTTACTGG - Intergenic
1007826800 6:44606917-44606939 ATCCCAGCTCTGCCACACACTGG - Intergenic
1008063947 6:47027621-47027643 ATCCCAGCGGTGCCCCTGACTGG - Intronic
1008360367 6:50610228-50610250 ATCCTAGTACTACCACTCACTGG + Intergenic
1011743288 6:90385035-90385057 ATCCTGGCTCTGCCATTTACTGG + Intergenic
1011751066 6:90455168-90455190 AGCCTGGCTCTACCACTTACTGG + Intergenic
1011814566 6:91173348-91173370 ATCCTAGTCCTGCGAGTGACTGG - Intergenic
1012298906 6:97559774-97559796 ATCCTTGCTCTGCCACTGTTTGG + Intergenic
1012436867 6:99224281-99224303 ATCACAGCTCTGCGATTGACAGG + Intergenic
1012650846 6:101750502-101750524 ATACTAGCTATGCCACTGAGAGG - Intronic
1013372188 6:109480762-109480784 ATCCCAGCTCTGTCACTAACGGG + Intronic
1014168816 6:118255201-118255223 ATCCTGGCTCTGACATTGCCAGG + Intronic
1014482119 6:121951607-121951629 ATTCTAGCTCTGCCACTATCTGG - Intergenic
1015509246 6:134021679-134021701 ATCCCAGCTCTTCTACTTACTGG - Intronic
1015973028 6:138761779-138761801 ATCCTAGCTGTACTACTGGCTGG + Intronic
1016339837 6:143050698-143050720 ATCTTAGCTCTGCCATTGACAGG + Intergenic
1016356323 6:143222506-143222528 ATTTCAGCTCTGCCACTGTCTGG + Intronic
1016690253 6:146929849-146929871 ATTCTAGGTCTCCCACTTACTGG - Intergenic
1016897583 6:149068298-149068320 CTCCTACCTCTGCCACTTTCTGG + Intronic
1017031317 6:150225317-150225339 CTCCTACCTCTGCCCGTGACTGG + Intronic
1017655269 6:156621795-156621817 GTCCCAGCTTTGCCACTTACTGG + Intergenic
1018027041 6:159814706-159814728 ATCCCAGCTTTGCCACTCACTGG + Intronic
1018391643 6:163345826-163345848 ATCCTAGCTCAGCCTCAGAGGGG + Intergenic
1018668388 6:166160529-166160551 ATCCTGGTTCTGCCACTTACTGG - Intronic
1018889088 6:167968830-167968852 GGCCCAGCTCTGCCTCTGACTGG - Intronic
1018945410 6:168344522-168344544 AGCCCAGCTCTGACACTGCCTGG + Intergenic
1018945424 6:168344586-168344608 AGCCCAGCTCTGGCACTGCCTGG + Intergenic
1019767160 7:2860139-2860161 ATCCTGGCTCTGCCTGTAACTGG - Intergenic
1019790051 7:3005895-3005917 AACCTGGCTCTACCACTTACTGG + Intronic
1019818288 7:3217667-3217689 AATCCAGCTCTGCCACTGACTGG + Intergenic
1021136297 7:16968444-16968466 ATGCTAGCTTTGCCATTGATTGG - Intergenic
1021846844 7:24771541-24771563 ATCCTGGTTCTGCCACTTACTGG + Intergenic
1021975438 7:26007364-26007386 ATGCTGGCTCAGCCACTAACTGG - Intergenic
1022032598 7:26505913-26505935 ATGCTGGCTCTACCACTTACAGG + Intergenic
1022412950 7:30153538-30153560 ATCCTGGCTCTGCCACTTACTGG + Intronic
1022472104 7:30688408-30688430 ATCCTAGCTCTTCCACCCAGCGG - Intronic
1022508900 7:30922914-30922936 ATCCTGGCTCAGCCACTTTCGGG + Intronic
1022552888 7:31258640-31258662 ATCCTAGCTCTTTCACTTAATGG + Intergenic
1022620548 7:31979567-31979589 ATCCTGGCTCTGCCATTTACTGG - Intronic
1023344919 7:39261625-39261647 ATCCCGCCTCTGCCACTTACAGG - Intronic
1024254016 7:47526547-47526569 GTCCTGGCCCTGCCCCTGACAGG - Intronic
1024486074 7:49921474-49921496 ATCCCAGTTCTACCACTTACTGG + Exonic
1024499701 7:50091894-50091916 ATCCTAATTCTGCCACTTACTGG + Intronic
1025012959 7:55413630-55413652 AGCACGGCTCTGCCACTGACGGG + Intronic
1025749077 7:64275674-64275696 ATCCTGGTTCTGCCACTTATGGG + Intergenic
1025794912 7:64730387-64730409 ATCCCAGTTCTGCCACTTATGGG + Intergenic
1026003298 7:66580426-66580448 ACCCCAGCTCTGCCACGTACTGG + Intergenic
1026028241 7:66765236-66765258 ACCCCAGCTCTGCCACGTACTGG - Intronic
1026232802 7:68499963-68499985 ATCCTGGCTCTGTCTCTTACTGG + Intergenic
1026288622 7:68986049-68986071 TTCCAAGCTCAGTCACTGACTGG - Intergenic
1026291314 7:69008705-69008727 ATCTTGGTTCTGCCACTGATAGG + Intergenic
1026455325 7:70567418-70567440 ATCCTGGTTCTGCCACTCTCTGG + Intronic
1026537190 7:71248638-71248660 ATCCTAGCTTTGTCAATGAATGG + Intronic
1026673189 7:72407174-72407196 ATCCTGGCTGTGCCACTTAGGGG + Intronic
1026984544 7:74546632-74546654 ACCCGATCTCTGCCACTGAGTGG - Intronic
1028099641 7:86804274-86804296 ATTCTAGATCTGCCACTGCATGG + Intronic
1030511388 7:110486705-110486727 AGTCTAGTTCTGCCACTTACTGG + Intergenic
1030671305 7:112340207-112340229 ATTCCAGCTCTGGCACTTACTGG + Intronic
1031020088 7:116618428-116618450 ATCCTGGCTCTGACACTTACTGG + Intergenic
1031857387 7:126938890-126938912 ATCCTAGTTCTCCCAATTACAGG + Intronic
1032084741 7:128878009-128878031 AGCCTTGCTTTGCCACTCACTGG - Intronic
1032222160 7:130002594-130002616 GTCCTAGCTCTGCCACTCACTGG + Intergenic
1032402339 7:131632474-131632496 ATGCCAGTTCTGCCACTGACTGG - Intergenic
1032540922 7:132702536-132702558 ATCCAAGCTCTGACACTTACAGG - Intronic
1032595342 7:133234073-133234095 ATCCTTTTTCTGCCACTTACTGG - Intergenic
1033128694 7:138726804-138726826 ATGATAGCTCTGAAACTGACTGG - Intronic
1033442659 7:141394422-141394444 AGCCCAGCTCTGCCAGTCACTGG + Intronic
1033637673 7:143226992-143227014 GTCCTGGCTCTGCCACTTACTGG + Intergenic
1034189547 7:149203331-149203353 ATCCTGACTTTGCCACTTACTGG + Intronic
1034201783 7:149287265-149287287 ATCCCAGCTCTACCACTCACTGG - Intronic
1034442546 7:151093787-151093809 GTCCCTGCTCTGCCACTAACTGG + Intronic
1034475934 7:151282025-151282047 ATCCCAGCTCTGCCACTTTCTGG - Intergenic
1034884989 7:154792579-154792601 ATCCTGGCCCTGGCACTGACAGG - Intronic
1035045712 7:155964095-155964117 ATCCTAACTCAGCCACTTACTGG - Intronic
1036112181 8:5915307-5915329 TTAGTATCTCTGCCACTGACAGG + Intergenic
1036414650 8:8535755-8535777 ATCCCAGATCTGCCATTTACTGG - Intergenic
1037276107 8:17180729-17180751 ATCCTGCCTCTGCCACTTGCTGG - Intronic
1037389944 8:18382875-18382897 AGCCTAGCTCTGACAATGACAGG + Intergenic
1037750103 8:21676065-21676087 ATCCCAGATCTGCCACTAACTGG + Intergenic
1037785221 8:21898932-21898954 ATCCCAGGTCTGCCACTAACTGG - Intergenic
1038494826 8:27993960-27993982 ATACTAGCTCTGCCACTTACTGG - Intergenic
1038668309 8:29560963-29560985 ATCACAGCTCTGCAACTTACTGG - Intergenic
1038793098 8:30686050-30686072 ATCCTAGCTCTGCAACTTACCGG + Intronic
1038952487 8:32431135-32431157 ATCCCAACTCTGCCACTAACTGG - Intronic
1039272930 8:35902833-35902855 ATCTTAGCTCTGCCACACATAGG - Intergenic
1039518231 8:38150658-38150680 ATCCTAGTTGTGCCTCTTACTGG - Intronic
1039803951 8:40983028-40983050 GTCCTAGCTCTGCTGTTGACTGG + Intergenic
1039917560 8:41871208-41871230 ATCTTCTCTCTCCCACTGACTGG + Intronic
1040385243 8:46910929-46910951 ACCCTAGCTCTGTCACACACTGG - Intergenic
1041694731 8:60723973-60723995 ACCTCCGCTCTGCCACTGACTGG + Intronic
1042027633 8:64440854-64440876 TTCCCAGCTCTGCCACTTAGTGG - Intergenic
1042325460 8:67523081-67523103 ATCCCAGCTCTGCCACTTGTAGG + Intronic
1042718384 8:71800996-71801018 ATCCTGACTCTGCCATTGCCTGG + Intergenic
1043565936 8:81547741-81547763 ATCCTATTTCTGACACTGGCAGG - Intergenic
1043867477 8:85392503-85392525 ATATTAGCTCTTCAACTGACTGG - Intronic
1044103332 8:88169466-88169488 AACCCAGCTCTGCCACTTAGAGG - Intronic
1044604033 8:94033497-94033519 ATCCTAGCCCCACCACTTACTGG - Intergenic
1044717105 8:95110618-95110640 ATCCCAGCTTTGCTACTTACTGG - Intronic
1044906672 8:97011595-97011617 ATCCTGGCTCTGACACTTATTGG + Intronic
1045166783 8:99615316-99615338 ATCCTGGCGCTACCACTTACTGG + Intronic
1045255471 8:100516980-100517002 ATCCCAGCTCTGCCGCTTACTGG + Intronic
1046046243 8:108968345-108968367 ATCCTGGCTTTACCACTAACTGG + Intergenic
1046103745 8:109643962-109643984 CTCCAACCTCTGCCACTGAAAGG + Intronic
1046135532 8:110021217-110021239 ACTCCAACTCTGCCACTGACTGG + Intergenic
1046740271 8:117820275-117820297 ATCCCAGATCTACCACTTACTGG + Intronic
1046861656 8:119099523-119099545 ATCCTGGCTTTGCCACTTACTGG - Intronic
1047228771 8:122978380-122978402 ATCCTGCCTATGCCACAGACTGG - Intergenic
1047281197 8:123447590-123447612 ATCCTGGCTCTACTACTTACTGG - Intronic
1047305145 8:123646482-123646504 ATCCTGGCTCTGTCACTAACTGG - Intronic
1047765144 8:127984393-127984415 ATCCTAGCTCTGCCACTTGCTGG - Intergenic
1047773103 8:128046385-128046407 ATCCCAGCTCTGCCATTCCCAGG - Intergenic
1047824239 8:128555816-128555838 ATACTAGCTGTGCCACTAAATGG - Intergenic
1047861930 8:128976475-128976497 GTCTTAGCTCTGCCACTTGCTGG + Intergenic
1048167418 8:132075916-132075938 ATCTTAGCTCAGCCATTTACTGG - Intronic
1048186644 8:132248037-132248059 ATCCTAGCTCTGCCACTTCCTGG - Intronic
1048273683 8:133049543-133049565 ATCCTGCCTCTGTCACTTACTGG - Intronic
1048329115 8:133460338-133460360 ATCCCAGCTCTGCCACTCCGTGG + Intronic
1048335479 8:133499115-133499137 ATCCCAGCTCTGCCACTTACCGG + Exonic
1048883773 8:138892282-138892304 ATCCTAGCTTTGCCACTTGGTGG + Intronic
1049563930 8:143327651-143327673 TTCCTAGCTCTGCTAGTGACTGG + Intronic
1049934362 9:486551-486573 ATCCTGCCTCTGCTACTCACAGG - Intronic
1050116699 9:2270954-2270976 ATTCTAGCTCTGCCACTTGCTGG - Intergenic
1050285094 9:4093178-4093200 ATCATGACTCTGCCACTTACAGG - Intronic
1050301952 9:4268139-4268161 ATCCTGACTCTGCCACTTACAGG + Intronic
1050336765 9:4597132-4597154 ATCCTAGTTCTGCCATTTACAGG - Intronic
1050661394 9:7886712-7886734 ATCCTGGGTCTGCCACACACTGG + Intronic
1051042003 9:12823196-12823218 ATCCTGGCTTTGACACTTACTGG - Intergenic
1051590490 9:18772524-18772546 ATCCTGACTCTGCCACTTACTGG + Intronic
1051683197 9:19629165-19629187 ATCTGAGCTCTGCCACTTGCTGG - Intronic
1051831469 9:21283427-21283449 TTCCTATCTCTGTCACTGAGAGG - Intergenic
1052396118 9:27940433-27940455 CTACTATTTCTGCCACTGACTGG - Intergenic
1052742103 9:32403172-32403194 AACCTAGCTCTGCCTCTTACTGG + Intronic
1052843303 9:33312245-33312267 ATCCTGGTTCTGTCACTTACTGG + Intronic
1053048405 9:34938540-34938562 ATCATAGCTCTGACACTTACTGG + Intergenic
1053361709 9:37492339-37492361 ATCCTGTCTCTGCCACTACCTGG + Intronic
1053372588 9:37575567-37575589 ATCACAGTTCTGCCACTTACTGG - Intronic
1053433592 9:38060136-38060158 ATCTCATCTCTGCCACTTACTGG + Intronic
1053685922 9:40522438-40522460 ATCCCAGCTCTTCCACTTTCTGG + Intergenic
1053711335 9:40812471-40812493 ATCCCAGCTCTTCCACTTTCTGG + Intergenic
1053935872 9:43150711-43150733 ATCCCAGCTCTTCCACTTTCTGG + Intergenic
1054277813 9:63102531-63102553 ATCCCAGCTCTTCCACTTTCTGG - Intergenic
1054299003 9:63357891-63357913 ATCCCAGCTCTTCCACTTTCTGG + Intergenic
1054397023 9:64662399-64662421 ATCCCAGCTCTTCCACTTTCTGG + Intergenic
1054421246 9:64933288-64933310 ATCCCAGCTCTTCCACTTTCTGG + Intergenic
1054431665 9:65167591-65167613 ATCCCAGCTCTTCCACTTTCTGG + Intergenic
1054498713 9:65853916-65853938 ATCCCAGCTCTTCCACTTTCTGG - Intergenic
1055053388 9:72001426-72001448 AACCTAGTGCTGCCACTGATAGG + Intergenic
1055703932 9:78977591-78977613 ATTCTGCCTCTGCCACTGACTGG - Intergenic
1055743215 9:79412371-79412393 ATCCTGGCCCTGCCACTTACTGG + Intergenic
1056109660 9:83382526-83382548 ATCCTATCTCTGCCACCTGCTGG - Intronic
1056901960 9:90608128-90608150 ATCCTCACTCTGCCACGGAATGG - Intergenic
1057092701 9:92273913-92273935 ATCATGGCACTGCCACTAACGGG - Intronic
1057574767 9:96233331-96233353 ACGCCAGCTCTGCCACTCACTGG + Intergenic
1057772537 9:97981720-97981742 ATCCTAGCTCTGCTTCTTGCTGG + Intergenic
1057824087 9:98358933-98358955 ATCCAGGCTCTGCCACTCACTGG + Intronic
1058439035 9:104990909-104990931 GTCCAGGCTCTGCCACCGACGGG - Intergenic
1058888789 9:109343295-109343317 AGCCTAGCTCTGTCGCTGACTGG - Intergenic
1058911264 9:109522001-109522023 ATTCCAGCTCTGCCACTGACAGG - Intergenic
1058951550 9:109908424-109908446 ATCCCAGCTCTGCCACTTACTGG + Intronic
1059159599 9:112021484-112021506 ATCCTAGCTCTGCTAGGTACTGG + Intergenic
1059321419 9:113473335-113473357 ACCCCAGCTCTGCCACTTACTGG + Intronic
1059356955 9:113707349-113707371 ATCCCAGCTCTACCACTTACGGG - Intergenic
1059395095 9:114029108-114029130 GTCCCAGCTCTGCCTCTGGCTGG + Intronic
1059457013 9:114406181-114406203 ATCCCGGCTCTGCCACTGACTGG - Intronic
1059697331 9:116741588-116741610 ATCTTGGCTCTGTCACTGGCTGG + Intronic
1059719084 9:116941947-116941969 ATCCTGGCTTTGCTACTGAAAGG + Intronic
1059739219 9:117133372-117133394 ATCCTAGCTCTGCCACTGACTGG - Intronic
1059765294 9:117378415-117378437 ATGCTATCTCTGCCACTGGCTGG + Intronic
1059838326 9:118182821-118182843 ATTCTAGCTCTGTCACTTACAGG - Intergenic
1059902159 9:118939989-118940011 GACCTGGCTCTGCCACTAACTGG + Intergenic
1060269185 9:122128905-122128927 AACCCAGCTCTGCCACTTTCTGG + Intergenic
1060454970 9:123783648-123783670 ATCCTGGCTCTGCCATTTACAGG - Intronic
1060476477 9:123990696-123990718 ATCCCAGCTCTGCCATTCTCTGG + Intergenic
1060665926 9:125432131-125432153 ATCCTAGTGCTGCCACTTGCTGG - Intergenic
1060698160 9:125727949-125727971 ATCCCAGCTCTGCTACTCTCTGG + Intergenic
1060699519 9:125738660-125738682 ATCCTAGCTCCACCACTAAATGG - Intergenic
1060741384 9:126099763-126099785 CTCCTGGCTCTGCCACTTCCTGG + Intergenic
1060939275 9:127534437-127534459 ATCCCAGCTCTACCACCCACTGG - Intronic
1060944423 9:127561557-127561579 GTCCTGGCTCTGCCACTGGATGG - Intronic
1060972914 9:127748989-127749011 GTCCCAGCTCTGCCACTCGCTGG - Intronic
1061048407 9:128179988-128180010 ATGCTGGCTCTACCACTTACAGG + Intronic
1061092330 9:128433712-128433734 ATCCCAGCTCTGCCACTTCCTGG + Intronic
1061282114 9:129603291-129603313 ATCCTGGCTTTGCCACTTCCTGG + Intergenic
1061285782 9:129621721-129621743 CTCCCAGCTCTGACACTGAGGGG + Intronic
1061303490 9:129719554-129719576 ATCCCAGCCCTGCCACTTACTGG + Intronic
1061384557 9:130281246-130281268 ATCCCAGCACTGCCACTTATTGG + Intergenic
1061505663 9:131030527-131030549 ATCCCAGCTCTGCCATGCACTGG + Intronic
1061518168 9:131101711-131101733 ATCCCAGATCTGCCACTTCCTGG - Intronic
1061622064 9:131817171-131817193 ATCTCAGCTCTGCCTCTTACTGG - Intergenic
1061906306 9:133701071-133701093 ACCATAACTCTGCCACTGCCTGG - Intronic
1062218430 9:135401662-135401684 ATCCTGGCCCTGCCACTTACAGG - Intergenic
1186358040 X:8807817-8807839 AGCTTGGCTCTGCCTCTGACTGG - Intergenic
1186505621 X:10089747-10089769 CACCCAGCTCTGCCACTCACTGG - Intronic
1186617459 X:11204338-11204360 AGCTTGGCTCTGCCTCTGACTGG + Intronic
1186724503 X:12342927-12342949 ATCCCAGCTCTACCTCTTACTGG - Intronic
1187424166 X:19162146-19162168 ATCTCAGCTCTACCACTAACTGG + Intergenic
1187696986 X:21932811-21932833 AGCCTCACTCTGCCACAGACTGG + Intergenic
1187941894 X:24390701-24390723 TTGCTGGCTCTGCCACTTACTGG + Intergenic
1187975079 X:24696764-24696786 ATTCCAGCTCTGCCATTTACTGG - Intronic
1188184552 X:27097904-27097926 ATCCAAGCTCTGCTACCTACTGG - Intergenic
1188218378 X:27508159-27508181 ATCCTAGCTTTGCAACTCAAGGG - Intergenic
1188411666 X:29880007-29880029 ATCCAAGCTTTGCAACTGAATGG - Intronic
1188585753 X:31772701-31772723 ATCCTTGTTCTGCTACTTACTGG + Intronic
1189167286 X:38872722-38872744 ATCCCAGCACTGCCACTTATTGG - Intergenic
1189288684 X:39870195-39870217 ATCCAGGCTCTGCCACTAACTGG - Intergenic
1189599127 X:42602836-42602858 ATCCTCGCTCTGCAACTTTCTGG + Intergenic
1189647060 X:43144774-43144796 ATCCCAGGTGGGCCACTGACTGG - Intergenic
1190032733 X:46990392-46990414 ATCCTAGCTCTTTCACTCTCTGG + Intronic
1190337716 X:49272353-49272375 ATCCTGGCGCTGCCACTTACTGG + Intronic
1190472673 X:50798594-50798616 ATCACAGCTCTACCACTTACTGG + Intronic
1190734567 X:53247566-53247588 ATCCTGGCTCTGCCACTTTAGGG - Intronic
1191678148 X:63813302-63813324 ATCCCAGATCTGCCACTTACTGG + Intergenic
1191682328 X:63853830-63853852 ATCTCAGCTCTGCCACTCACTGG - Intergenic
1191724159 X:64261304-64261326 GTCCTGGCTCTGCCATTCACTGG - Intergenic
1192537378 X:71939634-71939656 ATTCCAGATCTGCCACTGATTGG + Intergenic
1194650428 X:96508087-96508109 ACCCCAACTCTGCCACTTACTGG - Intergenic
1194790308 X:98139940-98139962 ATCCCAGCTCTACCACTAATTGG + Intergenic
1195078138 X:101346945-101346967 ATCCCAGCTCTGCCATTTTCTGG - Intronic
1196132591 X:112173402-112173424 ATCCCAGCTCTGCCGCTTACTGG + Intergenic
1196188181 X:112766680-112766702 ATCCTAGCTCAGCTACTTACAGG - Intergenic
1196282772 X:113842612-113842634 ATCCCAGCTCTGCCACTTACTGG + Intergenic
1196406118 X:115364465-115364487 AAGTTAGCTCTGCCACTTACTGG - Intergenic
1196749460 X:119101836-119101858 ATCCTAGCTATACCACTTATTGG + Intronic
1196798273 X:119520013-119520035 GTCCTGGCTCTGTCACTTACTGG - Intergenic
1196845310 X:119892525-119892547 ATCCGAGCTCTGCCACATACTGG - Intergenic
1196928838 X:120661063-120661085 ATCCTAGCTCTGCAACATATTGG - Intergenic
1197772033 X:130095219-130095241 ACCCCGGCTCTGCCACTTACTGG - Intronic
1197835904 X:130693479-130693501 ATTCTAGGTCTGCCTCTTACTGG - Intronic
1197896911 X:131325942-131325964 ATCCCAGCTTTGCCACTTACTGG + Intronic
1198015393 X:132605224-132605246 ATCCTGGCCCTGCCACTCACTGG - Intergenic
1198026688 X:132714188-132714210 ATGCCAGCTCTGCCATTAACTGG + Intronic
1198032201 X:132764274-132764296 ACTCTGGCTCTGCCACTGACTGG - Intronic
1198208051 X:134487565-134487587 ATTCAAGCTCTACCACTTACTGG - Intronic
1198477966 X:137014157-137014179 ATCATGGCTCTACCACTTACTGG - Intergenic
1198570316 X:137948052-137948074 ATCCCAGCTCTGCCATTAGCTGG + Intergenic
1198637486 X:138715257-138715279 ATCCTATCTCTGCCACTAATTGG + Intronic
1198659252 X:138949022-138949044 ATCCTGGCCCAGCTACTGACTGG - Intronic
1198777940 X:140200737-140200759 ATCCTAGCAATGCCACTCATGGG - Intergenic
1198816259 X:140594266-140594288 AGCCTGGCTCTGCCACTCACTGG - Intergenic
1198829261 X:140731347-140731369 ATCCTGGCTCTACCACTCCCTGG + Intergenic
1198829277 X:140731458-140731480 ATTCTGTCTCTGCCACTTACTGG + Intergenic
1199191780 X:144979945-144979967 CTACTAGCTCAGCCACTGAAGGG + Intergenic
1199907415 X:152247502-152247524 ATACCAGCTCTGCCACTTATTGG + Intronic